A gene of a morindae radix leaf alcohol synthase moGES and its coding product and application

Abstract

This invention relates to the field of medicinal plant genetic engineering, specifically to a geraniol synthase derived from Morinda officinalis. MoGES Genes and their encoded products and applications. The Morinda officinalis leaf extract enzyme. MoGES The coding region nucleotide sequence of the gene is shown in SEQ ID NO. 1. The Morinda officinalis leaf extract synthase... MoGES The amino acid sequence is shown in SEQ ID NO. 2. It also includes the application of the gene encoding the *Morinda officinalis* geraniol synthase in increasing the geraniol content of plants. This invention successfully cloned the gene encoding *Morinda officinalis* geraniol synthase and verified its efficacy through in vivo functional experiments with *Morinda officinalis*. MoGES To regulate the accumulation of geraniol in Morinda officinalis, an engineered strain BL21(DE3)-MoGES was constructed. A method for the large-scale induction expression and purification of the Morinda officinalis geraniol synthase MoGES protein was developed, and the function of the MoGES protein in catalyzing the synthesis of geraniol in vitro was verified.

Description

Technical Field

[0001] This invention relates to the fields of medicinal plant genetic engineering and synthetic biology, specifically to a Morinda officinalis-derived geranium synthase MoGES gene and its encoded product and applications. Background Technology

[0002] Morinda officinalis ( Morinda officinalis How Morinda officinalis is a perennial vine belonging to the Rubiaceae family and the Morinda genus. Its roots are used medicinally, first recorded in the *Shennong Bencao Jing* (Shennong's Classic of Materia Medica) and included in all editions of the *Pharmacopoeia of the People's Republic of China* in 1963. It is widely used to treat kidney deficiency, osteoporosis, rheumatoid arthritis, and depression. However, the cultivation of Morinda officinalis has a long cycle (approximately 5-6 years), and artificial cultivation often results in the medicinal components not meeting the standards for use in medicine. Furthermore, there are issues such as depletion of wild resources and germplasm degradation.

[0003] Iridoids are monoterpenoid compounds with a basic cyclopentane-pyran ring structure. They are one of the main active pharmaceutical ingredients of Morinda officinalis, possessing pharmacological activities such as anti-inflammatory, analgesic, anti-rheumatoid arthritis, and anti-osteoporosis effects. Furthermore, iridoids are also precursors for the synthesis of monoterpene indole alkaloids. These monoterpene alkaloids, represented by vinblastine and strychnine, exhibit significant antitumor, antihypertensive, and anti-inflammatory activities. Geraniyl pyrophosphate (GPP) is an important metabolic boundary point for terpenoids. It can generate monoterpenoid compounds with different structures under the action of different monoterpene synthases, and can also enter the synthetic pathways of sesquiterpenes, diterpenes, and triterpenes under the catalysis of corresponding enzymes. The geraniol synthase GES gene belongs to the g subfamily of terpene synthases and is located at the branch point of monoterpene synthesis. It catalyzes the conversion of GPP to geraniol, which enters the iridoid synthesis pathway, and is the first key rate-limiting enzyme in this pathway.

[0004] Geraniol is a very important natural monoterpene alcohol, possessing not only a sweet rose fragrance but also a wide range of biological functions and industrial applications. In the fragrance and cosmetics industry (its primary use), it is a core component of rose scents, widely used in high-end perfumes, cosmetics, skincare products, soaps, and detergent fragrances. It also acts as a co-fixant, stabilizing the fragrance and prolonging its longevity. In the pharmaceutical and health fields, geraniol exhibits broad-spectrum antibacterial and anti-inflammatory activities, analgesic, anti-anxiety, neuroprotective, and transdermal absorption enhancer properties. In the food industry, it is often used as a safe flavoring agent, imparting rose or fruity flavors to food and beverages (such as juice, candy, and chewing gum). In chemical synthesis, geraniol is a cornerstone for the synthesis of other important compounds. For example, it can be chemically converted into citral, citronellol, vitamin E, and vitamin A.

[0005] Secondary metabolites in plants are typically present in low concentrations and are expensive to extract. Utilizing synthetic biology to perform heterologous biosynthesis in engineered bacteria, and enhancing the host's ability to synthesize metabolites through plant genetic engineering, are effective ways to obtain large quantities of desired secondary metabolites. However, the geraniol synthase (GES) responsible for catalyzing the production of geraniol from GPP in Morinda officinalis has not yet been reported, and the gene encoding this geraniol synthase has not been identified or cloned. Summary of the Invention

[0006] This invention addresses the shortcomings of existing technologies by studying Morinda officinalis folia alcohol synthase. MoGES The function of the gene in the synthesis of Morinda officinalis monoterpenoids was investigated, providing a geraniol synthase gene involved in geraniol synthesis and its encoded protein, so as to produce Morinda officinalis monoterpenoids using synthetic biology strategies or plant genetic engineering.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] A Morinda officinalis leaf alcohol synthase MoGES Gene, the Morinda officinalis foliol synthase MoGES The nucleotide sequence of the coding region of the gene is shown in SEQ ID NO. 1.

[0009] The gene encodes Morinda officinalis leaf extract enzyme. MoGES The Morinda officinalis foliol synthase MoGES The amino acid sequence is shown in SEQ ID NO. 2.

[0010] An expression vector containing the encoded gene.

[0011] An engineered bacterium containing the expression vector described above.

[0012] Overexpression of the Morinda officinalis foliol synthase MoGES Application of genes in increasing geraniol content in plants.

[0013] The Morinda officinalis leaf alcohol synthase MoGES Gene, or the aforementioned Morinda officinalis leaf extract enzyme MoGES Mutants or codon-optimized variants of the gene, or the Morinda officinalis foliol synthase described therein. MoGES The application of the gene-encoded protein, or a fusion protein containing the protein encoded by the *Morinda officinalis* geraniol synthase gene and geraniol pyrophosphate synthase or other terpene metabolic pathway enzymes, or the expression vector, or the engineered bacteria, in the preparation of geraniol and geraniol derivatives, or in the preparation of an in vitro enzymatic reaction system for geraniol synthesis. The application is the catalytic synthesis of geraniol from geraniol by *GPP* pyrophosphate.

[0014] A method for increasing the geraniol content in Morinda officinalis includes the following steps: (1) Construct a plant overexpression vector containing Morinda officinalis geranium synthase. MoGES The nucleotide sequence of the gene, as shown in SEQ ID NO: 1; (2) Introduce the vector constructed in step (1) into Agrobacterium to obtain the infecting and transforming bacteria; (3) Infect Morinda officinalis explants with the aforementioned transforming bacteria and co-culture them; (4) The explants after co-culture were screened and regenerated on a medium containing screening agents to obtain transgenic Morinda officinalis plants or hairy roots; (5) Identify and culture the transgenic Morinda officinalis plants or hairy roots, wherein the overexpression of Morinda officinalis geraniol synthase MoGES protein results in a higher Morinda officinalis geraniol content than the non-transgenic control.

