Method for enhancing synthesis of myo-inositol as well as engineering bacteria and application thereof
By constructing an enhanced myo-inositol synthesis pathway in Escherichia coli using gene editing technology, the problems of low synthesis efficiency and carbon flow imbalance in existing technologies have been solved, achieving efficient and stable myo-inositol production.
Patent Information
- Application Number
- CN202610094461.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-23
- Publication Date
- 2026-04-14
AI Technical Summary
The existing technologies have not effectively solved problems such as low synthesis efficiency of myo-inositol, long fermentation cycle, imbalance of carbon flow distribution, accumulation of by-products and inhibition of carbon metabolism.
Gene knockout and overexpression were performed on the E. coli genome using gene editing technology to construct an enhanced myo-inositol synthesis pathway. This included suppressing the expression of lactose operon repressor protein, glucose-1-phosphate dehydrogenase, acetate kinase, glucose-1-phosphate isomerase, and glycerol repressor protein, while overexpressing inositol-1-phosphate synthase, inositol monophosphatase, glucokinase, glucose permease, and glycerol kinase, thereby optimizing the metabolic pathways of glucose and glycerol.
It significantly increased the yield of myo-inositol to 56.48 g/L, improving the synthesis efficiency by 99.7%, relieving carbon metabolism inhibition, reducing byproduct accumulation, and achieving efficient and stable myo-inositol production.
Smart Images

Figure CN121852304A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of metabolic engineering and discloses a genetically engineered bacterium for producing myo-inositol, its construction method, and its application. Background Technology
[0002] Myo-inositol is a stable white crystalline powder, odorless at room temperature, readily soluble in water, and highly hygroscopic. It has a melting point of 225℃-227℃, a relative density of 1.75 g / cm³ (15ºC), and the molecular formula C6H₂O. 12 O6 has a relative molecular mass of 180.16. Myo-inositol has a structure similar to glucose and has nine isomers. Four of these (D-(+)-chiro, L-(-)-chiro, Scyllo, and myo-inositol) are naturally occurring, while the remaining five require artificial synthesis. Among them, myo-inositol (MI) is the most widely distributed, present in almost all organisms, and is the most extensively studied isomer. Current research indicates that myo-inositol has significant applications in various fields, including food, medicine, chemicals, and animal feed.
[0003] Currently, the main methods for synthesizing myo-inositol include microbial fermentation and in vitro enzymatic catalysis. Microbial fermentation is green and sustainable, and by genetically engineering strains to enhance metabolic pathways, it is an important direction for future industrial production. In vitro enzymatic catalysis is a highly efficient method for converting sugars using multi-enzyme systems, with a yield of up to 98.9%, but breakthroughs are still needed in enzyme stability and purification technology. Hansen et al. (Hansen CA, Dean AB, Draths KM, et al. Synthesis of 1,2,3,4-tetrahydroxybenzene from d-glucose: exploiting myo-inositol as a precursor toaromatic chemicals[J]. Journal of the American Chemical Society, 1999, 121(15): 3799-3800) were the first to synthesize myo-inositol using Saccharomyces cerevisiae. INO1 Introduce E. coli and bind to endogenous bacteria. suhBGene expression was used to construct the inositol synthesis pathway, and fed-batch fermentation yielded 21 g / L. Tang et al. (Tang E, Shen X, Wang J, et al. Synergetic utilization of glucose and glycerol for efficient myo-inositol biosynthesis[J]. Biotechnology and Bioengineering, 2020, 117(4): 1247-1252) introduced Saccharomyces cerevisiae to achieve this. INO1 Strategies such as optimizing the combination of IPS and IMP enzymes were employed, and ultimately, after 96 hours of fermentation in a 3 L fermenter, the myo-inositol yield reached 76.00 g / L. However, the engineered strain exhibited drawbacks including low synthesis efficiency, long fermentation cycle, unbalanced carbon flow distribution, byproduct accumulation, and inhibition of carbon metabolism. Summary of the Invention
[0004] To address the aforementioned deficiencies, this invention provides an engineered bacterium that enhances the myo-inositol synthesis pathway and glycerol metabolism, along with its construction method and applications.
[0005] To achieve the above objectives, the present invention provides the following technical solution: In a first aspect, the present invention provides a genetically engineered bacterium for producing myo-inositol, wherein the genetically engineered bacterium is obtained by performing the following gene editing on its genome, using Escherichia coli as the starting strain: the genetically engineered bacterium does not express lactose operon repressor protein, glucose-1-phosphate dehydrogenase, acetate kinase, glucose-1-phosphate isomerase, or glycerol repressor protein; and overexpresses inositol-1-phosphate synthase, inositol monophosphatase, glucokinase, glucose permease, or glycerol kinase. The term "not expressed" means that the expression level of the protein is significantly lower than the original level, for example, significantly reduced by at least 50%, 60%, 70%, 80%, 90%, or 100%. Gene editing on the genome of the starting strain to prevent the expression of the protein can be achieved by conventional means in the art, including but not limited to gene knockout, gene knock-in, point mutation, deletion mutation, and combinations thereof. "Overexpression" refers to a protein expression level significantly higher than the original level. This overexpression is achieved through gene editing in the starting strain using conventional methods in the art. These methods include replacing the promoter of the corresponding gene in the genome of the starting strain with a strong promoter, inserting the corresponding gene into the genome to increase the gene copy number, overexpressing the target protein in the starting strain using plasmids, or combinations thereof. When selecting a promoter, a reasonable choice can be made based on the specific expression level requirements and the characteristics of the target gene; for example, replacing the promoter with P... trc wait; Furthermore, the originating strain is Escherichia coli W3110; Furthermore, the NCBI-Protein IDs of the lactose operon repressor protein are: BAE76127; BAA15660; BAA16135; BAE78027; and BAE77869. Furthermore, the encoding genes for inositol-1-phosphate synthase and inositol monophosphatase are derived from the inositol-1-phosphate synthase encoding gene of Corynebacterium glutamicum ATCC 13032. cg3323 Inositol monophosphatase encoding gene suhB ; More preferably, the coding genes for inositol-1-phosphate synthase, inositol monophosphatase, glucokinase, and glucose permease are P trc Promoter control expression; More preferably, the overexpression of inositol-1-phosphate synthase, inositol monophosphatase, glucokinase, glucose permease and glycerol kinase is performed by integrating the encoding genes of the corresponding enzymes (either the original enzyme or a different enzyme) into the genome of the starting strain. Preferably, the amino acid sequence of the inositol-1-phosphate synthase is shown in SEQ ID NO.1; Preferably, the amino acid sequence of the inositol monophosphatase is as shown in SEQ ID NO.2; Preferably, the amino acid sequence of the glucokinase is shown in SEQ ID NO.3; Preferably, the amino acid sequence of the glucose permease is shown in SEQ ID NO.4; Preferably, the amino acid sequence of the glycerol kinase is shown in SEQ ID NO.5.
[0006] Secondly, the present invention also provides a method for constructing a genetically engineered bacterium for producing myo-inositol, comprising the following steps: using Escherichia coli W3110 as the starting strain, integrating the coding genes for inositol-1-phosphate synthase, inositol monophosphatase, glucokinase, glucose permease, and glycerol kinase into its genome; knocking out the coding genes for lactose operon repressor protein, phosphogluconate isomerase, phosphogluconate dehydrogenase, and the coding genes for repressor protein and acetate kinase in the glycerol metabolic pathway; Furthermore, through P trc The promoter regulates the expression of genes encoding inositol-1-phosphate synthase, inositol monophosphatase, glucokinase, and glucose permease. Furthermore, when integrating the above genes, the gene insertion site can be rationally selected based on specific operational requirements and the characteristics of the target gene, taking into account factors such as PAM sequence, genomic environment, functional requirements, and off-target risks. Preferably, the insertion site of the gene encoding inositol-1-phosphate synthase is... yfhQ ; Preferably, the insertion site of the gene encoding inositol monophosphatase is... yfhQ ; Preferably, the glucokinase coding gene insertion site is: ycgH ; Preferably, the insertion site of the gene encoding the glucose permease is... rph ; Preferably, the insertion site of the coding gene for the glycerol kinase mutant is: glpR ; Preferably, the gene editing technology for knockout, integration, and replacement is CRISPR-Cas9 gene editing technology.
