Reformed klebsiella and application thereof in production of 1,3-propanediol by using mixed carbon source

Abstract

This application relates to the field of biotechnology, and particularly to modified Klebsiella bacteria and their application in producing 1,3-propanediol using a mixed carbon source. This application discloses modified Klebsiella bacteria and a method for producing 1,3-propanediol using a mixed carbon source of glucose and glycerol. The modified Klebsiella bacteria are bacteria with inactivated dihydroxyacetone kinase large subunit and glycerol kinase; the modified Klebsiella bacteria are bacteria with inactivated dihydroxyacetone kinase large subunit, phosphorylation transfer system, and glycerol kinase; the modified Klebsiella bacteria are bacteria with inactivated dihydroxyacetone kinase large subunit, glucose-6-phosphate isomerase, and glycerol kinase. The modified Klebsiella bacteria are inoculated into a culture medium using sugar raw materials and glycerol as carbon sources for fermentation. After cultivation, the performance of the strain in producing 1,3-propanediol is improved. The fermentation method for producing 1,3-propanediol provided by this invention significantly improves the conversion rate of raw materials.

Description

Technical Field

[0001] This specification relates to the field of biotechnology, and in particular to modified Klebsiella pneumoniae and its application in the production of 1,3-propanediol using mixed carbon sources. Background Technology

[0002] 1,3-Propanediol is a colorless, odorless, hygroscopic viscous liquid. Its molecular formula is C3H8O2, and its molecular weight is 76.10. In the pharmaceutical field, 1,3-propanediol is mainly used as a solvent, stabilizer, and wetting agent. It can improve drug solubility, increase drug stability, and reduce drug irritation, thereby improving drug efficacy. 1,3-Propanediol is also an important chemical raw material, primarily used in polymerization reactions with terephthalic acid (PTA) to produce high-performance polyester material—polypropylene terephthalate (PTT).

[0003] Klebsiella bacteria are Gram-negative bacteria with short, stout, rod-shaped, non-motile cells that are non-spore-forming and have a distinct capsule structure. The genus includes species such as *Klebsiella pneumoniae*, *Klebsiella oxytoca*, *Klebsiella variicola*, and *Klebsiella michiganensis*. These bacteria are characterized by vigorous growth and the ability to utilize various carbon sources. Currently, Klebsiella bacteria are used in the production of products such as 1,3-propanediol, 2,3-butanediol, 2-ketogluconic acid, and acetoin, exhibiting advantages such as high substrate conversion rates and high final product concentrations.

[0004] Bacteria, including *Klebsiella* and *Citrobacter freundii*, can naturally synthesize 1,3-propanediol using glycerol as a carbon source. *Klebsiella* bacteria, in particular, have a strong ability to synthesize 1,3-propanediol from glycerol and are currently used as strains for industrial production. The *Klebsiella* genome contains a *dha* operon, which encodes enzymes related to the metabolism of glycerol to 1,3-propanediol. These enzymes include glycerol dehydratase, 1,3-propanediol oxidoreductase, glycerol dehydrogenase, dihydroxyacetone kinase I, and dihydroxyacetone kinase II. Therefore, *Klebsiella* bacteria can synthesize 1,3-propanediol using glycerol as a carbon source. The synthesis of 1,3-propanediol from glycerol involves a reduction pathway and an oxidation pathway. In the reduction pathway, glycerol is catalyzed by a dehydratase to form 3-hydroxypropanal, which is then catalyzed by 1,3-propanediol oxidoreductase to form 1,3-propanediol. In the oxidation pathway, glycerol is catalyzed by dehydrogenases to form dihydroxyacetone, which is then catalyzed by kinases to form dihydroxyacetone phosphate. The latter enters the cellular glycolysis pathway and is further metabolized to form other metabolites.