[0015] An engineered strain BL21(DE3)-MoGES expressing geraniol synthase, the method for constructing the engineered strain BL21(DE3)-MoGES is as follows: (S1) Using the pCE2_TA-Blunt-Zero recombinant vector pCE2_TA-Blunt-Zero-MoGES containing the nucleotide sequence shown in SEQ ID NO. 1 as a template, and using MoGES-pET32a-F / MoGES-pET32a-R as primers, a PCR reaction was performed. After the PCR product was detected, the pET32a-MoGES insert fragment was recovered. The pET32a-MoGES-F sequence is: TATCGGATCCGAATTCATGGCATGCTCCACCAGC. The pET32a-MoGES-R sequence is: GTGGTGGTGCTCGAGATTAATTATAGGAGTGAAAAACAAAGCCTTTACATAATTATCG; The PCR reaction conditions were as follows: 95 °C, pre-denaturation for 3 min; 95 °C, denaturation for 15 s; 60 °C, annealing for 20 s; 72 °C, extension for 2 min; 35 cycles of amplification; 72 °C, final extension for 10 min. The PCR reaction system is shown in Table 4. Table 4. PCR reaction system for amplifying the pET32a-MoGES insert fragment

[0016] (S2) The pET32a vector plasmid was double-digested with the restriction enzymes EcoRI and XhoI from New England Biolabs to prepare a linearized vector, and the pET32a linearized vector was recovered and purified. (S3) The pET32a-MoGES insert fragment was ligated to the pET32a linearized vector via homologous recombination to obtain the recombination product; (S4) The recombinant product was transformed into BL21(DE3) competent cells, and the engineered strain BL21(DE3)-MoGES was obtained by screening.

[0017] A method for producing Morinda officinalis leaf extract synthase (MoGES) protein includes the following steps: Step 1: Inoculate the engineered strain BL21(DE3)-MoGES obtained according to claim 9 into LB medium containing 50 mg / mL Amp and incubate overnight at 37 ℃ and 200 rpm. Step 2: Inoculate the overnight cultured bacterial suspension into fresh LB medium containing 50 mg / mL Amp, and incubate at 37°C and 200 rpm until the bacterial cell OD reaches the target value. 600 Reaching 0.6-0.8; Step 3: Add IPTG to the culture system to a final concentration of 0.1-1.0 mM, and induce expression at 15-30 ℃ for 4-20 hours; Step 4: Centrifuge to collect the induced bacterial cells. Add Tris-HCl containing 300 mM NaCl and pH 7.8 to the precipitate to a final concentration of 50 mM to resuspend the induced bacterial cells. Then add PMSF to a final concentration of 1 mM. Step 5: The bacterial culture was broken and resuspended using a high-pressure homogenizer, and the supernatant containing Morinda officinalis leaf extract synthase (MoGES) protein was collected after centrifugation. Step 6: After incubating the supernatant with the Ni-NTA agarose column, transfer it to an empty column tube and add elution buffer of increasing imidazole concentration to wash away impurities. Add buffer 1, allow to flow naturally, and repeat the rinse three times; buffer 1 consists of 50 mM Tris-HCl, 300 mM NaCl and 10 mM imidazole, and the pH of buffer 1 is 7.8. Add buffer 2, allow to flow naturally, and repeat rinsing three times; buffer 2 consists of 50 mM Tris-HCl, 300 mM NaCl and 20 mM imidazole, and the pH of buffer 2 is 7.8. Add buffer 3, allow to flow naturally, and repeat rinsing three times; buffer 3 consists of 50 mM Tris-HCl, 300 mM NaCl and 50 mM imidazole, and the pH of buffer 3 is 7.8. Elute with buffer 4, which contains 50 mM Tris-HCl, 300 mM NaCl and 250 mM imidazole, and has a pH of 7.8. Step 7: Desalt or dialyze the collected eluent to obtain purified Morinda officinalis leaf alcohol synthase MoGES protein.

[0018] A method for generating geraniol from geraniol by catalysis of Morinda officinalis geraniol synthase MoGES protein includes the following steps: (1) Prepare a reaction system, which consists of the following components and their final concentrations: 4-Hydroxyethylpiperazine ethanesulfonic acid (HEPES), with a molar concentration of 30-50 mM and a pH value of 7.3-7.8; Geranyl pyrophosphate (GPP) at a mass concentration of 50-75 μg / mL; Dithiothreitol (DTT), with a molar concentration of 5-10 mM; Glycerin, with a volume concentration of 5%-10%; MgCl2, with a molar concentration of 10-15 mM; MnCl2, with a molar concentration of 1.25-1.5 mM; Morinda officinalis leaf extract synthase MoGES protein, the amino acid sequence of which is shown in SEQ ID NO. 2, and the mass concentration is 75-100 μg / mL; Solvent: ddH2O, balance; (2) Incubate the reaction system prepared in step (1) at 26-32 °C for 0.5-6 h.

[0019] Compared with the prior art, the present invention has the following beneficial effects: This invention successfully cloned and functionally identified the enzyme encoding Morinda officinalis geraniol synthase. MoGES The gene. Through in vivo functional experiments with Morinda officinalis, the geraniol synthase from Morinda officinalis was confirmed for the first time. MoGES It is a key rate-limiting enzyme regulating geraniol biosynthesis in Morinda officinalis, and the efficacy of overexpression of Morinda officinalis geraniol synthase was verified. MoGES Geraniol content accumulates significantly in Morinda officinalis, providing a new gene target for quality improvement and secondary metabolite synthesis.

[0020] An engineered strain BL21(DE3)-MoGES was constructed, and a method for the large-scale induction expression and high-purity affinity purification of Morinda officinalis leaf alcohol synthase MoGES protein in microbial systems such as Escherichia coli was successfully developed. This solved the technical bottleneck of low content and difficulty in obtaining this enzyme in natural plants, and laid the foundation for the preparation of industrial enzyme preparations.

[0021] In vitro enzyme activity experiments confirmed that the purified Morinda officinalis geraniol synthase (MoGES) protein can efficiently catalyze the production of geraniol from the substrate geraniyl pyrophosphate (GPP), achieving full-chain verification from gene to active protein to target product. Using the purified enzyme provided by this invention, in vitro enzyme-catalyzed reaction systems can be developed for the specific synthesis of high-purity, high-concentration geraniol, replacing traditional plant extraction or chemical synthesis methods. This offers significant advantages such as mild reaction conditions, single product, and environmental friendliness. Attached Figure Description

[0022] Figure 1 Morinda officinalis leaf extract enzyme MoGES Electrophoresis diagram of gene PCR amplification.

[0023] Figure 2 Morinda officinalis leaf extract enzyme MoGES Phylogenetic tree of genes.

[0024] Figure 3 The amino acid sequence of the geranium synthase gene in Morinda officinalis was compared with that in other species.