[0007] This invention utilizes gene editing technology to overexpress and knock out target genes in a starting bacterial strain, thereby constructing a genetically engineered bacterium that produces high levels of myo-inositol. During this process, the specific order of gene editing can be flexibly adjusted according to experimental needs; different editing sequences can all achieve the expected genetic engineering goals without affecting the performance of the final genetically engineered bacterium or the yield of myo-inositol.
[0008] Specifically, a method for constructing a genetically engineered bacterium that produces myo-inositol is provided, comprising the following steps: (1) Using the genome of Escherichia coli W3110 as a template, the gene encoding the lactose operon repressor protein was amplified. lacI The upstream and downstream homologous arms will lacI The upstream and downstream homologous arms are fused to obtain lacI Overlapping segment U of upstream and downstream homologous arms lacI -D lacI ;Change U lacI -D lacI and containing lacI The vector containing -gRNA was transformed into the starting strain *Escherichia coli* W3110 to obtain... lacI Knockout strains E.coli W3110 lacI ; The " lacI "-gRNA" indicates that, according to lacIThe RNA molecule designed and synthesized to guide the Cas9 nuclease to recognize the target DNA sequence can be a combination of natural crRNA and tracrRNA, or an engineered single-guide RNA (sgRNA); the description of gRNA for other genes follows the same principle. Furthermore, the vector is a pGRB plasmid.
[0009] (2) Using the genome of Escherichia coli W3110 as a template, the gene was amplified. yfhQ The upstream and downstream homologous arms were obtained; the encoding gene of inositol-1-phosphate synthase was obtained by PCR amplification using the genome of Corynebacterium glutamicum 13032 as a template. cg3323 and the gene encoding inositol monophosphatase suhB GC Fragment; will yfhQ upstream homologous arm, downstream homologous arm and cg3323 , suhB GC Gene fragment fusion is performed to obtain a fused fragment. The obtained fused fragment is then combined with a gene fragment containing... yfhQ -gRNA vector conversion into E. coli W3110 lacI The strain obtained had its genes knocked out. yfhQ And in yfhQ Site-integrated inositol-1-phosphate synthase and inositol monophosphatase strains; (3) Using the strains obtained in the previous round as the basis for construction, and repeating the same method as in step (2), construct the strains sequentially. ycgH Site-integrated glucokinase encoding gene glk ,exist rph Site-integrated glucose via enzyme-encoded gene glf ZM ,exist glpR The coding gene of site-integrated glycerol kinase mutant glpK G913A strains; (4) Using CRISPR-Cas9 gene editing technology, to glk, glf ZM Replace the gene promoter with P trc promoter; (5) Based on the strain obtained in step (4), knock out the gene encoding phosphoglucose isomerase. pgi phosphate glucose dehydrogenase encoding gene zwf, Acetylkinase encoding gene ackA Strains with the above genes knocked out were obtained.
[0010] Thirdly, the present invention also provides the application of the genetically engineered bacteria described in one of the technical solutions in the production of myo-inositol; Furthermore, it is a method for fermenting to produce myo-inositol, using the above-mentioned genetically engineered bacteria or genetically engineered bacteria obtained according to the above construction method to ferment with glucose and glycerol as substrates; Furthermore, the method includes the following steps: (1) The recombinant Escherichia coli was inoculated into a seed culture medium and seed culture was carried out to obtain a seed culture; (2) Inoculate the seed culture obtained in step (1) onto the fermentation medium at an inoculum rate of 10%-20%, with a fermentation temperature of 35-37℃ and an aeration rate of 2-4 m³ / h. 3 At a stirring speed of 300-900 rpm and dissolved oxygen maintained at 10-40%, glucose and glycerol solutions were added to carry out aerobic fermentation to obtain a fermentation broth containing myo-inositol. The seed culture medium consists of: 15-30 g / L glycerol, 2-5 g / L yeast extract, 1-5 g / L peptone, 1.5-3 g / L KH2PO4, 5-15 mg / L FeSO4·7H2O, 10-12 mg / L MnSO4, with the remainder being water; the pH is 7.0-7.2. The fermentation medium consists of: 10-20 g / L glucose, 2-6 g / L yeast extract, 1-5 g / L peptone, 10-30 g / L glycerol, 1-3 g / L KH2PO4, 0.5-2 g / L MgSO4·7H2O, 5-15 mg / L FeSO4·7H2O, 5-15 mg / L MnSO4, with the remainder being water; the pH is 6.8-7.2.
[0011] Using the genetically engineered bacteria for producing myo-inositol and the fermentation method for producing myo-inositol provided by this invention, the myo-inositol yield reached 52.6-58.4 g / L after 48 h of fermentation in a 5 L fermenter. More preferably, in step (1), the recombinant Escherichia coli is inoculated into a fermenter containing seed culture medium for seed culture, the pH of the fermentation broth is adjusted to 6.8-7.2, dissolved oxygen is maintained at 15-20%, and the ventilation rate is 2-4 m³ / h. 3 The seed culture was obtained by stirring at 200-800 rpm for 6-10 h at 30-35℃.
[0012] More preferably, in step (2), the seed culture obtained in step (1) is inoculated into a fermenter containing fermentation medium at an inoculation rate of 10-20%, the fermentation temperature is 35-37℃, and the ventilation rate is 2-4 m³ / h. 3The stirring speed was 300-900 rpm, the dissolved oxygen was maintained at 10-30%, and 60% glucose solution and 60% glycerol were added separately, maintaining the glucose and glycerol concentrations at 0.1%-0.5%. 25% NaOH was added to adjust the pH of the fermentation broth to 6.8-7.2, and the fermentation cycle was 48 h.
[0013] Beneficial effects: The genetically engineered bacteria provided by this invention contain inositol-1-phosphate synthase and inositol monophosphatase, respectively derived from... Corynebacterium glutamicum ATCC strain 13032 cg3323 Genes and suhB The gene, compared to the gene encoding inositol phosphate synthase from Saccharomyces cerevisiae cited in the literature. INO1 With inositol monophosphatase in Escherichia coli suhB The production of myo-inositol increased by 99.7%; a non-phosphotransferase-dependent glucose uptake system and a glucokinase encoding gene were introduced. glf ZM and glk It can effectively promote myo-inositol synthesis, with a yield of 4.72 g / L, an increase of 27.2%; at the same time, knocking out key genes pgi and zwf By blocking the flow of glucose-6-phosphate to the EMP and HMP pathways, myo-inositol production reached 7.61 g / L, an increase of 61.2%; using a glycerol kinase mutant glpK G913A and knocking out genes encoding repressor proteins in the glycerol metabolic pathway glpR This process relieved carbon metabolism inhibition, allowing more intracellular glycerol to be used for bacterial growth and myo-inositol synthesis, increasing glycerol utilization by 41% and myo-inositol yield to 13.84 g / L, an increase of 81.9%; the gene encoding acetate kinase was knocked out. ackA To reduce the accumulation of byproducts, the myo-inositol yield reached 14.04 g / L, an increase of 1.4%. Finally, after culturing in a 5 L fermenter for 48 h, the myo-inositol yield reached 56.48 g / L.