[0005] Glucose, as one of the main energy sources for bacteria, provides a large amount of energy through processes such as glycolysis, the citric acid cycle, and oxidative phosphorylation. It is also an important carbon source for bacteria to synthesize various biological macromolecules (such as proteins, nucleic acids, and lipids). Klebsiella pneumoniae can efficiently synthesize important chemicals such as 2,3-butanediol, lactic acid, and ethanol from glucose. However, bacteria of the genus Klebsiella cannot synthesize 1,3-propanediol using glucose or other sugary raw materials as a carbon source. Currently, no bacteria or microorganisms in nature have been found that can produce 1,3-propanediol from glucose or other sugary raw materials. Summary of the Invention

[0006] To address the aforementioned technical problems, this application provides a modified bacterial strain, including *Klebsiella*, capable of producing 1,3-propanediol from glycerol. It also provides a method for producing 1,3-propanediol from a mixed carbon source consisting of glycerol and glucose, as well as its application in this process.

[0007] Glucose and other carbohydrates are metabolized in cells via glycolysis. This metabolism can synthesize dihydroxyacetone phosphate (DHP), but in bacteria such as *Klebsiella*, DHP cannot be converted to dihydroxyacetone or glycerol, and therefore cannot be used for the synthesis of 1,3-propanediol. When culturing *Klebsiella* using a mixed carbon source of glycerol and glucose, the bacteria preferentially utilize glucose. Only after glucose is depleted will the strain utilize glycerol.

[0008] This application provides a method for preparing 1,3-propanediol, which involves culturing a production strain in a culture medium. The production strain is a starting strain modified by inactivating the large subunit of dihydroxyacetone kinase.

[0009] This application also provides the production strain used in the above method.

[0010] This application also provides the use of the above-mentioned production strain in the preparation of 1,3-propanediol.

[0011] This application provides a modified 1,3-propanediol producing bacterium, wherein the 1,3-propanediol producing bacterium is a Klebsiella spp. bacterium that inactivates the large subunit of dihydroxyacetone kinase II.

[0012] This application also provides a modified Klebsiella bacteria, wherein the Klebsiella bacteria inactivate the large subunit of dihydroxyacetone kinase.

[0013] This application also provides a modified Klebsiella bacteria, which in addition to inactivating dihydroxyacetone kinase, also inactivates glycerol kinase.

[0014] This application also provides a modified Klebsiella bacteria, which, in addition to inactivating dihydroxyacetone kinase, also inactivates phosphotransferase or glucose-6-phosphate isomerase.

[0015] This application also provides a modified Klebsiella bacteria, which, in addition to inactivating dihydroxyacetone kinase, also inactivates glycerol kinase, phosphotransferase, or glucose-6-phosphate isomerase.

[0016] This application also provides the use of the above-mentioned Klebsiella bacteria in the preparation of 1,3-propanediol.

[0017] This application also provides a method for preparing 1,3-propanediol, using a culture medium to culture the above-mentioned Klebsiella bacteria.

[0018] This application also provides a method for preparing 1,3-propanediol, which involves culturing the modified Klebsiella bacteria using a mixed carbon source medium containing sugary raw materials such as glycerol and glucose.

[0019] The beneficial effects of this application include, but are not limited to: This application modifies 1,3-propanediol-producing bacteria such as *Klebsiella* by inactivating the large subunit of dihydroxyacetone kinase II and glycerol kinase. When these modified *Klebsiella* bacteria are fermented using a mixture of glucose and other carbohydrate carbon sources and glycerol, glycerol can be efficiently converted to 1,3-propanediol, which then accumulates in the fermentation broth. This application also modifies 1,3-propanediol-producing bacteria such as *Klebsiella* by inactivating the large subunit of dihydroxyacetone kinase II, phosphotransferase, and glycerol kinase. When these modified *Klebsiella* bacteria are fermented using a mixture of glucose and other carbohydrate carbon sources and glycerol, glycerol can be efficiently converted to 1,3-propanediol, which then accumulates in the fermentation broth. This application modifies 1,3-propanediol-producing bacteria, such as Klebsiella, by inactivating the large subunit of dihydroxyacetone kinase II, glucose-6-phosphate isomerase, and glycerol kinase. The modified Klebsiella and other 1,3-propanediol-producing bacteria, when fermented with a mixed carbon source of glucose or other sugars and glycerol, can convert the vast majority of glycerol into 1,3-propanediol with less consumption of glucose or other sugars. The method provided in this application effectively improves the conversion efficiency of glycerol to 1,3-propanediol in 1,3-propanediol-producing bacteria. Detailed Implementation

[0020] As indicated in this specification and claims, unless the context clearly indicates otherwise, the words "a," "an," "an," and / or "the" do not specifically refer to the singular and may also include the plural. Generally speaking, the terms "comprising" and "including" only indicate the inclusion of expressly identified steps and elements, which do not constitute an exclusive list, and the method or apparatus may also include other steps or elements.

