CD90-targeted nano-drug delivery system and application thereof in preparation of drugs for treating alopecia senescens

By modifying the surface of mesoporous silica nanoparticles with DNA aptamers targeting CD90, precise delivery of hair follicle stem cells was achieved, solving the problem of insufficient targeting of existing drugs in the treatment of age-related hair loss, improving the stability and delivery efficiency of DHA, and enhancing the hair follicle regeneration capacity.

CN121818962AActive Publication Date: 2026-04-10PEKING UNIV SCHOOL OF STOMATOLOGY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202610079295.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-21
Publication Date
2026-04-10
Estimated Expiration
2046-01-21

AI Technical Summary

Technical Problem

Existing drugs are unable to achieve precise targeted delivery to senescent hair follicle stem cells, resulting in poor treatment effects for age-related hair loss. Traditional drugs lack the ability to recognize hair follicle stem cells, and DHA has insufficient stability in the skin and hair follicle areas, making it difficult to reverse the weakening of dry function and regeneration disorders of senescent HFSCs.

Method used

Mesoporous silica nanoparticles were used as carriers, and DNA aptamers targeting CD90 were modified with PEG segments to achieve selective binding of nanoparticles to hair follicle stem cells. DHA was loaded to improve their enrichment and stability in the hair follicle region.

Benefits of technology

It achieves selective recognition and targeted binding of hair follicle stem cells, improves the stability and utilization of DHA in the skin and hair follicle areas, enhances the drug delivery capability to the hair follicle stem cell microenvironment, improves hair follicle regeneration disorders, and enhances the treatment effect of age-related hair loss.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121818962A_ABST
    Figure CN121818962A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biological medicine, in particular to a CD90-targeted nano-drug delivery system and application of the CD90-targeted nano-drug delivery system in preparation of a drug for treating alopecia senescens. Efficient loading and stable release of an anti-aging drug dihydroartemisinin (DHA) are realized through the dendritic ordered porous structure; furthermore, the surfaces of the nano-particles are covalently modified by using a CD90-targeting aptamer A15518, so that the nano-particles are endowed with the targeting capability of selectively recognizing the senescent hair follicle stem cells and the microenvironment of the senescent hair follicle stem cells. The nano-drug delivery system provided by the invention can significantly improve the enrichment efficiency of the drug at the hair follicle part, enhance the regulation effect of the drug on the aging-related pathway, and promote the aging hair follicle to enter the growth period, so that the nano-drug delivery system can be used for preparing drugs or related preparations for treating aging alopecia.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of nanodrug delivery systems, in particular to a CD90-targeted nanodrug delivery system and its application in the preparation of a drug for treating senescent alopecia. BACKGROUND

[0002] As a globally high-incidence senescence-related phenotype, senescent alopecia still has limited clinical treatment methods at present: traditional drugs such as minoxidil and finasteride mainly act on blood flow or androgen pathways, which not only have slow effect and rebound after drug withdrawal, but also often cause adverse reactions such as skin irritation and sex hormone imbalance; hair transplantation surgery can improve appearance, but has high cost and strong invasiveness, and does not have the ability to restore the intrinsic biological function of hair follicles, making it difficult to popularize in large-scale populations. These means are difficult to meet the clinical needs, and the core is that they do not directly attack the cause and cannot solve the problem of senescent hair follicle stem cell (HFSCs) functional decline from the root. With age, senescent HFSCs show decreased stemness, weakened proliferation ability, and promote stress-driven asymmetric division patterns, making senescent HFSCs more prone to terminal differentiation in the epidermis, ultimately leading to miniaturization of hair follicles, depletion of HFSCs, and damage to hair regeneration cycles. However, existing drugs generally lack precise action on senescent HFSCs, making it difficult to reverse their stemness decline and restore biological function, thereby severely limiting the long-term efficacy of current treatment options, which is a core problem that needs to be solved in hair loss prevention and treatment.

[0003] For precise action on senescent HFSCs, the key lies in achieving specific recognition and targeted delivery of HFSCs. Studies have found that CD90 (Thy-1) is one of the markers highly expressed on the surface of adult hair follicle stem cells, and has good cell population specificity, providing a reliable receptor basis for constructing HFSC targeting strategies. Based on this, in recent years, the technology of using aptamer as a targeting ligand has gradually attracted attention. Aptamer is a short-chain nucleic acid molecule that can bind to specific protein epitopes with high selectivity and non-covalent binding, and its binding affinity can reach the level of monoclonal antibodies, while it has the advantages of easy synthesis, chemical modification, good hydrophilicity, and low immunogenicity. Modifying CD90-targeting DNA aptamer on the surface of nanodrugs can enable nanoparticles to selectively bind to hair follicle stem cells through receptor-ligand recognition between aptamer and CD90, thereby achieving more efficient localization and enrichment in the hair follicle area. This CD90 marker-based targeting strategy provides a new technical approach to improving the delivery efficiency of drugs to senescent HFSCs and breaking through the limitations of traditional hair follicle treatment methods in terms of targeting.