[0014] Furthermore, no byproducts were detected during the entire fermentation process, indicating that its metabolic pathway is highly specific and can efficiently convert glucose into myo-inositol.
[0015] Meanwhile, this strain does not carry plasmids, avoiding the risks of plasmid loss or instability, ensuring the stability and reliability of the strain during long-term fermentation. Furthermore, this strain is non-auxotrophic and can stably grow and produce myo-inositol without the addition of inducers.
[0016] Compared with existing technologies, the genetically engineered bacteria of the present invention exhibit significant advantages in terms of key enzyme expression rate, metabolic specificity, and fermentation cycle, providing an efficient, stable, and economically feasible solution for the industrial production of myo-inositol. Attached Figure Description
[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. The drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0018] Figure 1 This is a schematic diagram of the myo-inositol biosynthesis pathway in Escherichia coli and the genetic engineering modification involved in this invention.
[0019] Figure 2 The image shows the high-performance liquid chromatogram of the fermentation broth of strain W-7. Detailed Implementation
[0020] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the protection scope of the present invention.
[0021] This invention provides a genetically engineered bacterium for producing myo-inositol. The genetically engineered bacterium is obtained by editing the genome of Escherichia coli using the following gene editing: the genetically engineered bacterium does not express lactose operon repressor protein, glucose-1-phosphate dehydrogenase, acetate kinase, glucose-1-phosphate isomerase, or glycerol repressor protein; and overexpresses inositol-1-phosphate synthase, inositol monophosphatase, glucokinase, glucose permease, and glycerol kinase.
[0022] In this invention, "non-expression" means that the expression level of the protein is significantly lower than the original level, for example, significantly reduced by at least 50%, 60%, 70%, 80%, 90%, or 100%. The method of gene editing on the genome of the starting strain to prevent the protein from being expressed can be achieved by conventional means in the art, including but not limited to gene knockout, gene knock-in, point mutation, deletion mutation, and combinations thereof.
[0023] In this invention, "overexpression" refers to a protein expression level significantly higher than the original level. This overexpression is achieved through gene editing on the genome of the starting strain, using methods conventional in the art. This can be achieved by replacing the promoter of the corresponding gene on the genome of the starting strain with a strong promoter, by inserting the corresponding gene into the genome to increase the gene copy number, or a combination thereof. When selecting a promoter, a reasonable choice can be made based on the specific expression level requirements and the characteristics of the target gene.
[0024] This invention is based on E. coli Using strain W3110 as the starting strain, genetic modifications to enhance myo-inositol fermentation production primarily focused on constructing a myo-inositol synthesis pathway, enhancing glucose transport, re-editing the EMP and HMP pathways to improve glucose-6-phosphate supply, and decoupling growth and myo-inositol synthesis. Specifically, by overexpressing the encoding genes for inositol-1-phosphate synthase and inositol monophosphatase from Corynebacterium glutamicum 13032, a myo-inositol synthesis pathway in Escherichia coli was constructed, enabling E. coli to accumulate myo-inositol. A non-phosphotransferase-dependent glucose permease from Pseudomonas motilityis was introduced, along with overexpression of the encoding gene for endogenous glucokinase, to enhance glucose uptake and supply. By knocking out the genes encoding glucose-6-phosphate isomerase and glucose-6-phosphate dehydrogenase, the flow of glucose-6-phosphate to other pathways is blocked, increasing the accumulation of myo-inositol precursor glucose-6-phosphate; by knocking out the gene encoding glycerol repressor protein and overexpressing the gene encoding glycerol kinase mutant, carbon metabolism inhibition is alleviated, thereby enhancing glycerol uptake and metabolism; and by knocking out acetate kinase, acetate accumulation is reduced.
[0025] This invention, through the aforementioned gene editing, successfully constructed a genetically engineered *Escherichia coli* strain that produces myo-inositol. Experimental results showed that this strain significantly increased the myo-inositol yield. After 48 hours of fermentation in a 5 L fermenter, the myo-inositol yield reached 56.48 g / L, and no other byproducts were detected during the fermentation process.
[0026] Specifically, the present invention utilizes a coding gene from Corynebacterium glutamicum 13032. cg3323 and suhB GC The genes were integrated into the *E. coli* genome. Compared to the previously lacking efficient myo-inositol synthesis pathway in *E. coli*, the two introduced key enzymes for myo-inositol synthesis efficiently catalyze the conversion of glucose-6-phosphate to inositol-1-phosphate, and subsequently to myo-inositol. The myo-inositol production is significantly higher than that of endogenous inositol monophosphatase in *E. coli* reported in previous literature. suhB and inositol phosphate synthase introduced from brewer's yeast INO1It increased by 99.7%.
[0027] The genetically engineered bacteria in this invention enhance the non-phosphotransferase-dependent glucose transport pathway by introducing a glucose permease-encoding gene from *Morhizopus motiles*. glf ZM Genes accelerate substrate uptake while overexpressing the gene encoding endogenous glucokinase. glk Enhanced glucokinase phosphorylation of glucose, ultimately through the use of trc Promoter enhancement glf ZM and glk The expression of [something] balances glucose uptake and metabolic burden.
[0028] In this invention, the genetically engineered bacteria, in order to enhance the supply of glucose-6-phosphate, a precursor for myo-inositol synthesis, knock out the enzyme encoding glucose-6-phosphate dehydrogenase. zwf Genes that block the glucose-6-phosphate to pentose phosphate pathway; knockout of genes encoding glucose-6-phosphate isomerase. pgi The gene blocks the flow of glucose-6-phosphate to the glycolysis pathway, directing it to the myo-inositol synthesis pathway and increasing myo-inositol accumulation. Simultaneously, the genetically engineered bacteria in this invention utilize glucose and glycerol as dual carbon sources, targeting the gene encoding the repressor protein in the glycerol metabolism pathway. glpR Knockout removes the inhibition of glycerol metabolism, allowing glycerol to be utilized more efficiently for cell growth or energy supply, while glucose is converted more towards glucose-6-phosphate, ultimately producing myo-inositol. Furthermore, according to relevant literature, when the base at site 913 is mutated from the original base G to the mutated base A (denoted as...),... glpK G913A The strain significantly improves glycerol utilization; therefore, this invention utilizes a glycerol kinase mutant to achieve, under the same fermentation conditions, use a strain containing... glpK G913A Fermentation of mutant E. coli showed a higher myo-inositol production compared to the wild type. glpK This improved the level by 16.7%. Finally, the genetically engineered bacteria in this invention knocked out acetate kinase. ackA This reduces the accumulation of acetic acid.
[0029] Inositol-1-phosphate synthase converts glucose-6-phosphate to myo-inositol-1-phosphate and is a key enzyme in the synthesis of myo-inositol in Escherichia coli. The encoding gene for inositol-1-phosphate synthase can be the inositol-1-phosphate synthase encoding gene from Corynebacterium glutamicum 13032. cg3323 .
[0030] Inositol monophosphatase is a key enzyme that catalyzes the conversion of myo-inositol-1-phosphate to myo-inositol. The encoding gene for this inositol monophosphatase can be the inositol monophosphatase encoding gene from Corynebacterium glutamicum 13032. suhB GC .
[0031] Glucokinase phosphorylates glucose to glucose-6-phosphate, generating a precursor for the synthesis of myo-inositol. The glucokinase encoding gene can be derived from the glucokinase encoding gene of *Escherichia coli* W3110. glk .
[0032] Glucose permeases can enhance non-phosphotransferase-dependent glucose transport pathways, thereby strengthening glucose uptake and supply. The gene encoding the glucose permease can be derived from a glucose permease-encoding gene of *Pseudomonas motiles*. glf ZM .
