Primer and probe set for detecting sheep abortion-causing bacteria and application of primer and probe set
By designing specific primer and probe sets, multiplex real-time PCR technology has solved the problem of rapid, simple, and sensitive diagnosis of ovine abortion diseases, and has achieved efficient differential diagnosis of brucellosis, abortive salmonellosis, listeriosis and psittacosis, especially accurate identification of mixed infections.
Patent Information
- Application Number
- CN202610072300.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-20
- Publication Date
- 2026-04-10
AI Technical Summary
Existing technologies are insufficient for the rapid, convenient, and sensitive diagnosis of brucellosis, abortive salmonellosis, listeriosis, and psittacosis in sheep abortion diseases, especially when mixed infections are difficult to diagnose. Traditional methods are cumbersome, have long testing cycles, low sensitivity, and poor specificity.
We designed specific primer and probe sets for multiplex quantitative PCR detection, targeting Listeria, Salmonella abortus, Brucella, and Chlamydia psittaci. By using probes labeled with different fluorescent groups, we can achieve rapid identification and diagnosis through a single PCR amplification.
It achieves rapid diagnosis of four types of bacterial abortion in sheep with high sensitivity, high specificity, and simple operation, and is suitable for large-scale clinical testing. It can also distinguish between single and mixed infections.
Smart Images

Figure CN121826192A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biological detection technology, and in particular to a primer and probe set for detecting bacteria that cause abortion in sheep and their applications. Background Technology
[0002] Brucella ( Brucella Bru), Salmonella abortus ( Salmonella Abortus ovis Sal), Listeria monocytogenes ( Listeria monocytogenes Li), Chlamydia psittaci ( Chlamydia psittaci The diseases caused by these four pathogens (Brucella, Chlamydia, Listeria, and Listeria) are all characterized by symptoms such as abortion, stillbirth, and weak lambs in pregnant ewes. Brucella is a Gram-negative cocci without flagella, does not produce spores, and is a slow-growing intracellular parasite. Brucellosis caused by Brucella presents with symptoms including infertility, abortion, retained placenta, and inflammation of the reproductive organs and fetal membranes. It can infect various animals, including sheep, cattle, pigs, and dogs, as well as humans. Chlamydia psittaci is also an intracellular parasitic Gram-negative pathogen with a wide host range, including birds and mammals. Chlamydiosis, caused by Chlamydia psittaci, is an infectious disease characterized by fever, abortion, conjunctivitis, and arthritis, and mainly occurs in goats aged 2 years to adulthood. Listeria is a small, Gram-positive bacillus, most susceptible to lambs and pregnant ewes, exhibiting significant seasonal epidemics. Typical symptoms include meningoencephalitis, septicemia, and abortion in pregnant animals. Salmonella abortifacientis is a short, Gram-negative bacillus with blunt ends. It can cause abortion or stillbirth in ewes during late pregnancy, with a miscarriage and mortality rate of up to 60%. Brucella, Listeria, and Chlamydia are all zoonotic infectious diseases that can cause infection and illness in various animals and humans.
[0003] In recent years, with the continuous expansion of livestock farming, the incidence of brucellosis, abortive salmonellosis, listeriosis, and chlamydia in sheep flocks has been increasing year by year. Since these four diseases are mostly zoonotic and involve multiple animals, they place enormous pressure on livestock farming, food safety, and public health. On the other hand, mixed infections of multiple bacteria are common in sheep reproductive disorders, making diagnosis difficult based solely on clinical symptoms. Traditional diagnostic methods such as bacterial isolation and identification, serological analysis, and immunological analysis suffer from drawbacks such as difficulty in pathogen culture, cumbersome procedures, long testing cycles, low sensitivity, poor specificity, and easy viral shedding, thus failing to meet the requirements for rapid, large-scale clinical testing.
