Bacillus amyloliquefaciens with high yield of 1-deoxynojirimycin as well as construction method and application of bacillus amyloliquefaciens
By knocking out the yjbQ gene in Bacillus amyloliquefaciens, a high-yield 1-deoxynojirimycin-producing Bacillus amyloliquefaciens strain, LX-12△yjbQ, was constructed, solving the problem of low yield and achieving a significant increase in the yield of 1-deoxynojirimycin.
Patent Information
- Application Number
- CN202511998029.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-28
- Publication Date
- 2026-04-07
AI Technical Summary
The existing technology yields low levels of 1-deoxynojirimycin from Bacillus amyloliquefaciens, which is insufficient to meet the demands of high-efficiency production.
By knocking out the secondary thiamine phosphate synthase gene yjbQ, a high-yield 1-deoxynojirimycin-producing Bacillus amyloliquefaciens LX-12△yjbQ was constructed, and fermentation conditions were optimized to increase yield.
It significantly increased the yield of 1-deoxynojirimycin by at least 26.17% and up to 37.25%, providing a new strategy for the efficient production of 1-deoxynojirimycin.
Smart Images

Figure SMS_1 
Figure SMS_2
Abstract
Description
Technical Field
[0001] This invention relates to the fields of genetic engineering and microbiology, specifically to a high-yield 1-deoxynojirimycin-producing Bacillus amyloliquefaciens, its construction method, and its applications; achieved by knocking out the secondary thiamine phosphate synthase gene. yjbQ Increase the yield of Bacillus 1-deoxynojirimycin. Background Technology
[0002] 1-Deoxynojirimycin (1-DNJ) is a polyhydroxypiperidine alkaloid with strong α-glucosidase inhibitory activity. It is a natural hypoglycemic active ingredient and can be used as a raw material for treating non-insulin-dependent diabetes mellitus. In addition, 1-Deoxynojirimycin also possesses various biological activities such as anti-obesity and antiviral activity, making it extremely valuable for pharmaceutical applications.
[0003] yjbQ The gene is an important colonization-related gene in Bacillus amyloliquefaciens, playing a crucial role in bacterial biofilm formation and other processes by influencing the synthesis of extracellular polysaccharides. This patent addresses this by knocking out the secondary thiamine phosphate synthase gene in Bacillus amyloliquefaciens LX-12. yjbQ This significantly increased the yield of 1-deoxynojirimycin. This invention is the first to achieve this by knocking out the secondary thiamine phosphate synthase gene. yjbQ This provides a new strategy for increasing the yield of 1-deoxynojirimycin. Summary of the Invention
[0004] The purpose of this invention is to provide a Bacillus amyloliquefaciens that produces high levels of 1-deoxynojirimycin, its construction method, and its applications, achieved by knocking out the secondary thiamine phosphate synthase gene. yjbQ To construct a high-yield 1-deoxynojirimycin-producing Bacillus amyloliquefaciens, and to increase the yield of 1-deoxynojirimycin through fermentation, providing a new strategy for high-yield production of 1-deoxynojirimycin.
[0005] In a first aspect, the present invention provides a Bacillus amyloliquefaciens strain that produces high levels of 1-deoxynojirimycin, achieved by knocking out the secondary thiamine phosphate synthase gene within the genome of Bacillus amyloliquefaciens. yjbQ The high-yielding 1-deoxynojirimycin-producing Bacillus amyloliquefaciens, namely Bacillus amyloliquefaciens LX-12△, was constructed. yjbQ The gene yjbQ The nucleotide sequence is shown in SEQ ID NO.1 of the sequence listing.
