Application of kiwifruit transcription factor AcWRKY84 gene in resistance to botrytis cinerea
By silencing the AcWRKY84 gene in kiwifruit, the problem of kiwifruit resistance to gray mold was solved, the resistance of the fruit was reduced, the possibility of successful breeding was increased, and resistance gene resources were provided.
Patent Information
- Application Number
- CN202610219099.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-24
- Publication Date
- 2026-07-24
- Estimated Expiration
- 2046-02-24
Smart Images

Figure CN121801951B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant genetic engineering technology, specifically to a kiwifruit transcription factor. AcWRKY84 Application of genes in fruit resistance to gray mold. Background Technology
[0002] The fruit is sweet and nutritious, possessing high edible and medicinal value. However, the "Hongyang" kiwifruit is susceptible to diseases such as canker, soft rot, and gray mold. Among these, rot caused by latent infection of gray mold is the most severe, with a rot rate as high as 30%. Gray mold is caused by Botrytis cinerea (… Botrytiscinerea This fungus, belonging to the Deuteromycetes, causes gray mold. Botrytis cinerea colonies are extensive, fluffy, and have well-developed aerial hyphae, typically appearing grayish-brown. Under suitable temperature and humidity, this fungus produces conidia, which are spread through the air, infecting various parts of the plant, including leaves, flowers, and fruits. It mainly occurs during the flowering, young fruit, and storage stages of kiwifruit, and is the most serious post-harvest disease, causing fruit rot, quality decline, and, in severe cases, affecting the entire orchard's yield. Currently, with climate change and increased planting density, the frequency and severity of gray mold are constantly rising, posing a significant challenge to the kiwifruit industry. Summary of the Invention
[0003] To identify the functions of different genes in response to gray mold infection in kiwifruit and provide sufficient gene resources for gray mold resistance breeding in kiwifruit, this invention aims to provide a kiwifruit transcription factor. AcWRKY84 A new application of the gene: inhibiting the expression of this gene significantly weakens the resistance of kiwifruit to gray mold.
[0004] To achieve the above objectives, the technical solution provided by the present invention is as follows:
[0005] This invention provides a transcription factor that regulates the resistance of kiwifruit to gray mold. AcWRKY84 The gene, the coding sequence of which is shown in SEQ ID NO. 1, and the amino acid sequence of which is shown in SEQ ID NO. 2, is expressed by silencing the gene. AcWRKY84 Genes reduce the resistance of kiwifruit to gray mold.
[0006] A kiwifruit transcription factor AcWRKY84 Application of the gene in the resistance of kiwifruit to gray mold, the coding sequence of the gene is shown in SEQ ID NO .1, and the amino acid sequence is shown in SEQ ID NO .2.
[0007] This invention also provides a transcription factor that regulates the above-mentioned resistance of kiwifruit to gray mold. AcWRKY84The primers for gene amplification are shown in SEQ ID NO.3 and SEQ ID NO.4.
[0008] Furthermore, the present invention also provides a solution containing the above-mentioned kiwifruit transcription factor. AcWRKY84 Genetically engineered bacteria.
[0009] The present invention has the following beneficial effects: Because plant resistance to gray mold exhibits a quantitative trait characteristic controlled by multiple genes, with resistance phenotypes synergistically regulated by multiple genes and susceptible to environmental influences, resulting in continuous variation, and because no clearly defined major genes for gray mold resistance have yet been cloned in plants, the identification of numerous gray mold-related gene loci becomes particularly important in plant breeding. Understanding the regulatory network composed of multiple genes will help researchers understand the resistance mechanisms of gray mold in different varieties and achieve variety optimization based on gene interactions.
[0010] This invention provides a transcription factor that regulates the resistance of kiwifruit to gray mold. AcWRKY84 The gene, when its expression is silenced, significantly reduces the resistance of kiwifruit to gray mold. This invention clones... AcWRKY84 The gene was identified and its role in resisting gray mold in kiwifruit was demonstrated. Specifically, after inoculation with the virus, the experimental group showed more severe symptoms and a significantly larger infected area compared to the control group. The activities of SOD, POD, and CAT enzymes in the fruit were also significantly reduced compared to the control group. This provides sufficient gene resources for the gray mold resistance gene pool of kiwifruit, thereby greatly increasing the possibility of successfully breeding highly resistant varieties of gray mold in the future. Attached Figure Description
[0011] Figure 1 Inhibit expression AcWRKY84 Phenotypic observation of kiwifruit infected with gray mold compared to the control group.
[0012] Figure 2 Inhibit expression AcWRKY84 Statistics on the area of lesions in kiwifruit infected with gray mold for 3 days and 5 days compared to the control group.