[0033] Glyceryl kinase catalyzes the phosphorylation of glycerol to glycerol 3-phosphate, which then enters the TCA cycle to maintain cell growth. The encoding gene of the glycerol kinase mutant can be derived from the glycerol kinase mutant gene of *E. coli* W3110. glpK G913A .
[0034] The Escherichia coli W3110, Corynebacterium glutamicum ATCC 13032, and Pseudomonas motility-fermenting bacteria used in the embodiments of this invention were all obtained from the Metabolic Engineering Laboratory of Tianjin University of Science and Technology.
[0035] The recombinant reagent kit, ClonExpress II One Step Cloning Kit, was purchased from Nanjing Novizan Medical Technology Co., Ltd. All test materials used in this invention are commercially available and readily available in the market.
[0036] The detection method for myo-inositol and organic acids in this invention: (1) Processing the test solution: Take 1 mL of fermentation broth, centrifuge at 13000 rpm for 3 min, take the supernatant and pass it through a 0.22 μm organic membrane for later use, and store it in a -4°C refrigerator.
[0037] (2) High performance liquid chromatography (HPLC) detection: The chromatographic column was a Bio-Rad Aminex HPX-87H column (300 mm × 7.8 mm, L × ID), and the temperature was 35℃; the UV detection wavelength was 215 nm. The mobile phase was 0.005 mol / L H2SO4, and the flow rate was 0.6 mL / min.
[0038] The gene sequences involved in the embodiments of the present invention can be encoded and synthesized according to the sequence information corresponding to the amino acid sequences mentioned in the sequence listing or the NCBI number provided in the foregoing invention content section, or amplified using the microbial genome of the corresponding source as a template.
[0039] Some of the primers used in the embodiments of this invention are shown in Table 1: Table 1 Primer sequences used in the embodiments of the present invention Name Sequence -1 GCAAAGAGGGTTACGGACAGA -2 GATTGCCCTTCACCGCCTTGTTTGCCCGCCAGTTGT -3 ACAACTGGCGGGCAAACAAGGCGGTGAAGGGCAATC -4 GCGCAACTGTTGGGAAGG -1 TCAAGTCTGACATTCCCGAGTAAA -2 GAATCTATTATACAGAAAAATTTTCCTGAAAGCAAATAAATTTTTTATGATTCTTCGATGGCGGTTCAGGTTATT -3 GGAAGCGTTTATTATTGAAGCGTAAAGTGAGAGAGACCGATGCATCC -4 AACAGTTTGCCGACGATGTTG -1 ATTTCACACAGGAAACAGACCATGACAGAAGATAATATTGCTCCAATC -2 GGATGCATCGGTCTCTCTCACTTTACAACAATCTCTCTTCGAATCTTAGTT -1 AGGAAAATTTTTCTGTATAATAGATTCATAAATTTGAGAGAGGAGTTAAATATGAGCACGAGCACCATTCG -2 GGATGCATCGGTCTCTCTCACTTTACGCTTCAATAATAAACGCTTCC -1 AACTAAGATTCGAAGAGAGATTGTTGTAAAGTGAGAGAGACCGATGCATCC -2 CGACTGAGCCTTTCGTTTTATTTGTTAACGCTTCAGAGCGTCGC -1 GCATTCATCATCGAGGCGTAAAGTGAGAGAGACCGATGGATGCTCGTGGGATGTTG -2 TCGACTGAGCCTTTCGTTTTATTTGTTACTTGTACTCCTCATTTAACGACTGG -1 ATAGCGCAGGGTACATTCCACT -2 AATTGTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAACCTTCTTCAATAGAGGCGGTACA -3 AAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATTGCCGCAGAGACCGACAT -4 ACAGCGGTTGTGGTGGCA -1 TAAACTCGTCAGCGGCACAA -2 TGTGTGAAATTGTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAAGGTAGGCGTTTCTGTTGATTCTG -3 AAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATGCGTGTCGGATTATCGTTCG -4 GATTCAGGTTGCCATTTACGC P trc - glf ZM -1]]> TCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCATGAGCAGTGAAAGCAGTCAAGG P trc - glf ZM -2]]> CACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGTTATTTCTGGCTGCGCCAC -1 TCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCATGACAAAGTATGCATTAGTCGGTG -2 CACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGTTACAGAATGTGACCTAAGGTCTGG -1 CTGGATGTTGCGGATAGCGT -2 CGGCCTACATATCGACGATGACTTAGCGCAGTGAAGCATTTATTAG -3 CTAATAAATGCTTCACTGCGCTAAGTCATCGTCGATATGTAGGCCG -4 CCCTTCATTGAATGAATGGAGAT -1 GAAACGATTCACCGTCGGTT -2 CGATAGCACGGATAGCGTCACTAACCCGGTACTTAAGCCAGG -3 CCTGGCTTAAGTACCGGGTTAGTGACGCTATCCGTGCTATCG -4 GATTGCCCGTAAAGTGGTGC -1 CGTTACTTCACCCACGCGTT -2 CGCAACGATATATTTTTTTTCAGTCATTTATAAATCCCTGGAATTATTTTCGT -3 GTGGGAAGAACACGACGAATAATCCTGCACGGCTTCCCA -4 AACCGAACCTGGATTATGAAGTG -1 ACGAAAATAATTCCAGGGATTTATAAATGACTGAAAAAAAATATATCGTTGCG G913-1 CCTGCCATAAACACCGCACTTTCCAACGCATAGTTCACTTCG G913-2 CGAAGTGAACTATGCGTTGGAAAGTGCGGTGTTTATGGCAGG -2 TGGGAAGCCGTGCAGGATTATTCGTCGTGTTCTTCCCAC -1 TAAGGCGAACAGGGCAGTG -2 CAGAGCTTCTTCGATACCGATCAGGAAGTACCTATAATTGATACGTGGC -3 GCCACGTATCAATTATAGGTACTTCCTGATCGGTATCGAAGAAGCTCTG -4 TTCGTCGCGTAGTTGTCTTCA pGRBS AGTCCTAGGTATAATACTAGTGAATTACATTCCCAACCGCGGTTTTAGAGCTAGAA pGRB--A TTCTAGCTCTAAAACCGCGGTTGGGAATGTAATTCACTAGTATTATACCTAGGACT PG-1 AGTCCTAGGTATAATACTAGTCCGCAATCGCGACATGATAAGTTTTAGAGCTAGAA PG-2 TTCTAGCTCTAAAACTTATCATGTCGCGATTGCGGACTAGTATTATACCTAGGACT PG-3 AGTCCTAGGTATAATACTAGTTGCGACGTGCTTCAGGCTGAGTGGTTAGCTAGAA PG-4 TTCTAGCTAACCACTCAGCCTGAAGCACGTCGCAACTAGTATTATACCTAGGACT PG-5 AGTCCTAGGTATAATACTAGTCAGAACCCGGTAGTTGCGTTGTTTTAGAGCTAGAA PG-6 TTTCTAGCTCTAAAACAACGCAACTACCGGGTTCTGACTAGTATTATACCTAGGACT PG-7 AGTCCTAGGTATAATACTAGTTACACTCAACATTACGCTAAGTTTTAGAGCTAGAA PG-8 TTCTAGCTCTAAAACTTAGCGTAATGTTGAGTGTAACTAGTATTATACCTAGGACT PG-9 AGTCCTAGGTATAATACTAGTACTGCTGCATTCAGCCGTCTGTTTTAGAGCTAGAA PG-10 TTCTAGCTCTAAAACAGACGGCTGAATGCAGCAGTACTAGTATTATACCTAGGACT PG-11 AGTCCTAGGTATAATACTAGTCTGATCCCTGCGCCATCATGGGTTTTAGAGCTAGAA PG-12 TTCTAGCTCTAAAACCCATGATGGCGCAGGATCAGACTAGTATTATACCTAGGACT PG-13 AGTCCTAGGTATAATACTAGTGTTTTACCTGCCGTTATTTGGGTTTTAGAGCTAGAA PG-14 TTCTAGCTCTAAAACCCAAATAACGGCAGGTAAAACACTAGTATTATACCTAGGACT The present invention will be further explained and illustrated below through specific embodiments.