[0006] Secondly, the present invention provides the aforementioned Bacillus amyloliquefaciens LX-12△ yjbQ Construction method ,The steps include: S1, using Bacillus amyloliquefaciens LX-12 genomic DNA as a template, amplifying with primer pairs Y-F1 and Y-F2 to obtain the sample shown in SEQ ID NO. 6. yjbQ The upstream homologous arm gene fragment; amplified using Y-F2 and Y-R2 primer pairs to obtain the result shown in SEQ ID NO. 7. yjbQ Downstream homologous arm gene fragment; S2, via overlap extension PCR to... yjbQ The upstream and downstream homologous arms of a gene are joined together to form the target gene fragment: yjbQ upstream homologous arm of a gene - yjbQ Downstream homologous arm of the gene; S3, double digestion of the target gene fragment obtained in step S2 with restriction endonucleases to obtain the digested gene fragment, double digestion of the plasmid vector with the same restriction endonuclease to obtain the linear plasmid fragment; S4, ligation of the digested gene fragment and the linear plasmid fragment obtained in step S3 with ligase, transformation of the ligation product into Escherichia coli DH5α, selection of kanamycin resistance as a selection marker, and verification by colony PCR and sequencing to obtain the knockout plasmid; S5, transformation of the knockout plasmid obtained in step S4 into Bacillus amyloliquefaciens, selection of positive transformants using kanamycin resistance as a selection marker; S6, transformation of the positive transformants obtained in step S5 into colony PCR detection to obtain... yjbQ Positive single crossover conjugate strains of the upstream homologous arm of the gene and yjbQ S7. Positive single crossover binding strains of the downstream homologous arm of the gene; S8. Mix the two positive single crossover binding strains obtained in step S6 and inoculate them into a culture medium for transculturing, then screen for the deletion. yjbQ The engineered strain of Bacillus amyloliquefaciens, namely Bacillus amyloliquefaciens LX-12. △yjbQ .
[0007] Preferably, in step S1, the Bacillus amyloliquefaciens serving as the genome template is Bacillus amyloliquefaciens LX-12.
[0008] Preferably, in step S1, the nucleotide sequence of Y-F1 is shown in SEQ ID NO.2, the nucleotide sequence of Y-R1 is shown in SEQ ID NO.3, the nucleotide sequence of Y-F2 is shown in SEQ ID NO.4, and the nucleotide sequence of Y-R2 is shown in SEQ ID NO.5.
[0009] Preferably, in step S3, the restriction endonuclease is SacI and XbaI, and the plasmid is T2(2)-ori.
[0010] Preferably, in step S6, the positive transformants are transferred and cultured at 45°C.
[0011] Preferably, in step S7, the culture medium is a culture medium that does not contain kanamycin, and the transfer culture temperature is 37°C.
[0012] Thirdly, the present invention also provides the application of the knockout plasmid and the engineered Bacillus amyloliquefaciens in increasing the yield of Bacillus 1-deoxynojirimycin.
[0013] Finally, the present invention also provides a method for increasing the yield of 1-deoxynojirimycin from Bacillus, comprising the steps of: constructing engineered bacteria using the above-mentioned method for constructing high-yield 1-deoxynojirimycin-producing Bacillus amyloliquefaciens and then fermenting the culture medium, wherein the fermentation medium comprises: 60-100 g / L soybean meal, 50-90 g / L corn starch, 0.5-0.9 g / L KH2PO4, 0.2-0.6 g / L MgSO4•7H2O, 0.1-0.5 g / L FeSO4•7H2O, and adjusting the pH to 6.5-7.0.
[0014] Preferably, the application and method include the following steps: (1) Seed culture: First, Bacillus amyloliquefaciens was activated by inoculating it into 5 mL of LB medium at a volume percentage of 1% from a glycerol tube and culturing at 180 r / min and 37℃ for 10 hours. Then, the activated bacterial solution was inoculated into the seed fermentation medium at a volume percentage of 1% and cultured at 180 r / min and 37℃ for 10 hours to obtain the seed culture solution. The seed fermentation medium was LB medium with the following formula: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, pH 7.2.
[0015] (2) Fermentation culture: The bacterial culture of the seed culture was inoculated into the fermentation medium at an inoculation amount of 3% (volume percentage), the rotation speed was 180 r / min, the temperature was 37℃, and the fermentation culture was carried out for 48 hours to obtain the bacterial culture for production fermentation.