[0025] Figure 4 To detect the expression of green fluorescent protein GFP in Morinda officinalis during transient overexpression using fluorescence microscopy.

[0026] Figure 5 The expression of the MoGES-GFP fusion protein was detected by Western blot. Lane 1 contained 35S-GFP, and lane 2 contained 35S-MoGES-GFP.

[0027] Figure 6 For qRT-PCR detection MoGES Gene expression. In the figure, relative expression represents the expression level.

[0028] Figure 7 This is the ion chromatogram of geraniol detected by GC-MS. In the figure, the peak area represents the peak area. Geraniol is a standard for geraniol. 35S-GFP was the control group Morinda officinalis sample. 35S-MoGES-GFP is an overexpression MoGES Morinda officinalis sample of genes, MoGES-RNAi is an RNAi interference method. MoGES A Morinda officinalis sample containing genes.

[0029] Figure 8 For overexpression and RNAi interference MoGES The effect of genes on geraniol content. In the figure, Geraniolcontent represents geraniol content. Among them, Geraniol is a standard for geraniol. 35S-GFP was the control group Morinda officinalis sample. 35S-MoGES-GFP is an overexpression MoGES Morinda officinalis sample of genes, MoGES-RNAi is an RNAi interference method. MoGES A Morinda officinalis sample containing genes.

[0030] Figure 9 Western blot analysis of the induced expression of MoGES protein; Lane M is for protein markers. Lanes 1-6 represent the results of induced expression of BL21(DE3)-MoGES strain containing the pET32a-MoGES recombinant expression vector; Lanes 7-12 represent the results of induced expression of the BL21(DE3)-pET32a strain containing the empty pET32a vector.

[0031] Figure 10 SDS-PAGE results of purified Morinda officinalis leaf extract synthase (MoGES) protein induced by expression.

[0032] Figure 11 This is an ion chromatogram of the in vitro enzymatic activity reaction product of MoGES protein, as detected by GC-MS. In the figure, Relative intensity represents the relative intensity.

[0033] Figure 12 This is a mass spectrometry comparison of the in vitro enzymatic activity reaction product of MoGES protein and geraniol standard. In the figure, "reaction product" represents the reaction product. Detailed Implementation

[0034] The technical solution of the present invention will be further illustrated below through embodiments.

[0035] Example 1. Morinda officinalis leaf extract synthase MoGES Obtaining gene sequences Take about 0.5 g of leaves from Morinda officinalis tissue culture seedlings, grind them into powder in liquid nitrogen, extract RNA from Morinda officinalis using TaKaRa MiniBESTPlant RNA Extraction Kit (No. 9769S), and synthesize cDNA by reverse transcription using Novizan HiScript II 1stStrand cDNA Synthesis Kit (R211).

[0036] Based on the genomic information of Morinda officinalis, an amplification of Morinda officinalis geraniol synthase was designed. MoGES Specific primer sequences for gene fragments were used to prepare the following primers: The MoGES-F sequence is (5'-3'): ATGGCATGCTCCACCAGCA. The MoGES-R sequence is (5'-3'): TTAATTAGAGTGAAAAAC AAAGCC.

[0037] Using cDNA synthesized by reverse transcription as a template and MoGES-F / MoGES-R as primers, the Morinda officinalis leaf extract synthase was cloned using the high-fidelity enzyme PhantaMax Super-Fidelity DNA Polymerase (Vazyme, P505). MoGES The coding region sequence of a gene.

[0038] The PCR reaction conditions were as follows: 95 °C, pre-denaturation for 3 min; 95 °C, denaturation for 15 s; 57 °C, annealing for 30 s; 72 °C, extension for 2 min; 35 cycles of amplification; 72 °C, final extension for 10 min.

[0039] The PCR reaction system is shown in Table 1.

[0040] Table 1. Amplification of Morinda officinalis leaf extract synthase MoGES PCR reaction system for gene fragments

[0041] PCR products were detected by 1% agarose gel electrophoresis, and the results are as follows: Figure 1 As shown, a bright single band is visible between 1500 bp and 2000 bp in the DNA marker, which is the target band, approximately 1700 bp in size.

[0042] The target band was recovered using an agarose gel extraction kit (AG21005). The purified fragment was ligated into the pCE2_TA-Blunt-Zero vector using a TOPO cloning kit, and transformed into *E. coli* competent cells DH5α using a heat shock method. After selection with ampicillin and kanamycin, positive single clones were selected for sequencing to obtain *Morinda officinalis* folin synthase. MoGES The coding region sequence of a gene.

[0043] The Morinda officinalis leaf alcohol synthase MoGES The full-length coding region of the gene is 1764 bp, as shown in SEQ ID NO. 1.

[0044] The Morinda officinalis leaf alcohol synthase MoGES The gene encodes 587 amino acids, as shown in SEQ ID NO. 2.

[0045] SEQ ID NO. 1:

[0046] SEQ ID NO. 2: .

[0047] Example 2. Morinda officinalis leaf extract synthase MoGES Bioinformatics analysis of gene sequences Morinda officinalis leaf extract enzyme MoGES The amino acid sequence encoded by the gene was homology-searched in the NCBI database, and this Morinda officinalis leaf extract synthase showed similarities to other species at the amino acid level. ObGES : Ocimum basilicum AY362553; VvGES : Vitis vinifera HM807398; GjGES : Gardenia jasminoides MK182263; CrGES : Catharanthus roseus , AFD64744; UrGES : Uncaria rhynchophylla OP669346 has low homology with the periwinkle geranium synthase gene (CrGES The sequence identity was 81.2%, similar to that of Gardenia (Gardenia jasminoides), which is also a Rubiaceae plant. GjGES ), Uncaria ( UrGES The sequence identity of the geraniol synthase gene in the two samples was only 82.96% and 82.14%, respectively.

[0048] Sequence alignment was performed using MAFFT software, and a phylogenetic tree was constructed using the maximum likelihood method, with the bootstrap iterations repeated 1000 times. The results are as follows: Figure 2 As shown, Morinda officinalis and Gardenia jasminoides, both belonging to the Rubiaceae family, are... GjGES ), Uncaria ( UrGES Those located at the same branch point have the highest kinship. Figure 3 The sequence alignment results show that Morinda officinalis leaf extract synthase... MoGES The geraniol synthase protein sequence from Morinda officinalis is relatively conserved in the 280–411 aa range compared to other species, containing the typical conserved DDXXD motif. However, significant differences exist in the N-terminal and C-terminal sequences, indicating that Morinda officinalis geraniol synthase has undergone natural selection and evolution. MoGES Adaptive changes can occur, and this non-conservatism of the protein may give it different functions or catalytic activities.

[0049] Example 3. MoGES In vivo functional verification of genes 3.1 MoGES Construction of gene overexpression vectors according to MoGES The coding region nucleotide sequence of the gene was selected, and the SacI and XbaI restriction sites on the pCAMBIA1300-35S:EGFP vector (hereinafter referred to as 35S:EGFP) were selected. The stop codon TGA was removed to construct the 35S:MoGES-EGFP fusion expression vector.