[0004] The fluorescent quantitative PCR technology is based on the conventional PCR, adds a fluorescent group, uses the change of the fluorescent signal to monitor the change of the amplification amount of each cycle product in the PCR amplification reaction in real time, and quantitatively analyzes the initial template through a standard curve. The technology mainly includes the TaqMan probe method and the SYBR Green I dye method. The TaqMan probe method utilizes the 5'-3' exonuclease activity of the Taq enzyme, in the PCR amplification process, the specific probe is combined with the template, the Taq enzyme hydrolyzes the probe, releases the fluorescent signal, and the intensity of the fluorescent signal is proportional to the amount of the amplification product. The method has high specificity and is more suitable for multiplex detection. On the other hand, compared with the ordinary PCR, the method has the advantages of simple operation, short time consumption, high sensitivity, strong specificity and the like, and is more suitable for clinical diagnosis. SUMMARY
[0005] The purpose of the present application is to provide a primer and probe set for detecting abortion-causing bacteria in sheep, which is simple in operation, short in time consumption, high in sensitivity and good in specificity, and suitable for large-scale clinical detection.
[0006] In order to achieve the above-mentioned purpose of the application, the present application provides the following technical solutions. The present application provides a primer and probe set for detecting abortion-causing bacteria in sheep, wherein the primer and probe set are as follows: The sequence of the primer and probe set for detecting Listeria is shown as SEQ ID NO. 1-3; The sequence of the primer and probe set for detecting Salmonella abortus is shown as SEQ ID NO. 4-6; The sequence of the primer and probe set for detecting Brucella is shown as SEQ ID NO. 7-9; The sequence of the primer and probe set for detecting Chlamydia psittaci is shown as SEQ ID NO. 10-12.
[0007] Preferably, the probe for detecting Listeria is labeled with FAM at the 5' end and BHQ2 at the 3' end; the probe for detecting Salmonella abortus is labeled with HEX at the 5' end and BHQ2 at the 3' end; the probe for detecting Brucella is labeled with ROX at the 5' end and BHQ2 at the 3' end; and the probe for detecting Chlamydia psittaci is labeled with CY5 at the 5' end and BHQ2 at the 3' end.
[0008] Preferably, the primer and probe set are for Listeria hlyA gene, Salmonella abortus FimH gene, Brucella BP26 gene and Chlamydia psittaci MOMP gene.
[0009] The application further provides application of the primer and the probe group in preparation of a kit for detecting one or more of the Li's bacillus, the abortion salmonella, the brucella and the psittacosis chlamydia.
[0010] The application further provides a sheep bacterial abortion disease multiplex fluorescent quantitative PCR detection kit containing the primer and the probe group.
[0011] Preferably, the upstream primer and the downstream primer in the kit are respectively used in an amount of 0.5-1 μL, and the probe is used in an amount of 0.25-0.5 μL.
[0012] Beneficial effects
[0013] The primer, the probe group and the kit for detecting the bacteria causing abortion of sheep provided by the application have the characteristics of high sensitivity, strong specificity, simple operation and short time consumption, and can be used for detecting the four pathogenic bacteria respectively, and can realize rapid differential diagnosis of four kinds of sheep bacterial abortion diseases through one PCR amplification, and has important advantages in the field of clinical sheep disease diagnosis and identification. BRIEF DESCRIPTION OF DRAWINGS
[0014] Figure 1 Table 4 is the fluorescent quantitative PCR amplification results of the four pathogenic bacteria under the optimal reaction system in Example 1; Figure 2 Table 5 is the sensitivity detection results of the four pathogenic bacteria in Example 1; Figure 3 Table 6 is the specificity detection results of the four pathogenic bacteria in Example 1; Figure 4 Table 7 is the repeatability detection results of the four pathogenic bacteria in Example 1; Figure 5 Table 8 is the fluorescent quantitative PCR amplification results of the four pathogenic bacteria by the non-optimal primer and the probe in Comparative Example 1. DETAILED DESCRIPTION
[0015] The technical solutions provided by the application will be described in detail below with reference to the examples, but they should not be understood as limiting the protection scope of the application.
[0016] 1. The primer and the probe sequence used in the application are respectively derived from the Li's bacillus, the abortion salmonella, the brucella and the psittacosis chlamydia related genes published in the Gene bank, and the specific primer and probe sequence is shown in Table 1.