[0004] Dihydroartemisinin (DHA) has been found to have multiple potential anti-aging and tissue regeneration regulatory effects in recent years, including improving cellular oxidative stress levels, promoting mitochondrial function homeostasis, and restoring stem cell activity, making it have certain application prospects in the intervention of senescent alopecia. However, as a small molecule drug, DHA has the characteristics of short half-life, easy degradation, and weak hydrophilicity, making it difficult to achieve effective enrichment in the skin and hair follicle area. In addition, due to the lack of specific targeting mechanism, free DHA is difficult to accurately enter the microenvironment of the bulge region where hair follicle stem cells are located, making it difficult to reverse the reduced stemness function and regeneration disorder of senescent HFSCs. In order to improve the local stability and targeted distribution of DHA, strategies based on nanomedicine delivery systems have gradually attracted attention. Mesoporous silica nanoparticles (MSN) have high specific surface area, regular pore structure and good biocompatibility, which can significantly improve the loading efficiency and sustained release capacity of DHA; if further combined with cell surface markers for molecular-level targeting modification, it is expected to improve the localization ability of drugs in the hair follicle area. However, the existing delivery system generally lacks specific targeting means for senescent hair follicle stem cells, making it difficult to solve the key bottleneck of effective delivery of DHA in the hair follicle and selective entry of cells.

[0005] In summary, although DHA has potential anti-aging and stem cell function regulation effects, it is limited by its insufficient stability in the skin, difficulty in accumulating in the hair follicle area, and lack of selective delivery ability for hair follicle stem cells, which has significantly limited its application in the treatment of senescent alopecia. At the same time, although the surface molecular characteristics of senescent HFSCs have been relatively clear, CD90 (Thy-1) is considered an important marker for adult hair follicle stem cells, but the existing delivery system generally does not use this target for molecular-level targeting design, lacks the ability to recognize HFSCs, making it difficult for drugs to accurately act on the functionally declining HFSCs population, unable to improve the hair follicle regeneration disorder from the root, limiting the long-term effectiveness of existing treatment strategies. Therefore, there is an urgent need in the art to construct a nanomedicine system that can simultaneously achieve accurate targeting of hair follicle stem cells and efficient delivery of DHA to improve the treatment effect of senescent alopecia. SUMMARY

[0006] The application aims to provide a nano drug delivery system targeting CD90 and its application in the preparation of a drug for treating senescent alopecia.

[0007] To solve the above technical problems, the application provides the following technical solutions: A nano drug delivery system targeting CD90, referred to as DNAM@DHA, uses mesoporous silica nanoparticles as a core carrier, loads dihydroartemisinin in the pore structure of the MSN, and connects a nucleic acid aptamer A155_18 targeting CD90 to the surface of the MSN through a polyethylene glycol segment, so that the nanoparticles can selectively recognize hair follicle stem cells and achieve targeted delivery of DHA, wherein the sequence of the nucleic acid aptamer A155_18 is 5'-NH2-GCCAGTTCCGGAACCCTGCGTCGGGTGCGTCCTC-dT-3', as shown in SEQ ID NO: 1.

[0008] The construction method of the nano drug delivery system targeting CD90 provided by the application comprises: (1) Construction method of mesoporous silica nanoparticles MSN: the MSN with regular pore structure is constructed by a multi-phase assembly method induced by a surfactant, which is used as a carrier of dihydroartemisinin and for subsequent surface functionalization modification.

[0009] (2) Construction method of PEG functionalized MSN: by introducing amine groups or carboxyl reactive groups on the surface of the MSN, the PEG segment can be connected to the surface of the MSN by chemical coupling, forming a PEG functionalized nano platform, which is used to improve the particle dispersibility, biocompatibility and surface modifiability.

[0010] (3) DHA loading method: by using the mesoporous structure of the MSN, DHA is loaded in the pore channel of the MSN by physical adsorption or embedding, obtaining a PEGM@DHA nanoparticle with drug loading function.

[0011] (4) The connection method of the CD90 nucleic acid aptamer A155_18: the DNA aptamer with the sequence of 5'-NH2-GCCAGTTCCGGAACCCTGCGTCGGGTGCGTCCTC-dT-3' is connected to the end of the PEG chain segment by chemical coupling, so that the aptamer is arranged in an exposed state on the surface of the nanoparticle, thereby endowing the nanomedicine delivery system with specific recognition ability for the surface CD90 of the hair follicle stem cell.