[0050] Design specific primer sequences for homologous recombination, and prepare the following primers: The MoGES-EGFP-F sequence is (5'-3'): AGACACGGGGGACGAGCTCATGGCATGCTCCACCAGC; The sequence of MoGES-EGFP-R is (5'-3'): CCATGTCGACTCTAGAATTAATTATAGGAGTGAAAAACAAAGCCTTTACATAATTATCG; To include MoGESThe MoGES-EGFP insert fragment was prepared by PCR using the pCE2_TA-Blunt-Zero recombinant vector pCE2_TA-Blunt-Zero-MoGES, which contains the nucleotide sequence of the coding region of the gene, as a template and MoGES-EGFP-F / MoGES-EGFP-R as primers, and Phanta Max Super-Fidelity DNA Polymerase (P505) as a high-fidelity enzyme of novizan.

[0051] PCR reaction conditions: 95 ℃, pre-denaturation for 3 min; 95 ℃, denaturation for 15 s; 60 ℃, annealing for 20 s; 72 ℃, extension for 2 min; 35 cycles of amplification; 72 ℃, final extension for 10 min.

[0052] The PCR reaction system is shown in Table 2.

[0053] Table 2. PCR reaction system for amplifying the MoGES-EGFP insert fragment

[0054] PCR products were detected by 1% agarose gel electrophoresis, and the MoGES-EGFP insert was recovered using an agarose gel recovery kit (D2500-01).

[0055] The 35S:EGFP vector plasmid was double-digested with the restriction enzymes SacI and XbaI from New England Biolabs to prepare a linearized vector. The linearized 35S:EGFP vector was then recovered and purified using an agarose gel extraction kit (D2500-01).

[0056] Using the ClonExpress Ultra One Step Cloning Kit V2, the MoGES-EGFP insert was ligated into the 35S:EGFP linearized vector via homologous recombination to obtain the recombinant product.

[0057] The recombinant product was transformed into Escherichia coli DH5α, and the 35S:MoGES-EGFP fusion expression vector was obtained after screening with kanamycin and sequencing verification.

[0058] 3.2 MoGES Construction of gene RNAi interference vector according to MoGES Based on the principle of hpRNA-mediated RNAi interference, a 319bp RNAi interference fragment was designed from the nucleotide sequence of the gene's coding region.

[0059] An RNAi-MoGES vector insert containing a 319 bp sense strand, an intron, and a 319 bp antisense strand was constructed and synthesized. The sequence of the RNAi-MoGES vector insert is (5'-3'): CAGCATTTCATTTCTTTCGAAGCCATGGACAGCTTTGTACGTCCCTCGTGGGGTTCCTGGAGCTACTCGTTCATGGCTAAGAAAGCAGCTCAGCGTCAGAACCTCACGCATTTGTATGTGCATGCCATCGCCACCAACCTCTACTCAGCCCATAGCAGCTCCATTGATCAGAGACAATGAGTCTCTTCTCAAATATTTGCAACAACCCACGGTACTTCCACACGAAGTTGATGATGGGACCATGAGGAAAGAACTGTTGGAAATTACAAGGAGGGAATTGAGATCAATTTCAGAACCCTTAGAGGTCCTGAAGCTGATA (Sense strand) CTGCAGGT AAATTTCTAGTTTTTCTCCTTCATTTTCTTGGTTAGGACCCTTTTCTCTTTTTATTTTTTTGAGCTTTGATCTTTC TTTAAACTGATCTATTTTTTAATTGATTGGTTATGGTGTAAATATTACATAGCTTTAACTGATAATCTGATTACTT TATTTCGTGTGTCTATGATGATGATGATAGTTACAGAAGCTT(Intron) TATCAGCTTCAGGACCTCTAAGGGTTCTGAAATTGATCTCAATTCCCTCC TTGTAATTTCCAACAGTTCTTTCCTCATGGTCCCATCATCAACTTCGTGTGGAAGTACCGTGGGTTGTTGCAAATATTTGAGAAGAGACTCATTGTCTCTGATCAATGGAGCTGCTATGGGCTGAGTAGAGGTTGGT GGCGATGGCATGCACATACAAATGCGTGAGGTTCTGACGCTGAGCTGCTTTCTTAGCCATGAACGAGTAGCTCCAGGAACCCCACGAGGGACGTACAAAGCTGTCCATGGCTTCGAAAGAAATGAAATGCTG (antisense strand).

[0060] The pEGRNAIP35S vector plasmid was prepared by double digestion with the restriction enzymes BamHI and XbaI from New England Biolabs. The pEGRNAIP35S linearized vector was then recovered and purified using an agarose gel extraction kit (D2500-01).

[0061] Using the ClonExpress Ultra One Step Cloning Kit V2, the RNAi-MoGES vector insert fragment was ligated into the pEGRNAIP35S linearized vector via homologous recombination to obtain the recombinant product.

[0062] The recombinant product was transformed into Escherichia coli DH5α, and the pEGRNAiP35S-MoGES interference vector was obtained by screening with kanamycin and sequencing verification.

[0063] 3.3 Transient genetic transformation of Morinda officinalis The 35S:EGFP empty vector, 35S:MoGES-EGFP fusion expression vector, and pEGRNAiP35S-MoGES interference vector were transformed into Agrobacterium GV3101 using the freeze-thaw method. When the OD600 value of the bacterial culture was 0.8-1.0, the bacterial cells were collected by centrifugation, resuspended in 10 mL of MgCl2 solution (10 mM, containing 200 μM AS), and the OD600 was adjusted to about 1.0. The cells were then incubated at 28 ℃ for 2-3 h to obtain the empty vector infection solution, the overexpression vector infection solution, and the RNAi interference vector infection solution, respectively.

[0064] Morinda officinalis tissue culture seedlings (4–5 cm tall) were divided into two groups and immersed in three different infection solutions under vacuum for 5 min (-0.8 MPa). They were then cultured in a light incubator (28 ℃, 16 h light / 8 h dark). Samples were collected after 72 h for gene expression analysis (see Example 4) and geraniol detection (see Example 5). Each treatment was performed in triplicate, with 10 plants per replicate. The empty vector control group was named 35S-GFP, the overexpression vector infection solution treatment group was named 35S-MoGES-GFP, and the RNAi interference vector infection solution treatment group was named MoGES-RNAi.

[0065] Example 4. MoGES Gene expression level analysis 4.1 Detection of MoGES-GFP fusion protein expression by fluorescence microscopy and Western blot The expression of green fluorescent protein (GFP) in the transiently transformed Morinda officinalis leaves of Example 3 was detected using fluorescence microscopy. The results are as follows: Figure 4 As shown, compared with the 35S-GFP empty vector, the 35S-MoGES-GFP group was able to capture fluorescence signals, indicating that the MoGES-GFP fusion protein was effectively expressed in transiently transformed Morinda officinalis leaves.