[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention is the first attempt to achieve this through missing... yjbQ This invention utilizes genes to increase the yield of 1-deoxynojirimycin, providing a novel strategy for improving 1-deoxynojirimycin production. Compared to Bacillus amyloliquefaciens LX-12, the Bacillus amyloliquefaciens LX-12 constructed using this invention exhibits significantly higher yields. yjbQ The yield of 1-deoxynojirimycin, compared with the original bacterium Bacillus amyloliquefaciens LX-12, was significantly higher in the engineered strain LX-12. yjbQ The yield of 1-deoxynojirimycin J was increased by at least 26.17%, and up to 37.25%. The results of this invention indicate that the deletion of the secondary thiamine phosphate synthase gene... yjbQIncreasing the yield of 1-deoxynojirimycin is a very effective method. Detailed Implementation
[0017] The present invention will be further illustrated below with specific implementation examples, using *Bacillus amyloliquefaciens* LX-12 as the starting bacterium. These implementation examples are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following implementation examples that do not specify specific conditions are generally performed under conventional conditions or as recommended by the manufacturer. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent suppliers.
[0018] Example 1: Construction of a vector containing knockout T2(2)-Δ yjbQ Bacillus amyloliquefaciens LX-12 The construction method includes the following steps: 1. Based on the genomic DNA sequence of Bacillus amyloliquefaciens LX-12 yjbQ Design of upstream and downstream gene sequences yjbQ The upstream homologous arm primers (Y-F1, as shown in SEQ ID NO.2 and Y-R1, as shown in SEQ ID NO.3) and the downstream homologous arm primers (Y-F2, as shown in SEQ ID NO.4 and Y-R2, as shown in SEQ ID NO.5) were used to amplify the gene using Bacillus amyloliquefaciens LX-12 genomic DNA as a template. yjbQ The upstream homologous arm (820 bp) of the gene is shown in SEQ ID NO. 6 and yjbQ The downstream homologous arm of the gene (816 bp) is shown in SEQ ID NO.7.
[0019] The sequences Y-F1, Y-R1, Y-F2, and Y-R2 are as follows: Y-F1 (SEQ ID NO.2):GCTCTAGAgcgcctgttttcccgaaaac Y-R1 (SEQ ID NO.3): tatatgctgaaaaaacaaatgagtgagtggatgagt Y-F2 (SEQ ID NO.4): actcatccactcactcatttgttttttcagcatatagatgc Y-R2 (SEQ ID NO.5): CGAGCTCatcagccccgctccgtctcg 2. Using overlap extension PCR to... yjbQThe upstream and downstream homologous arms of the gene are joined together (using primers Y-F1, as shown in SEQ ID NO.2 and Y-R2, as shown in SEQ ID NO.5) to form the target gene fragment (1636 bp, as shown in SEQ ID NO.8). The sequence of this target gene fragment is as follows: yjbQ upstream homologous arm of a gene - yjbQ Downstream homologous arm of the gene.
[0020] 3. The target gene fragment was double-digested with SacI and XbaI restriction endonucleases to obtain the digested gene fragment (1608 bp, as shown in SEQ ID NO.9). At the same time, the plasmid T2(2)-ori was double-digested with SacI and XbaI restriction endonucleases to obtain the linear plasmid fragment (4100 bp backbone fragment, as shown in SEQ ID NO.10). The restriction endonucleases SacI and XbaI were purchased from Beijing TransGen Biotech Co., Ltd.
[0021] 4. The enzyme-digested gene fragment and the linear plasmid fragment were ligated using T4 DNA ligase to obtain the ligation product. The ligation product was transformed into E. coli DH5α by calcium chloride conversion. Transformants were screened in a medium containing kanamycin resistance at 37°C to obtain transformants. The plasmids of the transformants were selected for colony PCR verification (the primers used were: T2-F, as shown in SEQ ID NO.11 and T2-R, as shown in SEQ ID NO.12). If the PCR verification result of the transformant showed an electrophoretic band at the 1970bp target fragment (as shown in SEQ ID NO.13), it indicated that the knockout vector was successfully constructed. The above transformants were positive transformants and named: knockout vector T2(2)-△ yjbQ .
[0022] 5. Knockout vector T2(2)-△ yjbQ Transformations were performed using electroporation into Bacillus amyloliquefaciens LX-12. Transformants were screened at 37°C using a kanamycin-resistant medium. Plasmids from the transformants were then selected for colony PCR verification (primers used were T2-F, as shown in SEQ ID NO. 11, and T2-R, as shown in SEQ ID NO. 12). If the PCR verification result of the transformant showed an electrophoretic band at the 1970 bp target fragment (as shown in SEQ ID NO. 13), it proved that the T2(2)-Δ knockout vector was effective. yjbQ The transformant was successfully transferred into Bacillus amyloliquefaciens LX-12. At this point, the transformant was a positive transformant (i.e., it was transformed into the knockout vector T2(2)-Δ). yjbQ Bacillus amyloliquefaciens LX-12).