[0012] (5) The construction method of the DNAM@DHA nanomedicine delivery system: the PEG-modified mesoporous silica nanoparticle loaded with DHA and the DNA aptamer targeting CD90 are combined, so that the nanoparticle can selectively bind to the hair follicle stem cell through the non-covalent interaction of the aptamer-receptor, realize the targeted delivery of DHA, and be used for improving the enrichment ability and cell targeting of the drug in the hair follicle area.

[0013] Further, the specific steps include the following steps: (1) Preparation of mesoporous silica nanoparticles MSN: The cetyltrimethylammonium chloride solution, triethanolamine and deionized water are mixed in a reaction container to form micelles under stirring; then the tetraethyl orthosilicate solution dissolved in cyclohexane is added dropwise into the water phase, and the stirring is continued, and after the reaction is completed, the milky white water phase is separated, and the MSN is recovered by centrifugation at 20,000 g; the obtained MSN is extracted with acidic methanol to obtain MSN solid and is dispersed in anhydrous ethanol for standby; (2) Preparation of anti-CD90 nucleic acid aptamer A155_18: The aptamer with the sequence of 5'-NH2-GCCAGTTCCGGAACCCTGCGTCGGGTGCGTCCTC-dT-3' is dissolved in a binding buffer to obtain an A155_18 storage solution with a final concentration of 0.5 μM, denaturation at 95℃ for 20 min, and renaturation at 4℃ for 20 min; (3) Amination of MSN: The MSN is dispersed in anhydrous ethanol containing ammonia water, and 3-aminopropyltriethoxysilane is added dropwise under stirring, and after the reaction, the product is collected by centrifugation and washed with ethanol to obtain aminated MSN, namely MSN-NH2; (4) PEG functionalization: The MSN-NH2 is dispersed in DMF; the NHS-PEG 2k -COOH is dissolved in DMF, and the MSN-NH2 dispersion is added dropwise, and the PEG is covalently connected to the surface of the MSN through the NHS-amino reaction under stirring, and the product is obtained by centrifugation and washing to obtain PEG-modified MSN, namely PEGM; (5) Loading of dihydroartemisinin DHA: The DHA and PEGM were mixed in ethanol at a mass ratio of 2:8. The ethanol was completely evaporated by purging with nitrogen, allowing the DHA to be encapsulated into the MSN channels to obtain PEGM@DHA powder, which was then stored at -80°C. (6) Grafting of A155_18: A155_18 and PEGM@DHA were dispersed in MES buffer, and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide and N-hydroxysuccinimide NHS were added. The reaction was carried out so that the carboxyl group at the end of PEG formed an amide bond with the primary amine of A155_18. After centrifugation and washing, the DNAM@DHA nanomedicine delivery system was obtained.

[0014] In step (1), the concentration of the hexadecyltrimethylammonium chloride solution is 25 wt%, the concentration of the TEOS solution dissolved in cyclohexane is 20 v / v %, and the acidic methanol is 37% HCl:methanol = 1:10; micelles are formed by stirring at 60°C and 50 rpm.

[0015] In step (2), the binding buffer contains 25 mM 4-hydroxyethylpiperazine ethanesulfonic acid, 5.4 mM MKCl, 2.8 mM CaCl2, 3.2 mM MgCl2, and 144 mM NaCl.

[0016] In step (3), the concentration of ammonia in the anhydrous ethanol containing ammonia is 28–30%; the reaction temperature is 25°C; and the reaction time is 24 hours.

[0017] In step (4), the mixture is stirred at 25°C for 24 hours to covalently link PEG to the MSN surface via the NHS-amino reaction.

[0018] In step (6), the reaction temperature is 37°C and the reaction time is 24 hours.

[0019] The CD90-targeting nanodrug delivery system described in this invention can be used to prepare drugs for treating age-related hair loss.

[0020] Compared with existing technologies, the CD90-targeted nanomedicine delivery system of the present invention and its application in the preparation of drugs for treating age-related hair loss have at least the following beneficial effects: (1) Selective recognition and targeted binding of hair follicle stem cells are achieved: This invention introduces a DNA aptamer targeting CD90 onto the surface of mesoporous silica nanoparticles. This aptamer can specifically recognize the CD90 protein on the surface of hair follicle stem cells through a non-covalent mechanism, enabling the nanomedicine delivery system to selectively bind to HFSCs in the hair follicle region and improve the drug's accumulation capacity in the target cell population. This targeting strategy based on cell surface markers overcomes the limitation of traditional drugs lacking the ability to recognize hair follicle stem cells.