[0066] Leaves were collected, flash-frozen in liquid nitrogen, and ground on ice with a grinding rod until completely pulverized. Then, 70–100 µL of protein extraction buffer was added, and the mixture was ground thoroughly. The mixture was centrifuged at 13,000 rpm for 10–15 min at 4 °C. 80 µL of the supernatant was transferred to a new 1.5 mL EP container, and 20 µL of 5×SDS was added. After mixing, the mixture was boiled at 95 °C for 10–15 min to obtain total protein from *Morinda officinalis*. The extracted protein was added to the wells of a protein gel, and any unfilled wells were filled with 1×SDS. Electrophoresis was performed on a stacking gel at 80 V and a separating gel at 120 V. Soak the sponge, filter paper, and membrane in pre-cooled transfer buffer. With the blackboard at the bottom, place the sponge, three layers of filter paper, protein gel, PVDF membrane, three layers of filter paper, and sponge in that order. Place the sponge in an electrophoresis tank containing transfer buffer (25 mM Tris, 192 mM glycine, 20% methanol, pH 8.3) and transfer at 55 V for 120–140 min. Rinse once quickly with TBST (20 mM Tris-HCl, 150 mM NaCl, 0.1% Tween-20, pH 7.6), completely immerse the membrane in 5% skim milk powder, and block on a shaker at room temperature for 1 h. Wash the membrane three times with TBST for 5 min each time (shaking) to remove residual blocking solution. Dilute the primary antibody with TBST according to the antibody instructions, completely immerse the membrane in the primary antibody solution, and incubate at room temperature for 1 h with gentle shaking. Discard the primary antibody solution, wash the membrane 3-5 times with TBST for 10 min each time to thoroughly wash away unbound primary antibody. Similarly, dilute the secondary antibody with TBST according to the instructions, immerse the membrane in the secondary antibody solution, and incubate on a shaker at room temperature for 1 h. Discard the secondary antibody solution, wash the membrane 4-5 times with TBST for 10 min each time to ensure that unbound secondary antibody is washed away. Mix ECL substrate A and B solutions in a 1:1 ratio, add evenly to the membrane, react in the dark for several minutes, and then expose the membrane with a chemiluminescence imaging system to detect the bands. Western blot results are as follows Figure 5 As shown, lane 1 is 35S-GFP and lane 2 is 35S-MoGES-GFP. An 84.3 kDa fusion protein was detected in Morinda officinalis with transient overexpression of MoGES-GFP, while no 84.3 kDa target protein was detected in the control group 35S-GFP.

[0067] like Figure 4 and Figure 5 The results shown indicate that the transient overexpression described in Example 3... MoGES The MoGES-GFP fusion protein from Morinda officinalis was successfully expressed.

[0068] 4.2 Real-time quantitative PCR (qRT-PCR) detection of overexpression and RNAi interference MoGES Gene expression level 0.5 g of Morinda officinalis leaves that were transiently transformed with 35S:EGFP, 35S:MoGES-EGFP, and pEGRNAiP35S-MoGES in Example 3 were taken respectively, ground in liquid nitrogen, and total RNA was extracted from the leaves using the TaKaRa MiniBEST Plant RNA Extraction Kit (No. 9769S). cDNA was synthesized by reverse transcription using the Novizan HiScript II 1st Strand cDNASynthesis Kit (R211).

[0069] according to MoGES and MoGAPDH Based on the gene sequence, specific primer combinations qMoGES-F / qMoGES-R and qMoGAPDH-F / qMoGAPDH-R were designed, and the following primers were prepared: The sequence of qMoGES-F is (5'-3'): ATGGCATGCTCCACCAGCA; The sequence of qMoGES-R is (5'-3'): TTAATTAGAGTGAAAAAC AAAGCC; The sequence of qMoGAPDH-F is (5'-3'): GCTGGCATTGCYTTGAATCC; The sequence of qMoGAPDH-R is (5'-3'): AATCAACCACGCGAGAACTG; Using the cDNA synthesized by reverse transcription as a template, qRT-PCR reactions were performed using qMoGES-F / qMoGES-R and qMoGAPDH-F / qMoGAPDH-R primers, respectively, with the Novizan Taq Pro Universal SYBR qPCR Master Mix (Q712) kit.

[0070] qRT-PCR reaction conditions: pre-denaturation, 95℃, 30 s; denaturation, 95℃, 10 s; extension, 60℃, 30 s; fluorescence acquisition, 40 cycles; melting curve (default program).

[0071] The qRT-PCR reaction system is shown in Table 3.

[0072] Table 3. Detection MoGES qRT-PCR reaction system for gene expression

[0073] by MoGAPDH The gene is an internal reference gene. MoGES The gene is the target gene, and 2 is used.-ΔΔCT Methods for calculating transient overexpression and RNAi interference MoGES Changes in the relative expression levels of genes. qRT-PCR results are shown below. Figure 6 As shown, with the 35S:GFP empty vector as a control, the overexpression of Morinda officinalis... MoGES The gene (35S-MoGES-GFP in the figure) was significantly upregulated, 5.32 times that of the control. p <0.001); RNAi interference in Morinda officinalis MoGES The expression of the gene (MoGES-RNAi in the figure) was downregulated, with an expression level 0.73 times that of the control. p <0.05).

[0074] Example 5. GC-MS detection of overexpression and RNAi interference MoGES Geraniol content in Morinda officinalis The Morinda officinalis leaf samples transiently transformed with 35S:MoGES-EGFP and pEGRNAiP35S-MoGES in Example 3 were freeze-dried, ground into powder, and 0.5 g of powder was weighed and placed in a headspace vial. 2.5 ml of saturated sodium chloride was added, vortexed for 1 min, extracted at 80℃ for 40 min, and then injected for GC-MS analysis.

[0075] GC conditions: DB-5 capillary column (30 mm × 250 μm × 0.25 μm, Agilent); carrier gas: high-purity helium (purity ≥ 99.999%); column flow rate: 1 mL / min; injection port: 270 ℃; pressure: 273 kPa. Column temperature: 80 ℃ for 5 min, run for 5 min; then increase to 240 ℃ at a rate of 10 ℃ / min and hold for 1 min, run for 22 min; subsequently increase to 300 ℃ at a rate of 15 ℃ / min and hold for 12 min, run for 38 min.

[0076] MS conditions: TIC scan mode, ion source temperature 230 ℃, quadrupole temperature 150 ℃, EI ionization mode, electron energy 70 eV, scan mass range 29–500 Amu. Geraniol was used as a standard, and the sample was diluted according to the peak area. A standard curve was plotted based on the concentration and peak area to calculate the geraniol content in the sample.

[0077] like Figure 7 As shown, GC-MS detection results indicated that geraniol standard showed a peak at a retention time of 19.25 min, indicating the presence of overexpression and RNAi interference. MoGESBoth the Morinda officinalis gene and the control sample (transformed with 35S:GFP empty vector) showed peaks at the same time, indicating that geraniol could be effectively detected under GC-MS conditions.