[0040] Example 1: Construction of myo-inositol genetically engineered bacteria (1) trc The promoter is repressed by the lactose operon repressor protein LacI, so the LacI coding site is knocked out to constitutively overexpress the gene.
[0041] wild-type Escherichia coli E. coli Using the W3110 genome as a template, primers were used respectively... lacI -1 / lacI -2 and lacI -3 / lacI -4 amplification lacI The upstream and downstream homologous arms were then identified, and overlap PCR was used to obtain the homologous arms containing... lacI The fusion fragment U of the upstream and downstream homologous arms lacI -D lacI .
[0042] (2) According to lacI Sequence design and synthesis of a 20 bp forward sequence pGRB- for gRNA. lacI -S and reverse sequence pGRB- lacI -A, after annealing, both were ligated to plasmid pGRB using the ClonExpress II One Step Cloning Kit, and then transformed into... E. coli In DH5α, the recombinant plasmid pGRB- was obtained after screening and sequencing using LB solid medium containing 100 μg / mL ampicillin. lacI .
[0043] (3) The recombinant plasmid pGRB- lacI and fusion fragment U lacI -D lacI Electroconversion to plasmids containing pREDcas9 E. coli W3110 competent cells were revived and plated on LB agar containing 100 μg / mL spectinomycin and ampicillin, and cultured overnight at 32°C. The following day, primers were used... lacI -1 / lacI -4. Colony PCR identification was performed to screen for positive transformants. The transformants were activated, and arabinose was added to a final concentration of 0.2 mmol / L. The mixture was then incubated overnight at 32°C with shaking to allow pGRB- to develop. lacI The pREDcas9 plasmid was lost; then it was cultured overnight at 42°C with shaking to induce the loss of the plasmid, thus obtaining a knockout. lacI strains E. coli W3110 lacI .
[0044] (4) Using the Escherichia coli W3110 genome as a template, primers were used to... yfhQ -1 / yfhQ -2 and yfhQ -3 / yfhQ -4 amplification yfhQ Upstream and downstream homologous arms of a gene; Saccharomyces cerevisiae Using the S288C genome as a template, primers were used... INO1 -1 and INO1 -2 amplification by P trc Startup driver INO1 Gene fragment P trc - INO1 Using the genome of Escherichia coli W3110 as a template, primers were used... suhB -1 and suhB -2, gene amplification via PCR suhB The PCR products were recovered and then processed using primers. yfhQ -1 / yfhQ -4 was obtained via overlap PCR and contained yfhQ Upstream homologous arm, downstream homologous arm, P trc - INO1 and suhB EC fusion fragment U yfhQ -P trc - INO1-suhB EC - D yfhQ .
[0045] (5) According to yfhQ Sequence design and synthesis of 20 bp gRNA forward sequence PG-1 and reverse sequence PG-2 were performed, and recombinant plasmid pGRB-1 was obtained using the same method as in step (2).
[0046] (6) Combine the recombinant plasmid pGRB-1 and the fusion fragment U yfhQ -P trc - INO1-suhB EC -D yfhQElectroconversion to plasmids containing pREDcas9 E. coli W3110 lacI Competent cells were recovered and plated onto LB agar plates containing 100 μg / mL spectinomycin and ampicillin, and incubated overnight at 32°C. The following day, primers were used... yfhQ -1 / yfhQ -4. Perform colony PCR identification to screen for positive transformants. Using the same method as in step (3), remove the pGRB-1 and pREDcas9 plasmids from the positive transformants to obtain overexpressed transformants. INO1-suhB EC strain M-1.
[0047] (7) Using the Escherichia coli W3110 genome as a template, primers were used to... yfhQ -1 / yfhQ -2 and yfhQ -3 / yfhQ -4 amplification yfhQ Upstream and downstream homologous arms of a gene; Corynebacterium glutamicum Using the genome of ATCC13032 as a template, primers were used... cg3323 -1 / cg3323 -2 and impA -1 / impA -2, respectively PCR amplification of genes cg3323 and impA The PCR products were recovered and then used with primers. yfhQ -1 / yfhQ -4 was obtained via overlap PCR and contained yfhQ Upstream homologous arm, downstream homologous arm, P trc - cg332 and impA fusion fragment U yfhQ -P trc - cg3323 - impA- D yfhQ .
[0048] (8) Combine the recombinant plasmid pGRB-1 and the fusion fragment U yfhQ -P trc - cg3323 - impA -D yfhQ Electroconversion to plasmids containing pREDcas9 E. coli W3110 lacI Competent cells were recovered and plated onto LB agar plates containing 100 μg / mL spectinomycin and ampicillin, and incubated overnight at 32°C. The following day, primers were used... yfhQ -1 / yfhQ-4. Perform colony PCR identification to screen for positive transformants. Using the same method as in step (3), remove the pGRB-1 and pREDcas9 plasmids from the positive transformants to obtain overexpressed transformants. cg3323 - impA strain M-2.
[0049] (9) Using the Escherichia coli W3110 genome as a template, primers were used to... yfhQ -1 / yfhQ -2 and yfhQ -3 / yfhQ -4 amplification yfhQ Upstream and downstream homologous arms of the gene; using the genome of Corynebacterium glutamicum 13032 as a template, primers were used... cg3323 -1 / cg3323 -2, P was amplified by PCR. trc - cg3323 Fragment; using the genome of E. coli W3110 as a template, primers were used. suhB -1 / suhB -2, PCR amplification of genes suhB The PCR products were recovered and then processed using primers. yfhQ -1 / yfhQ -4 was obtained via overlap PCR and contained yfhQ Upstream homologous arm, downstream homologous arm, P trc - cg3323 and suhB EC fusion fragment U yfhQ -P trc - cg3323 - suhB EC -D yfhQ .
[0050] (10) Combine recombinant plasmid pGRB-1 and fusion fragment U yfhQ -P trc - cg3323 - suhB EC -D yfhQ Electroconversion to plasmids containing pREDcas9 E. coli W3110 lacI Competent cells were recovered and plated onto LB agar plates containing 100 μg / mL spectinomycin and ampicillin, and incubated overnight at 32°C. The following day, primers were used... yfhQ -1 / yfhQ -4. Perform colony PCR identification to screen for positive transformants. Using the same method as in step (3), remove the pGRB-1 and pREDcas9 plasmids from the positive transformants to obtain overexpressed transformants. cg3323 - suhB EC strain M-3.
[0051] (11) Using the Escherichia coli W3110 genome as a template, primers were used to... yfhQ -1 / yfhQ -2 and yfhQ -3 / yfhQ -4 amplification yfhQ Upstream and downstream homologous arms of the gene; using the genome of Corynebacterium glutamicum 13032 as a template, primers were used... cg3323 -1 and suhB - 2. PCR amplification of P trc - cg3323 - suhB GC Fragments. The above PCR products were recovered and subjected to overlap PCR to obtain fragments containing... yfhQ Upstream homologous arm, downstream homologous arm and P trc - cg3323 - suhB GC fusion fragment U yfhQ -P trc - cg3323 - suhB GC -D yfhQ .