[0021] (2) Improved stability and utilization of DHA in skin and hair follicle areas: Mesoporous silica nanoparticles have a high specific surface area and regular pore structure, which can encapsulate DHA inside the mesopores, which helps to improve the stability of DHA, slow down its degradation rate in the skin environment, and increase its retention time in the hair follicle, thereby improving the effective utilization of DHA under topical skin conditions.

[0022] (3) Enhanced drug delivery to the hair follicle stem cell microenvironment: Modification of the PEG chain segment can improve the water solubility and biocompatibility of nanoparticles, reduce non-specific adsorption of particles to skin tissue, thereby improving the diffusion ability of the nanosystem in the skin and hair follicle structure. Combined with the selective recognition effect of CD90 targeting aptamer, the delivery system of the present invention can more effectively enter the hair follicle bulge area, realizing targeted drug delivery to the microenvironment where HFSCs are located.

[0023] (4) A new treatment strategy for improving hair follicle regeneration: This invention can deliver DHA directly to the hair follicle stem cell population that has experienced functional decline, thereby improving the local effect efficiency of DHA in the target cell area, thus providing a new technical approach for improving hair follicle regeneration disorders and enhancing the treatment effect of age-related hair loss, overcoming the defects of insufficient targeting and limited drug effectiveness of traditional treatment methods. Attached Figure Description

[0024] The accompanying drawings in this application are intended to supplement the textual description in the specification with graphics, and to further explain the technical solution of this application. They do not constitute an undue limitation on this application.

[0025] Figure 1 This is a schematic diagram illustrating the fabrication of the DNAM@DHA nanomedicine delivery system. As shown, this invention uses mesoporous silica nanoparticles (MSN) as the base carrier, and modifies their surface with 3-aminopropyltriethoxysilane (APTES) to obtain MSN-NH2 with primary amine groups on the surface. Subsequently, NHS-PEG containing active esters is used... 2k-COOH undergoes an amidation reaction with MSN-NH2, achieving surface coupling of PEG segments to form PEG-functionalized nanoparticles (PEGM). Dihydroartemisinin (DHA) is loaded into the mesoporous structure of PEGM to obtain PEGM@DHA. Subsequently, through a coupling system containing the carboxyl activator EDC / NHS, the terminal amino group-containing anti-CD90 nucleic acid aptamer A155_18 is covalently linked to the surface of PEGM@DHA, ultimately forming the targeted nanodrug delivery system DNAM@DHA of this invention.

[0026] Figure 2 The figures show the physicochemical characterization of the DNAM@DHA nanomedicine delivery system. The figures display: (a) Scanning electron microscope (SEM) images of MSN and DNAM@DHA, showing the surface morphology of the particles; (b) Transmission electron microscope (TEM) images of MSN and DNAM@DHA, showing the internal porous structure of the nanoparticles; (c) Elemental mapping, showing the uniform distribution of elements on the surface of DNAM@DHA; (d) Thermogravimetric analysis (TGA) curves, characterizing the mass loss of MSN, MSN-NH2, PEGM, and PEGM@DHA; (e) Particle size distribution, showing the changes in the hydrated particle size of the nanoparticles at each stage; (f) Zeta potential analysis, showing the charge changes on the surfaces of MSN, MSN-NH2, and PEGM; and (g) The cumulative release curve of DHA, showing the drug release behavior of DNAM@DHA.

[0027] Figure 3 This is an immunofluorescence co-localization analysis of CD90 and CD34 in hair follicle tissue sections according to the present invention. The figure shows: (a) DAPI staining image, used to show the location of cell nuclei; (b) CD90 staining image, showing the spatial distribution of CD90, a hair follicle stem cell-related marker; (c) CD34 staining image, showing the expression region of CD34, a hair follicle-related stem cell marker; (d) a three-channel merged image, used to show the co-localization of CD90 and CD34 in the hair follicle region; (e) a local magnified view of the zoom region; (f) a fluorescence intensity distribution curve along the hair follicle region, showing the consistency of the spatial distribution of CD90 and CD34 signals; and (g) a Pearson correlation analysis diagram, showing the degree of correlation between the two signals.

[0028] Figure 4The figure shows the cellular uptake analysis of DNAM and hair follicle stem cells (HFSCs) after 4 hours of co-incubation. The figure shows: (a) the immunofluorescence image of the PEG-modified mesoporous silica nanoparticle (PEGM) treatment group, sequentially displaying nuclear staining (DAPI), cytoskeleton F-actin staining, nanoparticle tracking signal (Rh.B), and a combined image of the three; (b) the corresponding fluorescence image of the DNAM treatment group; and (c) a statistical graph comparing the intracellular nanoparticle fluorescence intensity (MFI per cell) between the two groups, used to demonstrate the difference in cellular uptake levels between DNAM and PEGM.