[0013] Figure 3 Inhibit expression AcWRKY84 Changes in POD activity in kiwifruit infected with gray mold for 3 and 5 days compared to the control group.
[0014] Figure 4 Inhibit expression AcWRKY84 Changes in SOD activity in kiwifruit infected with gray mold for 3 and 5 days compared to the control group.
[0015] Figure 5 Inhibit expression AcWRKY84Changes in CAT activity in kiwifruit infected with gray mold for 3 and 5 days compared to the control group. Detailed Implementation
[0016] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention, but the present invention is not limited to the scope of the specific embodiments.
[0017] All carriers and the 'Hongyang' kiwifruit variety used in the following examples were obtained from Chongqing Sanlei Tiantian Agricultural Development Co., Ltd., and all reagents were commercially available. The *Botrytis cinerea* strain used in the experiment was our laboratory's preserved strain CJLC2, stored at -80℃. After being removed from the ultra-low temperature freezer, it was thawed on ice, aseptically inoculated onto PDA medium, and activated by incubation at 25℃ for three weeks. It was then transferred to a new medium and incubated for another two weeks before being diluted and used to infect kiwifruit.
[0018] Example 1: Kiwi fruit transcription factor AcWRKY84 Obtaining gene silencing sequences Total RNA was extracted from kiwifruit using the Biosharp Polysaccharide and Polyphenol Plant Total RNA Extraction Kit. Kiwifruit leaves were ground into powder using liquid nitrogen and transferred to 1.5 ml RNase-free centrifuge tubes. Immediately after centrifugation, 600 μL of Buffer PSL lysis buffer was added, and the mixture was vortexed for 30 seconds and centrifuged at 12000 rpm for 5 min. After centrifugation, 500 μL of the supernatant was transferred to an adsorption column (Fast Pureg DNA-Filter Columns III) with a collection tube and centrifuged at 12000 rpm for 30 seconds. After centrifugation, the adsorption column was removed, and the filtrate was collected. 250 μL of anhydrous ethanol was added to the collection tube, and the mixture was vortexed for 15 seconds. The mixture obtained in the previous step was transferred to an adsorption column (Fast Pure RNA Columns V) with a collection tube and centrifuged at 12000 rpm for 30 seconds. After centrifugation, the filtrate was discarded. 700 μL of Buffer RWA was added to the adsorption column, and the mixture was centrifuged at 12000 rpm for 30 seconds. After centrifugation, the filtrate was discarded. Add 500 μL of Buffer RWB (confirm 48 mL of anhydrous ethanol has been added before use) to the adsorption column, centrifuge at 12000 rpm for 30 seconds, and discard the filtrate after centrifugation. Repeat this washing step to ensure complete removal of impurities. Place the adsorption column back into the collection tube and centrifuge at 12000 rpm for 2 minutes. After centrifugation, open the cap of the collection tube and leave it in an unoccupied area for 5 minutes to allow residual alcohol in the adsorption column to evaporate. Then, place the adsorption column into a new 1.5 mL centrifuge tube, add 80 μL of RNase-free ddH2O to the center of the adsorption column, let it stand for 2 minutes, centrifuge at 12000 rpm for 1 minute, and collect the RNA solution. Using total RNA as an experimental template, cDNA was synthesized by reverse transcription using All-in One First-Strand Synthesis Master Mix (containing dsDNase, Jiangsu Baishimei Biotechnology Co., Ltd.). Add 1 μg total RNA, 4 μL All-in-One First-Strand Synthesis Master Mix, and 1 μL dsDNase to a PCR tube, then add ddH2O to a final volume of 20 μL. Incubate at 37°C for 2 min, 55°C for 15 min, and 85°C for 5 min to terminate the reaction. Store at -20°C.
[0019] Obtained from the Sapindaceae Genome Database (https: / / www.sapindaceae.com / GeneSearch / GeneSearch.html) AcWRKY84 The gene sequence information, its base sequence is shown in SEQ ID NO. 1, and its amino acid sequence is shown in SEQ ID NO. 2. According to... AcWRKY84The gene's base sequence was designed as follows, and primers were used to construct the silencing vector fragment: Upstream primer: tgctcatcatcacctacacgtc (SEQ ID NO. 3) Downstream primer: ggctcttcatcaaccagaacattttc (SEQ ID NO. 4) The cDNA obtained from the reverse transcription process was used as a template for amplification. The enzyme mixture used in the PCR reaction was 2×Taq plus Master Mix with Dye (White Shark Biotechnology Co., Ltd.). The PCR reaction system was as follows: 2×Taq plus Master Mix with Dye, 12.5 μL; sterile water, 10.5 μL; cDNA template, 1 μL; forward and reverse primers, 0.5 μL each. The reaction conditions are shown in Table 1.