[0078] like Figure 8 As shown, The geraniol content in the control group (transformed with 35S:GFP empty vector) of Morinda officinalis was 134.9 ng / gDW. overexpression MoGES Geraniol content significantly accumulated in Morinda officinalis, reaching 173.89 ng / gDW ( p <0.001); RNAi interference MoGES Geraniol content in Morinda officinalis was significantly reduced to 103.44 ng / gDW. p <0.01).

[0079] The above results indicate that overexpression MoGES Genes can increase geraniol levels, while RNAi interference... MoGES Genes reduce geraniol content, thus cloning Morinda officinalis. MoGES The gene has geraniol synthase function.

[0080] Example 6. Validation of the in vitro enzymatic activity and catalytic function of Morinda officinalis leaf extract synthase (MoGES) protein. 6.1 MoGES Construction of gene overexpression engineered strains according to MoGES The coding region nucleotide sequence of the gene was determined. EcoRI and XhoI restriction sites were selected on the pET32a vector, the stop codon TGA was removed, and the prokaryotic expression vector pET32a-MoGES was constructed. Specific primer sequences for homologous recombination were designed, and the following primers were prepared: The pET32a-MoGES-F sequence is (5'-3'): TATCGGATCCGAATTCATGGCATGCTCCACCAGC; the pET32a-MoGES-R sequence is (5'-3'): GTGGTGGTGCTCGAGATTAATTATAGGAGTGAAAAACAAAGCCTTTACATAATTATCG; To include MoGESThe pCE2_TA-Blunt-Zero recombinant vector pCE2_TA-Blunt-Zero-MoGES, containing the nucleotide sequence of the gene coding region, was used as a template. Using MoGES-pET32a-F / MoGES-pET32a-R as primers, the pET32a-MoGES insert fragment was prepared by PCR reaction using Phanta Max Super-Fidelity DNA Polymerase (P505), a high-fidelity enzyme from Novizan.

[0081] The PCR reaction conditions were as follows: 95 °C, pre-denaturation for 3 min; 95 °C, denaturation for 15 s; 60 °C, annealing for 20 s; 72 °C, extension for 2 min; 35 cycles of amplification; 72 °C, final extension for 10 min.

[0082] The PCR reaction system is shown in Table 4.

[0083] Table 4. PCR reaction system for amplifying the pET32a-MoGES insert fragment

[0084] The PCR products were detected by 1% agarose gel electrophoresis, and the pET32a-MoGES insert was recovered using an agarose gel recovery kit (D2500-01).

[0085] The pET32a vector plasmid was double-digested with the restriction enzymes EcoRI and XhoI from New England Biolabs to prepare a linearized vector. The pET32a linearized vector was then recovered and purified using an agarose gel extraction kit (D2500-01).

[0086] Using the ClonExpress Ultra One Step Cloning Kit V2, the pET32a-MoGES insert was ligated to the pET32a linearized vector via homologous recombination to obtain the recombinant product.

[0087] The recombinant product was transformed into BL21(DE3) competent cells, and the engineered strain BL21(DE3)-MoGES was obtained by screening with ampicillin (Amp).

[0088] 6.2 Low-level induction of expression of Morinda officinalis leaf extract synthase MoGES protein Engineered strain BL21(DE3)-MoGES containing the pET32a-MoGES recombinant expression vector and control strain BL21(DE3)-pET32a (containing the pET32a empty plasmid vector) were inoculated into 1 mL of LB liquid medium containing 50 mg / mL Amp and cultured overnight at 37 °C. Then, the cultures were inoculated at a 1:100 ratio into 100 mL of LB ampicillin-resistant medium containing 50 mg / mL Amp and cultured at 37 °C with shaking at 200 rpm until the OD600 reached 0.6–0.8. Protein expression was induced for 18 h according to the conditions listed in Table 5.

[0089] Table 5. Combinations of conditions for inducing MoGES protein expression

[0090] After induction, the bacterial cells were collected by centrifugation at 8000 rpm for 10 min at 4 ℃. The cells were resuspended in 2 mL of extraction enzyme buffer (50 mM Tris-HCl, 10 mM MgCl2, 5 mM DTT, 10% glycerol, pH=8) and sonicated in an ice-water bath for 5 min. The lysed bacterial culture was then centrifuged at 10000 rpm for 10 min at 4 ℃, and the supernatant was collected. The induction expression of MoGES protein was detected by Western blot based on the His protein tag on the pET32a prokaryotic expression vector.

[0091] Western blot results of Morinda officinalis leaf extract synthase MoGES protein are as follows: Figure 9 As shown in the figure. Western blot results showed that no protein bands were detected in the BL21(DE3)-pET32a strain containing the empty pET32a vector (lanes 7-12), while obvious protein bands were detected in the engineered strain BL21(DE3)-MoGES containing the pET32a-MoGES recombinant expression vector (lanes 1-6). Based on the combination of protein expression induction conditions, MoGES protein expression was successfully induced at a low temperature of 20 °C, and the protein expression induction effect improved with increasing IPTG concentration (as shown in lanes 5-6). However, under high-temperature induction, low concentrations of IPTG could not induce protein expression, and increasing the IPTG concentration was required to induce protein expression (as shown in lanes 1-4).

[0092] 6.3 Large-scale expression and purification of Morinda officinalis leaf extract synthase MoGES protein The engineered strain BL21(DE3)-MoGES containing the pET32a-MoGES recombinant expression vector was inoculated into 2 mL of LB medium (containing 50 mg / mL Amp) and cultured overnight at 37 ℃ and 200 rpm. The overnight culture was then inoculated into 250 mL of LB medium (containing 50 mg / mL Amp) at a ratio of 1:100 and cultured at 37 ℃ and 200 rpm until the OD600 was approximately 0.6. 0.2 mM IPTG was added to the culture and the culture was induced at 20 ℃ and 200 rpm for 18 h.

[0093] The induced bacterial culture was centrifuged at 8000 rpm for 20 min at 4 ℃ to collect the bacterial cells; 30 mL of 50 mM Tris-HCl (containing 300 mM NaCl, pH 7.8) was added to the precipitate for resuspending, then 1 mM PMSF was added, the bacterial cells were homogenized by high pressure, centrifuged at 12000 rpm for 1 h at 4 ℃, and the supernatant was collected. After incubating the supernatant with a Ni-NTA agarose column, transfer it to an empty column tube and add elution buffers of increasing imidazole concentration sequentially: add 6 mL of buffer 1 (50 mM Tris-HCl, pH 7.8, 300 mM NaCl, 10 mM imidazole), allow to flow naturally, and repeat the wash three times; add 6 mL of buffer 2 (50 mM Tris-HCl, pH 7.8, 300 mM NaCl, 20 mM imidazole), allow to flow naturally, and repeat the wash three times; add 6 mL of buffer 3 (50 mM Tris-HCl, pH 7.8, 300 mM NaCl, 50 mM imidazole), allow to flow naturally, and repeat the wash three times to remove contaminating proteins; add 1 mL of buffer 4 (50 mM Tris-HCl, pH 7.8, 300 mM NaCl, 250 mM imidazole) for elution, and collect the eluent. The purified protein was analyzed by SDS-PAGE polyacrylamide gel electrophoresis.