[0029] Figure 5 This image shows the targeting detection of DNAM in hair follicle tissue. The left side of the image displays the DAPI / PEGM dual-channel fluorescence image of the PEGM-treated group, showing the distribution of non-targeted nanoparticles in the hair follicle tissue; the right side displays the DAPI / DNAM dual-channel fluorescence image of the DNAM-treated group, illustrating the tissue distribution of targeted nanoparticles in the hair follicle region. DAPI (blue) indicates the location of cell nuclei, and the red fluorescence signal represents the localization of nanoparticles in the tissue.

[0030] Figure 6 Phenotypic analysis of senescent hair follicle stem cells (HFSCs) treated with DHA. The figures include: (a) cell proliferation curves showing absorbance changes between different concentrations of DHA and the control group during culture time; (b) bar charts showing changes in mRNA expression levels of SOX2, SOX9, OCT4, P21, and P53 genes; (c) Western blots showing protein expression levels of the above genes; (d) SA-β-gal, γH2A.X, and DCFH-DA staining images, demonstrating staining signals for cell senescence markers and oxidation levels; (e) immunofluorescence images of Ki67, SOX2, OCT4, SOX9, and p-S6; and (f) quantitative statistical plots corresponding to figures d and e, showing changes in the proportion of positive cells in different treatment groups.

[0031] Figure 7This is a graph showing the hair growth and related tissue indicators after the application of DNAM@DHA in an aging hair model. The figure includes: (a) an experimental schematic diagram showing the overall process of establishing the aging hair model, treating DNAM@DHA every 3 days, and collecting samples after 21 days; (b) images of the back skin appearance of the Vehicle and DNAM@DHA treatment groups at different time points (D0, D7, D14, D21); (c) an EdU staining image showing the proliferation of cells in the hair follicle area, with a combined DAPI / EdU image; (d) an immunofluorescence staining image of SOX9 showing the expression of hair follicle-related stem cell markers; (e) a statistical bar chart of skin pigmentation area, EdU-positive cell ratio, and COL17-positive area; (f) a bar chart of changes in mRNA expression levels of SOX2 and OCT4; and (g) immunofluorescence staining images of CD34, COL17, and DAPI, used to observe the tissue distribution of hair follicle structure and basement membrane-related proteins, with a combined three-channel image.

[0032] Figure 8 This image shows histological (HE) staining of major organs in mice treated with DNAM@DHA. The image displays HE-stained sections of the heart, liver, spleen, lungs, and kidneys from the Vehicle group and the DNAM@DHA treatment group. For each organ, tissue sections from both the Vehicle (top row) and DNAM@DHA (bottom row) groups are shown to observe differences in tissue morphology. Detailed Implementation

[0033] The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings.

[0034] Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art, and the reagents and materials in this invention are obtained from the market or other public channels.

[0035] Example 1 Preparation of mesoporous silica nanoparticles (MSN) MSN was prepared using a one-pot two-phase separation method. 48 mL (25 wt%) of CTAC solution, 0.36 g of triethanolamine (TEA), and 72 mL of deionized water were added to a 500 mL round-bottom flask and stirred at 60°C and 50 rpm for 1 h to form a micelle structure. Subsequently, 20 mL of TEOS cyclohexane solution (20 v / v%) was carefully added dropwise to the surface of the aqueous phase, and stirring was continued at 60°C for 24 h. After the reaction was complete, a milky white aqueous phase was obtained, and the MSN solid was collected by centrifugation at 20,000 g for 90 min. The obtained MSN was subjected to template removal treatment three times sequentially with acidic methanol (37% HCl:methanol = 1:10). The final precipitate was dispersed in anhydrous ethanol and stored at 4°C for later use.

[0036] Experimental results ( Figure 2 (a) and (b): SEM and TEM images show that MSN has a uniform spherical structure with a porous surface and uniform particle size.

[0037] Example 2: Renaturation and storage of anti-CD90 aptamer A155_18 The synthesized DNA aptamer has the sequence: 5'-NH2–GCCAGTTCCGGAACCCTGCGTCGGGTGCGTCCTC–dT–3'. The aptamer was dissolved in a binding buffer containing 25 mM HEPES, 5.4 mM KCl, 2.8 mM CaCl2, 3.2 mM MgCl2, and 144 mM NaCl to a final concentration of 0.5 μM. The solution was denatured at 95°C for 20 min and annealed at 4°C for 20 min to obtain the A155_18 stock solution for later use.