[0052] (12) Combine recombinant plasmid pGRB-1 and fusion fragment U yfhQ -P trc - cg3323 - suhB GC -D yfhQ Electroconversion to plasmids containing pREDcas9 E. coli W3110 lacI Competent cells were recovered and plated onto LB agar plates containing 100 μg / mL spectinomycin and ampicillin, and incubated overnight at 32°C. The following day, primers were used... yfhQ -1 / yfhQ -4. Perform colony PCR identification to screen for positive transformants. Using the same method as in step (3), remove the pGRB-1 and pREDcas9 plasmids from the positive transformants to obtain overexpressing P. trc - cg3323 - suhB GC strain W-1.
[0053] (13) Using the Escherichia coli W3110 genome as a template, primers were used to... ycgH -1 / ycgH -2 and ycgH -3 / ycgH -4 amplification ycgHUpstream and downstream homologous arms of a gene; E. coli Using the W3110 genome as a template, primers were used... glk -1 and glk -2 amplification by P trc Startup driver glk Gene fragment P trc - glk After PCR product recovery, overlap PCR was performed to obtain the product containing... ycgH Upstream homologous arm, downstream homologous arm and P trc - glk fusion fragment U ycgH -P trc - glk -D ycgH .
[0054] (14) According to ycgH Sequence design and synthesis of 20 bp gRNA forward sequence PG-3 and reverse sequence PG-4 were performed, and recombinant plasmid pGRB-2 was obtained using the same method as in step (2).
[0055] (15) Combine the recombinant plasmid pGRB-2 and the fusion fragment U ycgH -P trc - glk -D ycgH Electroporation was performed into W-1 competent cells containing the pREDcas9 plasmid. After recovery, the cells were plated onto LB solid culture media containing 100 μg / mL spectinomycin and ampicillin, and incubated overnight at 32°C. The next day, primers were used... ycgH -1 / ycgH -4. Perform colony PCR identification to screen for positive transformants. Using the same method as in step (3), remove the pGRB-3 and pREDcas9 plasmids from the positive transformants to obtain overexpressing P. trc - glk strain W-2.
[0056] (16) Using the Escherichia coli W3110 genome as a template, primers were used to... rph -1 / rph -2 and rph -3 / rph -4 amplification rph Upstream and downstream homologous arms of a gene; E. coli Using the W3110 genome as a template, primer P trc - glf ZM -1 and P trc - glf ZM -2 amplification by P trc Startup driver glfZM Gene fragment P trc - glf ZM After PCR product recovery, overlap PCR was performed to obtain the product containing... rph Upstream homologous arm, downstream homologous arm and P trc - glf ZM fusion fragment U rph -P trc - glf ZM -D rph .
[0057] (17) According to rph Sequence design and synthesis of 20 bp gRNA forward sequence PG-5 and reverse sequence PG-6 were performed, and recombinant plasmid pGRB-3 was obtained using the same method as in step (2).
[0058] (18) Combine the recombinant plasmid pGRB-3 and the fusion fragment U rph -P trc - glf ZM -D rph Electroporation was performed into W-2 competent cells containing the pREDcas9 plasmid. After recovery, the cells were plated onto LB solid culture media containing 100 μg / mL spectinomycin and ampicillin, and incubated overnight at 32°C. The next day, primers were used... rph -1 / rph -4. Perform colony PCR identification to screen for positive transformants. Using the same method as in step (3), remove the pGRB-3 and pREDcas9 plasmids from the positive transformants to obtain overexpressing P. trc - glf ZM strain W-3.
[0059] (19) With wild-type Escherichia coli E. coli Using the W3110 genome as a template, primers were used respectively... pgi -1 / pgi -2 and pgi -3 / pgi -4 amplification pgi The upstream and downstream homologous arms of the gene were obtained by overlapping PCR after the PCR product was recovered. pgi The fusion fragment U of the upstream and downstream homologous arms pgi -D pgi .
[0060] (20) According to pgiSequence design and synthesis of 20 bp gRNA forward sequence PG-7 and reverse sequence PG-8 were performed, and recombinant plasmid pGRB-4 was obtained using the same method as in step (2).
[0061] (21) The recombinant plasmid pGRB-4 and the fusion fragment U pgi -D pgi Transformed into W-3 competent cells containing the pREDcas9 plasmid, and after thawing, plated onto LB solid culture media containing 100 μg / mL spectinomycin and ampicillin, and incubated overnight at 32°C. The next day, primers were used... pgi -1 / pgi -4. Perform colony PCR identification to screen for positive transformants. Using the same method as in step (3), remove the pGRB-4 and pREDcas9 plasmids from the positive transformants to obtain knockout strains. pgi The gene is from strain W-4.
[0062] (22) With wild-type Escherichia coli E. coli Using the W3110 genome as a template, primers were used respectively... zwf -1 / zwf -2 and zwf -3 / zwf -4 amplification zwf The upstream and downstream homologous arms of the gene were obtained by overlapping PCR after the PCR product was recovered. zwf The fusion fragment U of the upstream and downstream homologous arms zwf -D zwf .
[0063] (23) According to zwf Sequence design and synthesis of 20 bp gRNA forward sequence PG-9 and reverse sequence PG-10, and recombinant plasmid pGRB-5 was obtained using the same method as in step (2).
[0064] (24) The recombinant plasmid pGRB-5 and the fusion fragment U zwf -D zwf Transformed into W-4 competent cells containing the pREDcas9 plasmid, and after thawing, plated onto LB solid culture media containing 100 μg / mL spectinomycin and ampicillin, and incubated overnight at 32°C. The next day, primers were used... zwf -1 / zwf -4. Perform colony PCR identification to screen for positive transformants. Using the same method as in step (3), remove the pGRB-5 and pREDcas9 plasmids from the positive transformants to obtain knockout strains. zwf The gene is from strain W-5.
[0065] (25) Using the Escherichia coli W3110 genome as a template, primers were used to...glpR -1 / glpR -2 and glpR -3 / glpR -4 amplification glpR Upstream and downstream homologous arms of the gene; using wild-type Escherichia coli E. coli Using the W3110 genome as a template, glpK -1 / G913-1 and glpK -2 / G913-2 is the primer for PCR amplification. glpK The 5' and 3' ends of the gene were recovered and used with primers. glpK -1 / glpK -2 overlap PCR was obtained from P trc Startup driver glk Gene fragment P trc - glpK G913A The above PCR products were recovered and subjected to overlap PCR to obtain products containing... glpK Upstream homologous arm, downstream homologous arm and glpK fusion fragment U glpR - glpK -D glpR .
[0066] (26) According to glpR Sequence design and synthesis of 20 bp gRNA forward sequence PG-11 and reverse sequence PG-12 were performed, and recombinant plasmid pGRB-6 was obtained using the same method as in step (2).
[0067] (27) The recombinant plasmid pGRB-6 and the fusion fragment U glpR - glpK -D glpR Electroporation was performed into W-5 competent cells containing the pREDcas9 plasmid. After recovery, the cells were plated onto LB solid culture media containing 100 μg / mL spectinomycin and ampicillin, and incubated overnight at 32°C. The next day, primers were used... glpR -1 / glpR -4. Perform colony PCR identification to screen for positive transformants. Using the same method as in step (3), remove the pGRB-6 and pREDcas9 plasmids from the positive transformants to obtain transformants that have been knocked out. glpR Simultaneous overexpression glpK G913A strain W-6.
[0068] (28) With wild-type Escherichia coli E. coli Using the W3110 genome as a template, primers were used respectively... ackA -1 / ackA -2 and ackA -3 / ackA -4 amplification ackAThe upstream and downstream homologous arms were identified, and then overlap PCR was used to obtain... ackA The fusion fragment U of the upstream and downstream homologous arms ackA -D ackA .