[0094] SDS-PAGE results are as follows Figure 10 As shown, when the imidazole concentration in the elution buffer reached 250 mM, a distinct band between 63 kDa and 75 kDa appeared in the elution buffer, which is consistent with the theoretical size of the target recombinant protein 6×His-MoGES, 68.3 kDa. Furthermore, the number of extraneous protein bands in this lane was less than that in the supernatant lane, indicating that the purification system can effectively purify the recombinant protein.

[0095] 6.4 Validation of the in vitro enzymatic activity and catalytic function of Morinda officinalis leaf extract synthase (MoGES) protein The in vitro enzymatic reaction used GPP as the substrate and 1 M HEPES (pH 7.5) as the reaction buffer. The MoGES protein purified in Section 6.3 of this example was used as the experimental group, and the MoGES protein denatured and inactivated by boiling was used as the negative control. The in vitro enzymatic reaction system is shown in Table 6.

[0096] Table 6. In vitro enzyme activation reaction system of MoGES protein

[0097] The mixture was incubated at 30 °C for 2 h. After the reaction was complete, 400 μL of n-hexane was added, and the mixture was vortexed for 1 min. The upper organic phase n-hexane was collected by centrifugation at 5000 rpm. This process was repeated once, and the two organic phase n-hexane samples were combined and placed in a headspace vial. The mixture was shaken at 60 °C for 5 min, and a 120 µm DVB / CWR / PDMS extraction head was inserted into the sample headspace vial for headspace extraction for 15 min. The extract was then desorbed at 250 °C for 5 min, and the product was separated and identified by GC-MS, using geraniol as a standard.

[0098] GC conditions were as follows: DB-5 capillary column (30 mm × 250 μm × 0.25 μm, Agilent); carrier gas was high-purity helium (purity ≥ 99.999%), column flow rate was 1 mL / min; injection port temperature was 270 ℃, pressure was 273 kPa. Column temperature: 80 ℃ held for 5 min, run for 5 min; then increased to 240 ℃ at a rate of 10 ℃ / min and held for 1 min, run for 22 min; subsequently increased to 300 ℃ at a rate of 15 ℃ / min and held for 12 min, run for 38 min.

[0099] MS conditions: Acquisition mode was TIC scan, ion source temperature was 230 °C, quadrupole temperature was 150 °C, ionization mode was EI, electron energy was 70 eV, and scan quality range was 29–500 Amu.

[0100] The ion chromatogram detected by GC-MS is as follows: Figure 11 As shown, the experimental group MoGES+GPP exhibited a characteristic ion peak at a retention time of 11.10 min, which is consistent with the ion chromatography of geraniol standard (Standard). Figure 1 The negative control group, MoGES(inactivated) + GPP, did not show a characteristic ion peak at a retention time of 11.10 min.

[0101] The mass spectrum detected by GC-MS is as follows Figure 12 As shown, the mass spectrum of the product peak in the experimental group is compared with that of the geraniol standard mass spectrum. Figure 1The products exhibited the same characteristic ion peaks at m / z 41.0, 69.1, 93.0, and 123.0, confirming that the product in the experimental group was geraniol.

[0102] Figure 11 and Figure 12 The results show that the MoGES protein obtained in Section 6.3 of this example has geraniol synthase activity and can catalyze the production of geraniol from GPP in vitro.

[0103] Example 7 A method for generating geraniol from geraniol by catalysis of Morinda officinalis geraniol synthase MoGES protein includes the following steps: (1) Prepare a reaction system, which consists of the following components and their final concentrations: 4-Hydroxyethylpiperazine ethanesulfonic acid (HEPES), with a molar concentration of 30 mM and a pH of 7.3; Geraniyl pyrophosphate (GPP) at a mass concentration of 50 μg / mL; Dithiothreitol (DTT), with a molar concentration of 5 mM; Glycerin, with a volume concentration of 5%; MgCl2, with a molar concentration of 10 mM; MnCl2, with a molar concentration of 1.25 mM; Morinda officinalis leaf extract synthase MoGES protein, the amino acid sequence of which is shown in SEQ ID NO. 2, and the mass concentration is 75 μg / mL; Solvent: ddH2O, balance; (2) Incubate the reaction system prepared in step (1) at 26 °C for 0.5 h.

[0104] Example 8 A method for generating geraniol from geraniol by catalysis of Morinda officinalis geraniol synthase MoGES protein includes the following steps: (1) Prepare a reaction system, which consists of the following components and their final concentrations: 4-Hydroxyethylpiperazine ethanesulfonic acid (HEPES), with a molar concentration of 40 mM and a pH of 7.5; Geraniyl pyrophosphate (GPP) with a mass concentration of 60 μg / mL; Dithiothreitol (DTT) with a molar concentration of 8 mM; Glycerin, with a volume concentration of 7.5%; MgCl2, with a molar concentration of 12 mM; MnCl2, with a molar concentration of 1.40 mM; Morinda officinalis leaf extract synthase MoGES protein, the amino acid sequence of which is shown in SEQ ID NO. 2, and the mass concentration is 87 μg / mL; Solvent: ddH2O, balance; (2) Incubate the reaction system prepared in step (1) at 30 °C for 3 h.

[0105] Example 9 A method for generating geraniol from geraniol by catalysis of Morinda officinalis geraniol synthase MoGES protein includes the following steps: (1) Prepare a reaction system, which consists of the following components and their final concentrations: 4-Hydroxyethylpiperazine ethanesulfonic acid (HEPES), with a molar concentration of 50 mM and a pH of 7.8; Geranyl pyrophosphate (GPP) with a mass concentration of 75 μg / mL; Dithiothreitol (DTT), with a molar concentration of 10 mM; Glycerin, with a volume concentration of 10%; MgCl2, with a molar concentration of 15 mM; MnCl2, with a molar concentration of 1.5 mM; Morinda officinalis leaf extract synthase MoGES protein, the amino acid sequence of which is shown in SEQ ID NO. 2, and the mass concentration is 100 μg / mL; Solvent: ddH2O, balance; (2) Incubate the reaction system prepared in step (1) at 32 °C for 6 h.

Claims

1. A Morinda officinalis leaf alcohol synthase MoGES Genes, characterized by, The Morinda officinalis leaf alcohol synthase MoGES The nucleotide sequence of the coding region of the gene is shown in SEQ ID NO.

1.

2. The Morinda officinalis leaf extract enzyme encoded by the gene as described in claim 1 MoGES Its characteristics are, The Morinda officinalis leaf alcohol synthase MoGES The amino acid sequence is shown in SEQ ID NO.