[0023] 6. The positive transformants obtained in step (5) were cultured three times at 45°C on a medium containing kanamycin resistance, each time for 12 hours, and the cultures were divided into T2-F and ΔF. yjbQ -KYR is used as a primer (or T2-R and Δ) yjbQ Using KYF as primers, colony PCR was performed to detect single-exchange strains. A band of 1313 bp (SEQ ID NO.16) or 2119 bp (SEQ ID NO.17) was amplified, which proved that it was a single-exchange strain. Among them, △ yjbQ -KYR and △ yjbQ The sequence of -KYF is: △ yjbQ -KYF (SEQ ID NO.14): cggcgcttaagcgcgtcttg △ yjbQ -KYR (SEQ ID NO.15): agcgtttttccctcgtcagc 7. The single-exchange strain with a 1216 bp band obtained in step (6) and the single-exchange strain with a 2036 bp band obtained in step (6) were mixed and inoculated. After six subculturings at 37°C in a kanamycin-free medium, transformants were selected for colony PCR verification (primers were Δ). yjbQ -KYF and △ yjbQ -KYR). If the PCR verification results of the transformant show an electrophoretic band at 2172 bp, it indicates a gene reversion mutation, and the transformant is Bacillus amyloliquefaciens LX-12; if the electrophoretic band appears at 1772 bp, it indicates a deletion in the genome of Bacillus amyloliquefaciens LX-12. yjbQ The gene was detected, and the transformant was identified as a positive transformant. Subsequent DNA sequencing of the positive transformant further confirmed successful double crossover. yjbQ Deletion strain (i.e., Bacillus amyloliquefaciens LX-12△) yjbQ ).
[0024] Example 2: Bacillus amyloliquefaciens LX-12△ constructed in Example 1 yjbQ The specific steps for its application in the fermentation production of 1-deoxynojirimycin include: (1) Seed culture: First, Bacillus amyloliquefaciens was activated by inoculating it into 5 mL of LB medium at a volume percentage of 1% from a glycerol tube and culturing at 180 r / min and 37℃ for 10 hours. Then, the activated bacterial solution was inoculated into the seed fermentation medium at a volume percentage of 1% and cultured at 180 r / min and 37℃ for 10 hours to obtain the seed culture solution. The seed fermentation medium was LB medium with the following formula: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, pH 7.2.
[0025] (2) Fermentation culture: 25 mL of the fermentation culture medium with the following 10 different formulations was added to a 500 mL Erlenmeyer flask. Then, the seed culture bacterial solution was inoculated at a rate of 3% (volume percentage), and fermented at a speed of 180 r / min and a temperature of 37℃ for 48 hours to obtain the bacterial solution for production fermentation. The fermentation culture medium formulations used are shown in Table 1.
[0026] Table 1 Fermentation medium formulation table
[0027] The yield of 1-deoxynojirimycin in the fermentation broth produced in the above examples was determined by liquid chromatography. The specific determination conditions were as follows: 1.5 mL of fermentation broth was placed in a 2 mL centrifuge tube, centrifuged at 10000 r / min for 10 min, 100 μL of the supernatant was diluted to 2 mL, filtered through a 0.22 μm filter membrane, and the sample was then used for HPLC detection.
[0028] The Agilent 1260 high-performance liquid chromatography system (Agilent Technologies, USA) was used for detection. An Agilent Lichrospher C18 column (4.6 mm × 250 mm, 5 μm) was configured, the detection wavelength was 254 nm, and the mobile phase was acetonitrile:0.1% acetic acid solution (v / v 11:16). The injection volume was 10 μL, and the flow rate was 1.0 mL / min.
[0029] The yield of 1-deoxynojirimycin in the fermentation broths of different culture media was calculated using the liquid phase method (see Table 2). The control group consisted of the fermentation broth corresponding to *Bacillus amyloliquefaciens* LX-12; the experimental group consisted of the fermentation broth containing *Bacillus amyloliquefaciens* LX-12. yjbQ The corresponding production fermentation broth.