[0038] Example 3: Amination of MSN (MSN–NH2) Weigh 250 mg of MSN and disperse it in 50 mL of anhydrous ethanol. Add 1 mL of ammonia (28–30%) as a catalyst. Turn on magnetic stirring and add 4 mL of APTES dropwise at 25°C. Continue the reaction for 24 h. After the reaction is complete, centrifuge at 20000 g for 30 minutes at room temperature to collect the solid. Wash the solid repeatedly with ethanol and centrifuge three times to obtain aminated MSN (MSN–NH2).

[0039] Experimental results ( Figure 2 (f): The Zeta potential shifts from the negative potential of MSN to the positive potential, indicating that the amino group was successfully introduced.

[0040] Example 4 Preparation of PEG-modified MSN (PEGM) Disperse 100 mg MSN-NH2 in 10 mL DMF. Separately, disperse 108 mg NHS-PEG. 2k –COOH was dissolved in 15 mL of DMF. The PEG solution was added dropwise to the MSN–NH2 dispersion and magnetically stirred at 25°C for 24 h to form amide bonds via the NHS-amino reaction. After the reaction, the solid was collected by centrifugation at 20000 g for 30 minutes at room temperature, and washed repeatedly with ethanol and centrifuged three times to obtain PEG-modified MSN (PEGM).

[0041] Experimental results ( Figure 2 (e) The particle size distribution is slightly larger than that of MSN, and the Zeta potential value shifts towards the neutral direction, which is consistent with the characteristics of PEG modification.

[0042] Example 5: DHA Encapsulation (PEGM@DHA) PEGM and DHA were dispersed in ethanol at a mass ratio of DHA:PEGM = 2:8. After thorough mixing, the mixture was dried under nitrogen until the ethanol was completely evaporated, forming a solid powder. The resulting PEGM@DHA was stored at -80°C for later use.

[0043] Experimental results ( Figure 2 The TGA curve showed an increase in the weight loss of PEGM after DHA encapsulation, reflecting successful DHA loading; the release test showed that DHA was gradually released from DNAM@DHA.

[0044] Example 6: Aptamer coupling to form DNAM@DHA 10 mg of PEGM@DHA was weighed and dispersed in 10 mL of MES buffer (pH = 6.0); 200 nmol of A155_18 was added. Then, 0.959 mg of EDC and 0.288 mg of NHS were added, and the reaction was carried out at 37°C for 24 h, achieving covalent linkage of the aptamer via a carboxyl-primary amine reaction. After the reaction, the solid was collected by centrifugation at 20000g for 30 minutes at 4°C, and dispersed with deionized water to obtain the CD90-targeted nanodrug delivery system DNAM@DHA. Figure 1 A schematic diagram illustrating the construction of DNAM@DHA is shown.

[0045] Experimental results ( Figure 1 and Figure 2 The schematic diagram shows the successfully coupled structure; DLS and Zeta potential detection indicate a slight increase in particle size and a change in surface potential, consistent with coupling characteristics.

[0046] Example 7 Physicochemical property characterization of DNAM@DHA MSN, MSN–NH2, PEGM, PEGM@DHA, and DNAM@DHA were characterized as follows: (1) SEM / TEM (top of Figure 2) was used to observe particle morphology and pore structure. (2) EDS elemental mapping (Figure 2) was used to show the surface elemental distribution. (3) TGA (bottom left of Figure 2) was used to estimate the amount of modification and drug loading characteristics. (4) DLS particle size and Zeta potential (bottom middle of Figure 2) were used to measure the dynamic particle size distribution in the particle solution. (5) DHA release curve (bottom right of Figure 2) was used to monitor the cumulative release ratio of DHA under physiological conditions.

[0047] The results are shown in Figure 2: SEM / TEM showed that DNAM@DHA maintained a porous structure and had a uniform surface; EDS elemental diagram showed the elemental distribution of the aptamer and the PEG-modified aptamer; DLS showed that the particle size was concentrated and the stability was good.

[0048] Example 8: Histological analysis of CD90 expression in hair follicle stem cells Skin frozen sections were used for three-channel immunofluorescence staining of DAPI, CD90, and CD34. Colocalization analysis (Figure 3) was used to observe the expression of CD90 in the hair follicle region.

[0049] Experimental results ( Figure 3 CD90 and CD34 show partial overlap in distribution within the hair follicle bulge area; the high Pearson correlation coefficient indicates spatial consistency between the two. This result provides fundamental support for A155_18 targeting of hair follicle stem cells.

[0050] Example 9: In vitro HFSC-targeted uptake analysis of DNAM HFSCs were seeded in confocal dishes, and PEGM or DNAM labeled with Rh.B (50 μg / mL) was added to the culture plate. After co-incubation for 4 h, the cells were fixed and stained: DAPI represents the cell nucleus, F-actin represents the cytoskeleton, and Rh.B represents the nanoparticle localization. Figure 4 The distribution differences of DNAM and PEGM in HFSCs were shown, and the mean fluorescence intensity (MFI) of cells was calculated.