[0069] (29) According to ackA Sequence design and synthesis of 20bp gRNA forward sequence PG-13 and reverse sequence PG-14, and recombinant plasmid pGRB- was obtained using the same method as in step (2). ackA .
[0070] (30) The recombinant plasmid pGRB- ackA and fusion fragment U ackA -D ackA Electroporation was performed into W-6 competent cells containing the pREDcas9 plasmid. After recovery, the cells were plated on LB agar containing 100 μg / mL spectinomycin and ampicillin and incubated overnight at 32°C. The next day, primers were used... -1 / -4. Perform colony PCR identification to screen for positive transformants. Use the same method as in step (3) to extract pGRB- from the positive transformants. Plasmid and pREDcas9 plasmid lost, resulting in knockout. The gene-producing strain W-7 is a genetically engineered bacterium that produces high levels of myo-inositol.
[0071] A schematic diagram of the genetic modification of this high-yield myo-inositol genetically engineered bacterium is shown below. As shown.
[0072] (31) Based on strain M-1, strain M-4 is obtained by following the steps (13) to (30) above, that is, a myo-inositol-producing engineered strain is obtained by using inositol-1-phosphate synthase from Saccharomyces cerevisiae and inositol monophosphatase from Escherichia coli as key enzymes.
[0073] Example 2: Shake Flask Fermentation (1) Seed culture The myo-inositol-producing strains M-1, M-2, M-3, M-4, W-1, W-2, W-3, W-4, W-5, W-6, and W-7 obtained in Example 1 were inoculated onto LB solid medium slant, with W-1 as a control, and cultured at 37°C for 12 h. Then, single colonies were picked and inoculated into 30 mL of seed culture medium and cultured at 37°C and 220 rpm for 10 h.
[0074] The seed culture medium used consisted of 10 g / L yeast extract, 20 g / L glycerol, 6 g / L peptone, 1.2 g / L KH₂PO₄, 0.5 g / L MgSO₄·7H₂O, 10 mg / L FeSO₄·7H₂O, and 10 mg / L MnSO₄. 2.0% phenol red was added to the seed culture medium as a pH indicator to adjust the pH to 7.0-7.2. The medium was then autoclaved at 115°C for 15 min before use.
[0075] (2) Fermentation culture Inoculate the fermentation medium with a 10% inoculum and incubate at 37°C and 220 rpm for 24 h with shaking. During fermentation, when the glycerol in the medium is depleted, replenish with 60% glycerol 2-3 times to maintain the glycerol concentration at 0.1%-0.5%, replenishing 0.5 mL each time, and adjust the pH to 6.9-7.1 with NaOH.
[0076] The fermentation medium used consisted of: 10 g / L glucose, 2 g / L yeast extract, 4 g / L peptone, 20 g / L glycerol, 6 g / L (NH4)2SO4, 4 g / L KH2PO4, 0.7 g / L MgSO4·7H2O, 10 mg / L FeSO4·7H2O, and 10 mg / L MnSO4·H2O. 2.0% phenol red was added to the fermentation medium as a pH indicator to adjust the pH to 6.8-7.2. The medium was then autoclaved at 115℃ for 15 min before use.
[0077] After fermentation, the myo-inositol content in the fermentation broth was measured. The myo-inositol content in the fermentation broth of each strain is shown in Table 2.
[0078] Table 2. Myo-inositol content in the fermentation broth of the strain
[0079] Table 2 shows that, by comparing the myo-inositol content in the fermentation broths of strains M-1, M-2, M-3, and W-1, the results indicate that myo-inositol originates from Corynebacterium glutamicum. - GC To construct the optimal gene combination for efficient myo-inositol synthesis, and with W-1 achieving a myo-inositol yield 3.64 times that of M-1, this invention demonstrates the effectiveness of utilizing the inositol-1-phosphate synthase encoding gene from Corynebacterium glutamicum. and GC The combined construction of the myo-inositol synthesis pathway has yielded unexpected technical results.
[0080] The myo-inositol content in the fermentation broth of strains W-1 to W-7 showed an overall upward trend, indicating that the myo-inositol production capacity of the strains gradually increased. Among them, strain W-7 had the strongest myo-inositol production capacity, with its shake-flask fermentation yielding 14.04 g / L of myo-inositol, which is 2.79 times that of strain M-4.
[0081] Example 3: Fermentation in a fermenter (1) Seed culture The activated M-4 and W-7 (provided in Example 1) were inoculated at a rate of 10% into a 5 L fermenter containing 3 L of seed culture medium. 25% NaOH was added to adjust the pH of the fermentation broth to 6.8-7.2, dissolved oxygen was maintained at 20%, and aeration was maintained at 2-4 m³ / h. 3 The mixture was stirred at 200-700 rpm for 8 hours at 32℃ to obtain seed culture. The seed culture medium consisted of 15 g / L glycerol, 3 g / L yeast extract, 5 g / L tryptone, 1.5 g / L KH2PO4, 5 mg / L FeSO4·7H2O, and 12 mg / L MnSO4. The pH was adjusted to 7.0-7.2, and the medium was autoclaved at 115℃ for 15 minutes before use.
[0082] (2) Fermentation in fermentation tank The seed culture from step (1) was inoculated at a 10% inoculum into a 5 L fermenter containing 3 L of fermentation medium for fermentation culture at a fermentation temperature of 37℃ and an aeration rate of 2-4 m³ / h. 3 The stirring speed was 300-600 rpm, dissolved oxygen was maintained at 15-20%, and 60% glycerol and 60% glucose solutions were added separately to maintain the concentration of glycerol and glucose in the fermentation system at 0.1%-0.5%. 25% NaOH was added to adjust the pH of the fermentation broth to 6.8-7.2, and the fermentation cycle was 48 h. The fermentation medium used consisted of 20 g / L glucose, 10 g / L glycerol, 2 g / L yeast extract, 5 g / L tryptone, 1 g / L KH2PO4, 0.5 g / L MgSO4·7H2O, 5 mg / L FeSO4·7H2O, and 5 mg / L MnSO4. The pH was adjusted to 6.8-7.2, and the medium was autoclaved at 115℃ for 15 min before use.
[0083] The myo-inositol contents in the fermentation broths of strains M-4 and W-7 were 16.41 g / L and 52.68 g / L, respectively, with W-7 having a 2.2-fold higher inositol yield than M-4.
[0084] Example 4: Fermentation in a fermenter (1) Seed culture The activated strain W-7 (provided in Example 1) was inoculated at a rate of 10% into a 5L fermenter containing 3L of seed culture medium. 25% NaOH was added to adjust the pH of the fermentation broth to 6.8-7.2, dissolved oxygen was maintained at 20%, and aeration was maintained at 2-4 m³ / h. 3 The seed culture was obtained by stirring at 200-600 rpm for 10 h at 30℃. The seed culture medium consisted of 15 g / L glycerol, 3 g / L yeast extract, 5 g / L tryptone, 1.5 g / L KH2PO4, 5 mg / L FeSO4·7H2O, and 12 mg / L MnSO4, adjusted to pH 7.0-7.2, and autoclaved at 115℃ for 15 min before use.