2.

3. An expression vector containing the encoding gene of claim 1, or an engineered bacterium containing the expression vector.

4. Overexpression of the Morinda officinalis leaf extract enzyme as described in claim 1 MoGES Application of genes in increasing geraniol content in plants.

5. The Morinda officinalis leaf extract enzyme according to claim 1 MoGES Gene, or the Morinda officinalis leaf extract enzyme as described in claim 1 MoGES Mutants or codon-optimized variants of the gene, or the Morinda officinalis leaf extract enzyme as described in claim 1. MoGES The application of a gene-encoded protein, or a fusion protein comprising the protein encoded by the Morinda officinalis geraniol synthase gene of claim 1 and geraniol pyrophosphate synthase or other terpene metabolic pathway enzymes, or the expression vector of claim 3, or the engineered bacteria of claim 3, in the preparation of geraniol and geraniol derivatives, or the preparation of an in vitro enzymatic reaction system for geraniol synthesis.

6. The application as described in claim 5, characterized in that, The application is to catalyze the synthesis of geraniol from geraniyl pyrophosphate (GPP).

7. A method for increasing the geraniol content in Morinda officinalis, characterized in that, Includes the following steps: (1) Construct a plant overexpression vector containing Morinda officinalis geranium synthase. MoGES The nucleotide sequence of the gene, as shown in SEQ ID NO: 1; (2) Introduce the vector constructed in step (1) into Agrobacterium to obtain the infecting and transforming bacteria; (3) Infect Morinda officinalis explants with the aforementioned transforming bacteria and co-culture them; (4) The explants after co-culture were screened and regenerated on a medium containing screening agents to obtain transgenic Morinda officinalis plants or hairy roots; (5) Identify and culture the transgenic Morinda officinalis plants or hairy roots, wherein the overexpression of Morinda officinalis geraniol synthase MoGES protein results in a higher Morinda officinalis geraniol content than the non-transgenic control.

8. An engineered strain BL21(DE3)-MoGES expressing geraniol synthase, characterized in that, The construction method of the engineered strain BL21(DE3)-MoGES is as follows: (S1) Using the pCE2_TA-Blunt-Zero recombinant vector pCE2_TA-Blunt-Zero-MoGES containing the nucleotide sequence shown in SEQ ID NO. 1 as a template, and using MoGES-pET32a-F / MoGES-pET32a-R as primers, a PCR reaction was performed. After the PCR product was detected, the pET32a-MoGES insert fragment was recovered. The pET32a-MoGES-F sequence is: TATCGGATCCGAATTCATGGCATGCTCCACCAGC. The pET32a-MoGES-R sequence is: GTGGTGGTGCTCGAGATTAATTATAGGAGTGAAAAACAAAGCCTTTACATAATTATCG; The PCR reaction conditions were as follows: 95 °C, pre-denaturation for 3 min; 95 °C, denaturation for 15 s; 60 °C, annealing for 20 s; 72 °C, extension for 2 min; 35 cycles of amplification; 72 °C, final extension for 10 min. The PCR reaction system is shown in Table 4. Table 4. PCR reaction system for amplifying the pET32a-MoGES insert fragment (S2) The pET32a vector plasmid was double-digested with the restriction enzymes EcoRI and XhoI from New England Biolabs to prepare a linearized vector, and the pET32a linearized vector was recovered and purified. (S3) The pET32a-MoGES insert fragment was ligated to the pET32a linearized vector via homologous recombination to obtain the recombination product; (S4) The recombinant product was transformed into BL21(DE3) competent cells, and the engineered strain BL21(DE3)-MoGES was obtained by screening.

9. A method for producing Morinda officinalis leaf extract synthase (MoGES) protein, characterized in that, Includes the following steps: Step 1: Inoculate the engineered strain BL21(DE3)-MoGES obtained according to claim 9 into LB medium containing 50 mg / mL Amp and incubate overnight at 37 ℃ and 200 rpm. Step 2: Inoculate the overnight cultured bacterial suspension into fresh LB medium containing 50 mg / mL Amp, and incubate at 37 ℃ and 200 rpm until the bacterial cell OD reaches the target value. 600 Reaching 0.6-0.8; Step 3: Add IPTG to the culture system to a final concentration of 0.1-1.0 mM, and induce expression at 15-30 ℃ for 4-20 hours; Step 4: Centrifuge to collect the induced bacterial cells. Add Tris-HCl containing 300 mM NaCl and pH 7.8 to the precipitate to a final concentration of 50 mM to resuspend the induced bacterial cells. Then add PMSF to a final concentration of 1 mM. Step 5: The bacterial culture was broken and resuspended using a high-pressure homogenizer, and the supernatant containing Morinda officinalis leaf extract synthase (MoGES) protein was collected after centrifugation. Step 6: After incubating the supernatant with the Ni-NTA agarose column, transfer it to an empty column tube and add elution buffer of increasing imidazole concentration to wash away impurities. Add buffer 1, allow to flow naturally, and repeat the rinse three times; buffer 1 consists of 50 mM Tris-HCl, 300 mM NaCl and 10 mM imidazole, and the pH of buffer 1 is 7.

8. Add buffer 2, allow to flow naturally, and repeat the rinse three times; buffer 2 consists of 50 mM Tris-HCl, 300 mM NaCl and 20 mM imidazole, and the pH of buffer 2 is 7.

8. Add buffer 3, allow to flow naturally, and repeat rinsing three times; buffer 3 consists of 50 mM Tris-HCl, 300 mM NaCl and 50 mM imidazole, and the pH of buffer 3 is 7.

8. Elute with buffer 4, which contains 50 mM Tris-HCl, 300 mM NaCl and 250 mM imidazole, and has a pH of 7.

8. Step 7: Desalt or dialyze the collected eluent to obtain purified Morinda officinalis leaf alcohol synthase MoGES protein.

10. A method for the production of geraniol from geranium pyrophosphate (GPP) catalyzed by Morinda officinalis geraniol synthase (MoGES) protein, characterized in that, Includes the following steps: (1) Prepare a reaction system, which consists of the following components and their final concentrations: 4-Hydroxyethylpiperazine ethanesulfonic acid (HEPES), with a molar concentration of 30-50 mM and a pH value of 7.3-7.8; Geranyl pyrophosphate (GPP) at a mass concentration of 50-75 μg / mL; Dithiothreitol (DTT), with a molar concentration of 5-10 mM; Glycerin, with a volume concentration of 5%-10%; MgCl2, with a molar concentration of 10-15 mM; MnCl2, with a molar concentration of 1.25-1.5 mM; Morinda officinalis leaf extract synthase MoGES protein, the amino acid sequence of which is shown in SEQ ID NO. 2, and the mass concentration is 75-100 μg / mL; Solvent: ddH2O, balance; (2) Incubate the reaction system prepared in step (1) at 26-32 °C for 0.5-6 h.

Images