[0051] Experimental results ( Figure 4 The PEGM group showed less red signal, while the DNAM group had more obvious red granule distribution in cells. MFI statistics showed that the DNAM group had a higher average fluorescence intensity, indicating that HFSCs have different uptake abilities for PEGM and DNAM.

[0052] Example 10: Follicle tissue targeting of DNAM (in vivo) DNAM or PEGM (marked in red) was administered topically to the skin on the back of mice, and the skin tissue was frozen sectioned and counterstained with DAPI. Figure 5 This shows the difference in tissue distribution between the two groups of nanoparticles in the hair follicle region.

[0053] Experimental results ( Figure 5 The PEGM group showed a weaker red signal in the hair follicle area, while the DNAM group showed a greater distribution of red particles in the hair follicle area. This indicates a difference in the localization of the two groups of nanoparticles in the hair follicle tissue.

[0054] Example 11: Analysis of the Regulation of DHA on the Senescent HFSC Phenotype After culturing second-generation HFSCs to the 10th-12th generation, they were co-incubated with different concentrations of DHA (0, 0.1, 1, 10 μM) for 24 h, and the following were performed: (1) Cell proliferation detection (Figure 6(a)) OD450 was monitored using CCK-8. (2) Cell mRNA was collected for RT-qPCR to analyze the expression of SOX2, SOX9, OCT4, P21 and P53 genes. Figure 6 (b) (3) Collect cells for Western blot analysis to detect the protein expression levels of SOX2, OCT4, P16 and P53 in HFSCs ( Figure 6 (c)). (4) After cell fixation, staining was performed for cell senescence-related markers, including SA-β-gal, γ-H2A.X, and DCFH-DA ( Figure 6 (d)). (5) After fixing the cells, immunofluorescence of cell stemness-related markers was performed, including Ki67, SOX2, OCT4, SOX9, and p-S6 (Figure 6 (e)).

[0055] Experimental results ( Figure 6 ): 1μM DHA promotes cell proliferation more significantly over time; the expression of SOX2, SOX9, and OCT4 in the 1μM DHA treatment group showed an up-regulation trend, while the expression of P21 and P53 decreased; SA-β-gal staining positive cells decreased; γH2A.X signaling weakened; ROS level decreased; and the proportion of Ki67, SOX2, OCT4, and SOX9 positive cells increased.

[0056] Example 12: Application and Results of DNAM@DHA in an Aging Hair Model Male C57BL / 6j mice aged 20-24 months were selected as a model of senile alopecia. Hair removal cream was applied to the back of the mice and removed after 5 minutes. After washing with PBS, the color of the back skin was observed. After unifying the hair growth cycle (back skin was pink), DNAM@DHA (DNAM 50ug / ml, DHA 10 μM) and Vehicle (PEGM 50ug / ml) were injected intradermally every 3 days, and photos were taken. After 21 days, the mice were euthanized, and back skin tissue was collected for analysis. The analysis included: (1) Images of hair growth on the skin surface ( Figure 7 (b) Recordings were taken at D0, D7, D14, and D21; (2) EdU staining for hair follicle proliferation (Fig. 7(c)); (3) SOX9 immunofluorescence ( Figure 7 (d)); (4) Area of ​​skin pigmentation, EdU positivity rate, COL17 positivity area ( Figure 7 (e)); (5) Detection of SOX2 and OCT4 mRNA expression in skin tissue ( Figure 7 (f)); (6) CD34, COL17 immunohistostaining ( Figure 7 (g);(7)Hepatic iodine staining analysis of heart, liver, spleen, lungs and kidneys to analyze the in vivo biocompatibility of DNAM@DHA.

[0057] Experimental results (Figure 7): On days 14 and 21, a larger area of ​​hair coverage was observed on the back skin of the DNAM@DHA group; EdU staining showed more proliferating cells in the hair follicle area than in the control group; SOX9 and COL17 immunofluorescence signals were enhanced; and SOX2 and OCT4 mRNA expression was upregulated. These phenomena reflect the differences between the two groups in hair follicle tissue structure, proliferation, and the distribution of stem cell-related markers.

[0058] Experimental results (Figure 8): The tissue structures of the two groups of major organs maintained normal morphology, with no obvious inflammation, necrosis or other structural abnormalities visible.