[0085] (2) Fermentation in fermentation tank The seed culture from step (1) was inoculated at a 10% inoculum into a 5 L fermenter containing 3 L of fermentation medium for fermentation culture at a fermentation temperature of 37℃ and an aeration rate of 2-4 m³ / h. 3 The stirring speed was 300-800 rpm, and the dissolved oxygen was maintained at 15-30%. 60% glycerol and 60% glucose solutions were added separately, maintaining the concentrations of glycerol and glucose in the system at 0.1%-0.5%. 25% NaOH was added to adjust the pH of the fermentation broth to 6.8-7.2. The fermentation cycle was 48 hours. The fermentation medium consisted of 20 g / L glucose, 10 g / L glycerol, 2 g / L yeast extract, 5 g / L tryptone, 1 g / L KH₂PO₄, 0.5 g / L MgSO₄·7H₂O, 5 mg / L FeSO₄·7H₂O, and 5 mg / L MnSO₄. The pH was adjusted to 6.8-7.2, and the mixture was autoclaved at 115℃ for 15 minutes before use.
[0086] After fermentation, the content of myo-inositol and other organic acids in the fermentation broth was measured. The myo-inositol content in the fermentation broth of strain W-7 reached 55.42 g / L, and no other organic acids were detected.
[0087] Example 5: Fermentation in a fermenter (1) Seed culture The activated strain W-7 (provided in Example 1) was inoculated at a rate of 10% into a 5L fermenter containing 3L of seed culture medium. 25% NaOH was added to adjust the pH of the fermentation broth to 6.8-7.2, dissolved oxygen was maintained at 20%, and aeration was maintained at 2-4 m³ / h. 3The mixture was stirred at 200-800 rpm for 6 hours at 35°C to obtain seed culture. The seed culture medium consisted of 15 g / L glycerol, 3 g / L yeast extract, 5 g / L tryptone, 1.5 g / L KH2PO4, 5 mg / L FeSO4·7H2O, and 12 mg / L MnSO4. The pH was adjusted to 7.0-7.2, and the medium was autoclaved at 115°C for 15 minutes before use.
[0088] (2) Fermentation in fermentation tank The seed culture from step (1) was inoculated at a 20% inoculum into a 5 L fermenter containing 3 L of fermentation medium for fermentation culture at a fermentation temperature of 37℃ and an aeration rate of 2-4 m³ / h. 3 The stirring speed was 300-900 rpm, and the dissolved oxygen was maintained at 15-40%. 60% glycerol and 60% glucose solutions were added separately, maintaining the concentrations of glycerol and glucose at 0.1%-0.5%. 25% NaOH was added to adjust the pH of the fermentation broth to 6.8-7.2. The fermentation cycle was 48 hours. The fermentation medium consisted of 20 g / L glucose, 10 g / L glycerol, 2 g / L yeast extract, 5 g / L tryptone, 1 g / L KH₂PO₄, 0.5 g / L MgSO₄·7H₂O, 5 mg / L FeSO₄·7H₂O, and 5 mg / L MnSO₄. The pH was adjusted to 6.8-7.2, and the medium was autoclaved at 115℃ for 15 minutes before use.
[0089] After fermentation, the content of myo-inositol and other organic acids in the fermentation broth was measured. The myo-inositol content in the fermentation broth of strain W-7 reached 58.4 g / L, and no other organic acids were detected. ).
[0090] In summary, the present invention is based on Using strain W3110 as the starting strain, a non-auxotrophic myo-inositol biosynthesis pathway was constructed by introducing exogenous gene expression to construct the pathway, enhancing glucose transport, reducing competitive pathways to enhance glucose-6-phosphate supply, and synergistically utilizing carbon sources to uncouple growth and myo-inositol synthesis, thereby increasing the metabolic flux of myo-inositol synthesis. This resulted in a genetically engineered strain that produces myo-inositol without requiring inducers or carrying plasmids. Furthermore, the fermentation process for producing myo-inositol using this strain is simple, easy to control, and has low production costs, making it suitable for industrial-scale production and application.
[0091] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A genetically engineered bacterium for producing myo-inositol, characterized in that, The genetically engineered bacteria were obtained by editing the following genes in the genome of *Escherichia coli* as the starting strain: lactose operon repressor protein, glucose-1-phosphate dehydrogenase, acetate kinase, glucose-1-phosphate isomerase, and glycerol repressor protein were not expressed; inositol-1-phosphate synthase, inositol monophosphatase, glucokinase, glucose permease, and glycerol kinase were overexpressed.
2. The genetically engineered bacterium for producing myo-inositol as described in claim 1, characterized in that, The amino acid sequence of the inositol-1-phosphate synthase is shown in SEQ ID NO.1; the amino acid sequence of the inositol monophosphatase is shown in SEQ ID NO.
2.
3. The genetically engineered bacterium for producing myo-inositol as described in claim 2, characterized in that, The amino acid sequence of the glucokinase is shown in SEQ ID NO.3; the amino acid sequence of the glucose permease is shown in SEQ ID NO.4; and the amino acid sequence of the glycerol kinase is shown in SEQ ID NO.
5.
4. The genetically engineered bacterium for producing myo-inositol as described in claim 1, characterized in that, The starting strain was Escherichia coli W3110.
5. The genetically engineered bacterium for producing myo-inositol as described in claim 4, characterized in that, The NCBI-Protein IDs for the lactose operon repressor protein are: BAE76127; for glucose-phosphodiesterase, BAA15660; for acetate kinase, BAA16135; for glucose-phosphodiesterase, BAE78027; and for glycerol repressor protein, BAE77869.
6. The genetically engineered bacterium for producing myo-inositol as described in claim 1, characterized in that, The inositol-1-phosphate synthase, inositol monophosphatase, glucokinase, and glucose permease are produced using P... trc Promoter controls expression.
7. The genetically engineered bacterium for producing myo-inositol as described in claim 1, characterized in that, Starting with *Escherichia coli* W3110, the coding genes for inositol-1-phosphate synthase, inositol monophosphatase, glucokinase, glucose permease, and glycerol kinase were integrated into its genome; the coding genes for lactose operon repressor protein, phosphoglucose isomerase, phosphoglucose dehydrogenase, repressor protein in the glycerol metabolic pathway, and acetate kinase were knocked out; and the results were obtained through P... trc The promoter regulates the expression of genes encoding inositol-1-phosphate synthase, inositol monophosphatase, glucokinase, and glucose permease.
8. The use of the genetically engineered bacteria according to any one of claims 1-7 in the production of myo-inositol.
9. The application as described in claim 8, characterized in that, The method for producing myo-inositol using the genetically engineered bacteria through fermentation is as follows: Seed culture is inoculated onto the fermentation medium at an inoculum rate of 10%-20%, fermentation temperature is 35-37℃, and aeration rate is 2-4 m³ / h. 3 At a stirring speed of 300-900 rpm and dissolved oxygen maintained at 10-40%, glucose and glycerol solutions were added to carry out aerobic fermentation to obtain a fermentation broth containing myo-inositol.
10. The application as described in claim 9, characterized in that, Seed cultures were inoculated at a rate of 10-20% into fermenters containing fermentation medium. The fermentation temperature was 35-37℃, and the aeration rate was 2-4 m³ / h. 3 The stirring speed was 300-900 rpm, the dissolved oxygen was maintained at 10-30%, and 60% glucose solution and 60% glycerol were added separately, maintaining the glucose and glycerol concentrations at 0.1%-0.5%. The pH of the fermentation broth was adjusted to 6.8-7.2, and the fermentation cycle was 48 h. The fermentation medium consists of: 10-20 g / L glucose, 2-6 g / L yeast extract, 1-5 g / L peptone, 10-30 g / L glycerol, 1-3 g / L KH2PO4, 0.5-2 g / L MgSO4·7H2O, 5-15 mg / L FeSO4·7H2O, 5-15 mg / L MnSO4, with the remainder being water; the pH is 6.8-7.2.
Citation Information
Cited By
Recombinant strain for producing inositol and preparation method and application thereof
CN122146562A