[0030] Table 2. Yield of 1-deoxynojirimycin in fermentation broths from different culture medium formulations.
[0031] As shown in Table 2, under the same seed culture and production fermentation conditions, compared with the existing Bacillus amyloliquefaciens LX-12, the Bacillus amyloliquefaciens LX-12 constructed using this embodiment has a higher efficiency (Δ) yjbQ The yield of 1-deoxynojirimycin in the fermentation broth was significantly increased (at least by 26.17%, and up to 37.25%), indicating that the technical solution of the present invention has significant application value in increasing the yield of 1-deoxynojirimycin in Bacillus subtilis.
[0032] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
[0033] SEQ ID NO.1:atgctgaaaaaattgcagattcaaacaaacagacgggatgaaatgatcgacatcacacatgaagccgaagcgtttctccgcaaaacaggcgtgaaaaacggt ttggcgctcatatactgtccccatacaaccgccggcattaccataaatgaaaatgccgatccggatgtgaagagggatatgctcagaaggtttgatgaaatgtatcc gtggggagcacgaactggaccggcatatggagggaaatacggcggcacatatgaaagcgagtacaaccggcgcctcccagcatgtcatcatagaagacgggcgcctga tactcggaacatggcagggcgtttatttttgcgaatttgacggtccgcgaaacagaacctgttatatcaaaatacaggctgaaccggaggaaaacacaaatgagtga SEQ ID NO.6:cagccccgctccgtctcggtatggggtgacgaacggtttttgacagaaagcgccaaggcactcgccgcgatgtatatgctgatgaaaggcacgccgtttatttaccaggggcaggagctcgggatgaccaatgtttcgtttccatccattgaagattatgatgacgccgcaatgaaatatctgtatgaaaaagagacgtcccgcggcgttccgcatgaaaaagtgatgaagatcatctggaagaagggccgggataattcacggacaccgatgcaatggagcgatgaggcgaacggcgggttttctgatgcttctccgtggctcggagtgaatccgaaccacacatggctgaatgctgcatcacaaatggaggatgaaacatccgtataccatttctacagacggctgctcgccctcagaaaagaacacagcgtattgatcagcggcacatatgaattgctgcttccgaatgaccggcagatttatgcctatctaagaaaaaacggaacaaaaaccgccctgatcatcacaaatctgtcccgaacccccgctttatacaggcatcccggttatccgcttgactccgattctctcgtgcttgcaaacgtggaaacagaagcgcaccgccatgtgacatcctttcttttaaagccttatgaggcccgcgtatatatatggtgaaaaacttcagtcccgaggctgaagttttttgtgatctgcgtttatcatcgcgatccgacaggaaaagacaaatacagaaacgaatatgggaaaggaagagaaaaagaaaggaggcatctatatgctgaaaaaattgcag SEQ ID NO.7:gaaaacacaaatgagtgagtggatgagtgcattatcattaacaaagcccgtcattcaggcgccgatggccggcgggctggtcacgccgcgtctggcttcggcggtatcaaatgaaggggcgctcggaagcctcgcttcaggatacgtcagcccgcaagcgcttgaaaaacagcttatcgagatgaaagagctgacggaccgctcctttcaagtaaatcttttcgtcccggaggaaagacagatgcctgaggcggaacttgttgaaaaatggaaagcccgcattccgagggcaaaagacgccaagccgttctctgatctgaaagaagaatggaatgatttcgaggaaaaagcggagcttctgatccgttacggagtcaaagcgtgttcattcaccttcggcctgccgccggaagaaacggcggaaaagctgaagaaaagcggttgtttccttttcggcacggcgacaacgccggaggaagcgaaggcctttgaggaacgggggatggacgccgttattcttcagggaatagaagccggcggacatcgcgggtcgtttctgccggttaaaggagaaccggctctcggccttatggcgctgattccgcaggctaaagacgcgctgaatatcccggtgattgcggcaggcggcatttttgaccgccgcggcgtgcaggcggcccgatgtttgggtgcggacggcgttcaagtaggaacaccgtttctcctttgtgaagaaagcagcgcctcaccggcatatcaaaaagccattgccgaatcaaaaggagccgacacgcggctgaccaccctgttttcggg SEQ ID NO.11: ATGTGATAACTCGGCGTA SEQ ID NO.12: GCAAGCAGCAGATTACGC
Claims
1. A knockout plasmid that promotes the synthesis of 1-deoxynojirimycin, characterized in that, The knockout plasmid is based on plasmid T2(2)-Ori, and the knockout is achieved by knocking out genes. yjbQ The resulting knockout plasmid T2-Δ yjbQ The yjbQ The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
2. A high-yield *Bacillus amyloliquefaciens* engineered bacterium producing 1-deoxynojirimycin, characterized in that: The engineered Bacillus amyloliquefaciens contains the knockout plasmid as described in claim 1.