[0059] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A nanomedicine delivery system targeting CD90, characterized in that: Using mesoporous silica nanoparticles as the core carrier, dihydroartemisinin is loaded into the pore structure of MSN, and a nucleic acid aptamer A155_18 targeting CD90 is connected to its surface via polyethylene glycol segments. This enables the nanoparticles to selectively recognize hair follicle stem cells and achieve targeted delivery of DHA. The sequence of the nucleic acid aptamer A155_18 is 5'-NH2-GCCAGTTCCGGAACCCTGCGTCGGGTGCGTCCTC-dT-3', as shown in SEQ ID NO:

1.

2. The method for constructing the CD90-targeted nanodrug delivery system according to claim 1, characterized in that, Includes the following steps: (1) Preparation of mesoporous silica nanoparticles (MSN): A hexadecyltrimethylammonium chloride solution, triethanolamine, and deionized water were mixed in a reaction vessel and stirred to form micelles. Then, a tetraethyl orthosilicate solution dissolved in cyclohexane was added dropwise to the aqueous phase while stirring continued. After the reaction was completed, the milky white aqueous phase was separated, and MSN was recovered by centrifugation at 20,000 g. The obtained MSN template was extracted with acidic methanol to obtain solid MSN, which was then dispersed in anhydrous ethanol for later use. (2) Preparation of anti-CD90 nucleic acid aptamer A155_18: The aptamer with the sequence 5'-NH2-GCCAGTTCCGGAACCCTGCGTCGGGTGCGTCCTC-dT-3' was dissolved in binding buffer to a final concentration of 0.5 μM, and denatured at 95 °C for 20 min and annealed at 4 °C for 20 min to obtain A155_18 stock solution. (3) Amination of MSN: MSN was dispersed in anhydrous ethanol containing ammonia, and 3-aminopropyltriethoxysilane was added dropwise with stirring. After the reaction, the product was collected by centrifugation and washed with ethanol to obtain amino-modified MSN, i.e., MSN-NH2. (4) PEG functionalization: MSN-NH2 was dispersed in DMF; NHS-PEG was then dispersed. 2k -COOH is dissolved in DMF, and MSN-NH2 dispersion is added dropwise. The mixture is stirred to allow PEG to covalently attach to the MSN surface via the NHS-amino reaction. After centrifugation and washing, PEG-modified MSN, i.e., PEGM, is obtained. (5) Loading of dihydroartemisinin DHA: DHA and PEGM were mixed in ethanol at a mass ratio of 2:

8. The ethanol was completely evaporated by purging with nitrogen, allowing DHA to be encapsulated into the MSN channels to obtain PEGM@DHA powder, which was then stored at -80°C. (6) Grafting of A155_18: A155_18 and PEGM@DHA were dispersed in MES buffer, and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide and N-hydroxysuccinimide were added. The reaction was carried out so that the carboxyl group at the end of PEG formed an amide bond with the primary amine of A155_18. After centrifugation and washing, the DNAM@DHA nanomedicine delivery system was obtained.

3. The method for constructing a CD90-targeted nanomedicine delivery system according to claim 2, characterized in that: In step (1), the concentration of the hexadecyltrimethylammonium chloride solution is 25 wt%, the concentration of the TEOS solution dissolved in cyclohexane is 20 v / v %, and the acidic methanol is 37% HCl:methanol = 1:

10.

4. The method for constructing a CD90-targeted nanodrug delivery system according to claim 2, characterized in that: In step (1), micelles are formed by stirring at 60°C and 50 rpm.

5. The method for constructing a CD90-targeted nanodrug delivery system according to claim 2, characterized in that: In step (2), the binding buffer contains 25 mM 4-hydroxyethylpiperazine ethanesulfonic acid, 5.4 mM KCl, 2.8 mM CaCl2, 3.2 mM MgCl2, and 144 mM NaCl.

6. The method for constructing a CD90-targeted nanodrug delivery system according to claim 2, characterized in that: In step (3), the ammonia concentration in the anhydrous ethanol containing ammonia is 28–30%.

7. The method for constructing a CD90-targeted nanodrug delivery system according to claim 2, characterized in that: In step (3), the reaction temperature is 25°C and the reaction time is 24 hours.

8. The method for constructing a CD90-targeted nanodrug delivery system according to claim 2, characterized in that: In step (4), the mixture is stirred at 25°C for 24 hours to covalently link PEG to the MSN surface via the NHS-amino reaction.

9. The method for constructing a CD90-targeted nanodrug delivery system according to claim 2, characterized in that: In step (6), the reaction temperature is 37°C and the reaction time is 24 hours.

10. The use of the CD90-targeting nanomedicine delivery system of claim 1 in the preparation of a drug for treating age-related hair loss.

Citation Information

Patent Citations

  • Nanometer carrier loaded with dihydroartemisinin, preparation method and application of nanometer carrier

    CN114028585A

  • Hair follicle targeted delivery system and hair growth and hair loss prevention cosmetic

    CN121081290A