[0017] Table 1 Primer and probe sequence
[0018] 2. Main reagents
[0019] The bacterial genome extraction kit was from Beijing Tengen Bioengineering Co., Ltd.; 2x Premix (Probe) was purchased from Hunan Aikuer Biological Engineering Co., Ltd.; primers, probes and standard plasmids were synthesized by Universal Biological (Anhui) Co., Ltd.
[0020] Example 1
[0021] I. Multiplex fluorescent quantitative PCR reaction conditions
[0022] 1. Annealing temperature of primers and probes
[0023] The annealing temperature of the multiplex fluorescent quantitative PCR of Li's bacillus, abortion salmonella, brucella and psittacosis chlamydia is preferably 58℃.
[0024] 2. Concentration of primers and probes
[0025] Four pairs of primers and probes were diluted respectively, and the final concentration was 10 μM.
[0026] 3. Reaction system
[0027] The reaction system is preferably 20 μL, wherein the addition amount of upstream and downstream primers is 0.5 μL respectively, the addition amount of probe is 0.25 μL, 2x Premix (Probe) is 10 μL, DNA is 2 μL, and DEPC water is added to 20 μL.
[0028] According to the above optimal reaction system, the multiplex fluorescent quantitative PCR was carried out, and the reaction program was as follows: 95℃ for 3 min, 95℃ for 5 s, 58℃ for 30 s, 45 cycles (fluorescence signal collection at annealing temperature of each cycle), and 4℃ preservation. Under this reaction system and reaction program, the CT values of four pathogens of Li's bacillus, abortion salmonella, brucella and psittacosis chlamydia were 15.92, 17.68, 15.22 and 17.43 respectively. The results are shown in Figure 1 .
[0029] II. Sensitivity detection of multiplex fluorescent quantitative PCR detection method
[0030] The concentrations of the synthesized plasmids of Li's bacillus, abortion salmonella, brucella and psittacosis chlamydia were adjusted to 22.3x10 6 copies / μL, 8.1x10 7 copies / μL, 6.8x10 7 copies / μL and 12.8x10 6copies / μL. The above plasmids were diluted by ten times respectively, and the detection was carried out according to the reaction condition of step one, and the minimum nucleic acid copy number of the four kinds of bacteria which can be detected by the detection method was determined according to the Ct value, that is, the sensitivity of the detection method. The results are shown in Table 1. Figure 2
[0031] The results show that the minimum nucleic acid concentration which can be detected by the multiple fluorescence quantitative PCR detection method of Listeria, Salmonella abortus, Brucella and Chlamydia psittaci established by the application is as follows: the minimum nucleic acid concentration of Listeria is 2.2 copies / μL, the minimum nucleic acid concentration of Salmonella is 8.1 copies / μL, the minimum nucleic acid concentration of Brucella is 6.8 copies / μL, and the minimum nucleic acid concentration of Chlamydia psittaci is 1.3 copies / μL.
[0032] III. Specific detection of the multiple fluorescence quantitative PCR detection method
[0033] According to the reaction condition of step one, the specific detection was carried out, and the determination results are shown in Table 2. Figure 3 (1) Li's bacillus primer probe group has no Ct value for Pasteurella multocida (Pas), Escherichia coli (coli), psittacosis chlamydia, Brucella, abortion salmonella and negative control, and has no typical "S" amplification curve, and the Ct value for abortion salmonella plasmid is 13.50, and a typical "S" type amplification curve appears. (2) The primer probe group of abortion salmonella has no Ct value for Pasteurella multocida (Pas), Escherichia coli (coli), psittacosis chlamydia, Brucella, Li's bacillus and negative control, and has no typical "S" type amplification curve, and the Ct value for abortion salmonella plasmid is 14.96, and a typical "S" type amplification curve appears. (3) The primer probe group of Brucella has no Ct value for Pasteurella multocida (Pas), Escherichia coli (coli), psittacosis chlamydia, abortion salmonella, Li's bacillus and negative control, and has no typical "S" amplification curve, and the Ct value for Brucella plasmid is 14.13, and a typical "S" type amplification curve appears. (4) The primer probe group of psittacosis chlamydia has no Ct value for Pasteurella multocida (Pas), Escherichia coli (coli), abortion salmonella, Brucella, Li's bacillus and negative control, and has no typical "S" amplification curve, and the Ct value for psittacosis chlamydia plasmid is 13.58, and a typical "S" type amplification curve appears. The above results show that the multiple fluorescence quantitative PCR for abortion salmonella, psittacosis chlamydia, Brucella and Li's bacillus established in the application has good specificity.