[0020] Table 1 PCR reaction conditions
[0021] After observing bands in a fluorescence image analysis system, the amplified PCR products were removed and placed in an automated gel imaging system. Clearly visible bands were cut and placed into appropriate centrifuge tubes, and analyzed using EZNA. ® The GelExtraction Kit is used for purification and recovery.
[0022] Example 2 AcWRKY84 Construction of silencing vectors and analysis of resistance to gray mold 1. Construction of expression carrier The purified and recovered PCR product was ligated into the intermediate vector GV pX19-T Vector and sequenced for verification. The fragment size was 253 bp, and the base sequence is shown in SEQ ID NO. 5. The correctly sequenced plasmid was extracted, and both the TRV2 vector and the plasmid were double-digested with Kpn I and BamHI. Then, a DNA ligase containing [the desired fragment size] was used to construct [the appropriate ligation method]. AcWRKY84 The target gene silencing expression vector was then transformed into *E. coli* DH5α and cultured on Kana resistance plates. Resistant colonies were picked for PCR identification; plasmids were extracted from PCR-positive strains and further sequenced for verification. After confirming the sequence was correct, the constructed TRV2-AcWRKY84 silencing expression vector was mixed with the TRV1 vector at a 1:1 ratio and co-transformed into *Agrobacterium* GV3101.
[0023] 2. Disease resistance analysis The successfully transformed Agrobacterium GV301 was used to transiently transform 140 days after pollination into nearly mature 'Hongyang' kiwifruit that were uniform in size, undamaged, and free from pests and diseases. Using a sterile pipette tip, holes were evenly punched, and after drying, 10 μL of activated bacterial solution was injected into the pores to infect the kiwifruit. The fruit was then dried again, and the injection was repeated three times. The inoculum concentration of the Botrytis cinerea spore suspension was 1... 10 6 The control group was treated with 10 μL of sterile water to inoculate kiwifruit fruits. Fruit pulp samples from the diseased / healthy zone of both groups were rapidly frozen in liquid nitrogen at a fixed time each day. Samples were taken at different time points after inoculation (0, 24, 48, 72, 96, and 124 h) to analyze the fruit rot rate and lesion diameter in both groups, and to detect changes in defensive enzyme activity. Phenotypic observation ( Figure 1 ) and lesion area ( Figure 2 Statistical results showed that a significant difference in the degree of rot was observed between the two groups of kiwifruit three days after infection with Botrytis cinerea; by the fifth day... AcWRKY84 Extensive rot occurred around the wounds on kiwifruit, while the control group, which was silent, showed relatively mild rot symptoms at the wound sites. The activities of SOD, POD, and CAT were measured using a superoxide dismutase (SOD) activity assay kit (Beijing Solarbio Science & Technology Co., Ltd., BC0170), a peroxidase (POD) activity assay kit (Beijing Solarbio Science & Technology Co., Ltd., BC0090), a catalase (CAT) activity assay kit (Beijing Solarbio Science & Technology Co., Ltd., BC0680), and an ELISA reader (Tianjin Seres Automation Technology Co., Ltd.). The measurement procedures and calculation methods followed the kit instructions.
[0024] The t-test method in GraphPad Prism 10 software was used for significance analysis. The area of kiwifruit lesions was calculated using ImageJ software. The results showed that silent expression... AcWRKY84 Subsequently, the lesion area of the transgenic fruit was larger than that of the control group. On the third day, the lesion area of the transgenic fruit was 3.05 times that of the control group; on the fifth day, it was 5.92 times that of the control group. In addition, the activities of SOD, POD, and CAT enzymes in the transgenic fruit were significantly reduced. Among SOD enzymes, the transgenic fruit showed a decrease of 36.48 U / g on the third day compared to the wild-type control group, and a decrease of 57.67 U / g on the fifth day. Figure 3 In POD enzymes, the transgenin level decreased by 18.29 U / g on day 3 compared to the wild-type control group, and by 147.76 U / g on day 5. Figure 4 In the CAT enzyme, the transgenin level decreased by 38.33 U / g on day 3 compared to the wild-type control group, and by 10.97 U / g on day 5. Figure 5These results indicate that silencing occurs in kiwifruit. AcWRKY84 Genes can reduce the resistance of kiwifruit to gray mold by inhibiting the activity of SOD, POD and CAT enzymes.
Claims
1. Application of inhibiting the kiwifruit transcription factor AcWRKY84 gene in the resistance of kiwifruit to gray mold. The coding sequence of the gene is shown in SEQ ID NO. 1, and the amino acid sequence it encodes is shown in SEQ ID No. 2.