3. The engineered Bacillus amyloliquefaciens strain according to claim 2, characterized in that: The Bacillus amyloliquefaciens strain is Bacillus amyloliquefaciens LX-12. △yjbQ, Its originating bacteria is Bacillus amyloliquefaciens (BAM). Bacillus amyloliquefaciens LX-12, accession number CCTCCNO: M2015234.
4. The Bacillus amyloliquefaciens LX-12 according to claim 2 △yjbQ The construction method is characterized by, Includes the following steps: S1. Using Bacillus amyloliquefaciens LX-12 genomic DNA as a template, the amplification was performed using primer pairs Y-F1 and Y-F2 to obtain the result shown in SEQ ID NO.
6. yjbQ The upstream homologous arm gene fragment; amplified using Y-F2 and Y-R2 primer pairs to obtain the result shown in SEQ ID NO.
7. yjbQ Downstream homologous arm gene fragment; S2, via overlap extension PCR yjbQ The upstream and downstream homologous arms of a gene are joined together to form the target gene fragment: yjbQ upstream homologous arm of a gene - yjbQ Downstream homologous arms of genes; S3. The target gene fragment obtained in step S2 is double-digested with restriction endonucleases to obtain the digested gene fragment. The plasmid vector is then double-digested with the same restriction endonucleases to obtain the linear plasmid fragment. S4. The enzyme-digested gene fragment and linear plasmid fragment obtained in step S3 are ligated with ligase, and the ligation product is transformed into Escherichia coli DH5α. Kanapine is used as the resistance selection marker, and the knockout plasmid is obtained by colony PCR verification and sequencing verification. S5. The knockout plasmid obtained in step S4 is transferred into Bacillus amyloliquefaciens, and positive transformants are selected by using kanamycin resistance as a screening marker. S6. After transferring and culturing the positive transformants obtained in step S5, colony PCR detection is performed to obtain... yjbQ Positive single crossover conjugate strains of the upstream homologous arm of the gene and yjbQ Positive single crossover binding strains of the downstream homologous arm of the gene; S7. The two positive single-exchange conjugate strains obtained in step S6 are mixed and inoculated into a culture medium for transfer culture, and the strains with deletions are screened. yjbQ The engineered strain of Bacillus amyloliquefaciens, namely Bacillus amyloliquefaciens LX-12. △yjbQ .
5. The construction method according to claim 4, characterized in that: In step S3, the nucleotide sequence of Y-F1 is shown in SEQ ID NO.2, the nucleotide sequence of Y-R1 is shown in SEQ ID NO.3, the nucleotide sequence of Y-F2 is shown in SEQ ID NO.4, and the nucleotide sequence of Y-R2 is shown in SEQ ID NO.
5.
6. The construction method according to claim 4, characterized in that: In step S3, the restriction endonucleases are SacI and XbaI, and the plasmid is T2(2)-ori.
7. The construction method according to claim 4 or 5, characterized in that: In step S6, the positive transformants are transferred and cultured at 45°C.
8. The construction method according to claim 6, characterized in that: In step S7, the culture medium is a culture medium that does not contain kanamycin, and the transfer culture temperature is 37°C.
9. The use of the knockout plasmid of claim 1, or the engineered Bacillus amyloliquefaciens of claim 2 or 3, in increasing the yield of Bacillus 1-deoxynojirimycin.
10. A method for increasing the yield of Bacillus 1-deoxynojirimycin, characterized in that: Fermentation culture was carried out using the engineered Bacillus amyloliquefaciens strain described in claim 2 or 3.