[0034] Four, repeatability detection of the multiple fluorescence quantitative PCR detection method
[0035] According to the reaction conditions of step one, the standard plasmid mixture of Li's bacillus, abortion salmonella, Brucella, psittacosis chlamydia is detected three times repeatedly, and the Ct values of three PCR detections of each disease are compared, and the coefficient of variation is calculated according to the coefficient of variation formula (CV%=(standard deviation SD / average value Mean) x 100%). The results are shown in Table 2 and Figure 4 .
[0036] Table 2 Repeatability detection results of the multiple fluorescence quantitative PCR detection method
[0037] The results showed that the standard deviation of Ct value of three repeated detections was between 0.24 and 0.43, and the coefficient of variation was between 1.41 and 2.65%, both less than 3.00%, indicating that the multiplex PCR detection method established had good repeatability and stability, and could meet the detection needs.
[0038] Example 2 Multiplex fluorescent quantitative PCR detection kit
[0039] The kit includes fluorescent quantitative PCR amplification reagents, negative control and positive control.
[0040] 1. Multiplex fluorescent quantitative PCR reaction system
[0041] The reaction system is 20 μL, including 2× Premix (Probe) 10 μL, upstream and downstream primers 0.5 μL each, probe 0.25 μL, DNA 2 μL, and DEPC water to 20 μL. When the multiplex fluorescent quantitative PCR is used for detection, negative control and positive control are added at the same time, and 0.4 μL of positive control template is added.
[0042] 2. Multiplex fluorescent quantitative PCR reaction program
[0043] 95 ℃ 3 min, 95 ℃ 5 s, 58 ℃ 30 s, 45 cycles (fluorescence signal collection at each cycle annealing temperature), 4 ℃ storage.
[0044] 3. Multiplex fluorescent quantitative PCR result judgment
[0045] According to the threshold setting principle of fluorescent quantitative PCR, adjust the instrument, and the specific operation should be that the threshold line just exceeds the highest point of the negative control amplification curve; the negative control should have no Ct value and no typical "S" type amplification curve; the Ct value of the positive control should be between 10 and 20, and a typical "S" type amplification curve appears; if the above conditions are met, the experiment is valid. If the sample has no Ct value and no typical "S" type amplification curve, it is determined to be negative; if the sample has a Ct value ≤40 and a typical "S" type amplification curve, it is determined to be positive; if the sample has a Ct >40 and a typical "S" type amplification curve, it is determined to be suspicious and should be rechecked; other conditions are determined to be negative.
[0046] 4. Negative and positive control
[0047] The negative control is DEPC water. The positive control is prepared by designing and synthesizing recombinant plasmids of corresponding fragments according to the sequences of the related genes of Listeria, Salmonella abortus, Brucella and Chlamydia psittaci published in Gene bank (see Table 1), and then diluting and mixing the four bacterial plasmids to obtain a final concentration of 5 ng / μL.
[0048] 5. Detection of clinical samples
[0049] Thirty-five samples of abortive products such as fetal membranes and amniotic fluid stored at -40℃ in the laboratory were randomly selected and detected by using the above-mentioned kits, and the positive and negative controls were added. The results showed that the positive samples of Bru were 7 (the positive rate was 20%); the positive samples of Chl were 3 (the positive rate was 8.6%); the positive samples of Sal were 4 (the positive rate was 11.4%); the positive samples of Li were 3 (the positive rate was 8.6%); and one case of mixed infection of Bru and Sal. The PCR products were sent to General Biosystems (Anhui) Co., Ltd. for sequencing analysis and Blast sequence comparison. The results showed that the detection results of multiplex fluorescent quantitative PCR were consistent with the results of Blast sequence comparison, and the coincidence rate was 100%.
[0050] Comparative Example 1
[0051] The primers and probes in the system used in the application were replaced by the following non-optimal primers and probes, respectively, and the CT values of each disease after replacing the primers and probes were tested, and the reaction conditions and reaction procedures were unchanged. The results showed that under the condition of unreasonable primer and probe design, the CT values of Listeria, Salmonella abortus, Brucella and Chlamydia psittaci fluorescent quantitative PCR amplification were 28.32, 27.83, 21.90 and 30.75, respectively, which were significantly higher than the results of step one in Example 1, indicating that the sensitivity of the primers and probes was significantly lower than that of the optimal primer sequence. Figure 5 ).
[0052] The sequences of the non-optimal primers and probes are as follows: The sequences of the primers and probes for detecting Listeria are as follows: Li-F2 / SEQ ID NO. 13: 5' AGACCTTCCAGATTTTTCGGCAA 3'; Li-R2 / SEQ ID NO. 14: 5' TTCCCACTTACGGCAGCATCAA 3'; Li-P2 / SEQ ID NO. 15: 5' GCCGTATGCCACACTTGAGAT 3'; The detection primer and probe sequence for Salmonella abortus are: Sal-F2 / SEQ ID NO. 16: 5' GAGCATCACCGATAGTGTCGC 3'; Sal-R2 / SEQ ID NO. 17: 5' AAACGGCTTTTGCTGCGAC 3'; Sal-P2 / SEQ ID NO. 18: 5' GTTACGGGGCGGATAAAATACG 3'; The detection primer and probe sequence for Brucella are: Bru-F2 / SEQ ID NO. 19: 5' CTATCCTGACGACAAGAACAACCTG 3'; Bru-R2 / SEQ ID NO. 20: 5' ACACCGAGCGTGACGGATTC 3'; Bru-P2 / SEQ ID NO. 21: 5' GAGACTGGTGGATACAGAATAGCCG 3'; The detection primer and probe sequence for Chlamydia psittaci are: Chl-F2 / SEQ ID NO. 22: 5' CAACTCCTACGCAGGCTACAG 3'; Chl-R2 / SEQ ID NO. 23: 5' GATGTTCGGTCTGCCATTTGCTT 3'; Chl-P2 / SEQ ID NO. 24: 5' GGCTGATTAGTATTACTTGCGTT 3'.
[0053] The above only is the preferred embodiment of the present application, it should be noted that, for those skilled in the art, without departing from the principles of the present application, can make a number of improvements and refinements, these improvements and refinements should also be considered as the protection scope of the present application.
Claims
1. A primer and probe set for detecting bacteria that cause abortion in sheep, characterized in that, The primer and probe set is as follows: The sequences of primers and probes for Listeria detection are shown in SEQ ID NO. 1~3; The sequences of primers and probes for detecting Salmonella in abortion are shown in SEQ ID NO.4~6; The sequences of primers and probes for Brucella detection are shown in SEQ ID NO.7~9; The sequences of primers and probes for the detection of Chlamydia psittaci are shown in SEQ ID NO.10~12.
2. The primer and probe set as described in claim 1, characterized in that, The probe for detecting Listeria monocytogenes is labeled with FAM at the 5' end and BHQ2 at the 3' end; the probe for detecting Salmonella abortus is labeled with HEX at the 5' end and BHQ2 at the 3' end; the probe for detecting Brucella monocytogenes is labeled with ROX at the 5' end and BHQ2 at the 3' end; and the probe for detecting Chlamydia psittaci is labeled with CY5 at the 5' end and BHQ2 at the 3' end.
3. The primer and probe set as described in claim 1, characterized in that, The primer and probe set targets the Listeria monocytogenes hlyA gene, Salmonella abortus FimH gene, Brucella BP26 gene, and Chlamydia psittaci MOMP gene.
4. The use of the primer and probe set according to any one of claims 1 to 3 in the preparation of a kit for detecting one or more of Listeria, Salmonella abortus, Brucella and Chlamydia psittaci.
5. A multiplex real-time PCR detection kit for ovine bacterial abortion disease, characterized in that, It contains the primer and probe set as described in any one of claims 1 to 3.
6. The detection kit as described in claim 5, characterized in that, The amounts of upstream and downstream primers used were 0.5–1 μL, and the amount of probe used was 0.25–0.5 μL.