[0021] This application provides a method for preparing 1,3-propanediol, which involves culturing a production strain in a culture medium. The production strain is a starting strain modified by inactivating the large subunit of dihydroxyacetone kinase.

[0022] In some embodiments, the production strain may knock out, knock down, or silence the dhaM gene fragment.

[0023] In some embodiments, the dihydroxyacetone kinase may be dihydroxyacetone kinase II.

[0024] In some embodiments, the producing strain may also inactivate glycerol kinase.

[0025] In some embodiments, the producing strain can inactivate not only the large subunit of dihydroxyacetone kinase but also glycerol kinase.

[0026] In some embodiments, the production strain can inactivate not only the large subunit of dihydroxyacetone kinase, but also phosphotransferase or glucose-6-phosphate isomerase.

[0027] In some embodiments, the production strain may also knock out, knock down, or silence the glpK gene fragment.

[0028] In some embodiments, the production strain can knock out, knock down, or silence the dhaM gene fragment, and can also knock out, knock down, or silence the glpK gene fragment.

[0029] In some embodiments, the production strain may also knock out, knock down, or silence ptsG or pgi gene fragments.

[0030] In some embodiments, the production strain may knock out, knock down, or silence the dhaM gene fragment, as well as the ptsG or pgi gene fragment.

[0031] In some embodiments, the production strain may be selected from Klebsiella bacteria.

[0032] In some embodiments, the starting strain may be a strain capable of producing 1,3-propanediol using glycerol as a raw material.

[0033] In some embodiments, the method may use a culture medium containing a mixture of saccharide raw materials and glycerol as a carbon source to culture the production strain.

[0034] In some embodiments, the culture temperature can be 30–40°C. In some embodiments, preferably, the culture temperature can be 37°C.

[0035] In some embodiments, the rotation speed during cultivation can be 100–200 rpm. In some embodiments, preferably, the rotation speed during cultivation can be 150 rpm.

[0036] In some embodiments, the pH of the culture medium may be 6.5 to 7.5.

[0037] In some embodiments, the culture medium may include a glycerol culture medium or a mixed carbon source culture medium. In some embodiments, preferably, the glycerol culture medium includes, in addition to water, any one or more of glycerol, ammonium sulfate, yeast extract, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, magnesium sulfate, ferrous sulfate, or manganese sulfate. In some embodiments, preferably, the mixed carbon source culture medium may also include, in addition to water, a saccharide carbon source, glycerol, ammonium sulfate, yeast extract, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, magnesium sulfate, ferrous sulfate, or manganese sulfate. In some embodiments, more preferably, the saccharide carbon source may include any one or more of glucose, xylose, or lignocellulose hydrolysate. In some embodiments, more preferably, the saccharide carbon source may be glucose.

[0038] In some embodiments, preferably, the glycerol culture medium contains 10-30 g / L glycerol, 2-6 g / L ammonium sulfate, 1-2 g / L yeast extract, 0.2-2 g / L dipotassium hydrogen phosphate, 0.1-5 g / L potassium dihydrogen phosphate, 0.1-0.3 g / L magnesium sulfate, 0.03-0.07 g / L ferrous sulfate, and 0.005-0.015 g / L manganese sulfate. In some embodiments, preferably, the glycerol culture medium contains 20 g / L glycerol, 4 g / L ammonium sulfate, 1.5 g / L yeast extract, 0.69 g / L dipotassium hydrogen phosphate, 0.25 g / L potassium dihydrogen phosphate, 0.2 g / L magnesium sulfate, 0.05 g / L ferrous sulfate, and 0.01 g / L manganese sulfate.

[0039] In some embodiments, preferably, the mixed carbon source culture medium contains 10-30 g / L of saccharide carbon source, 10-30 g / L of glycerol, 2-6 g / L of ammonium sulfate, 1-2 g / L of yeast extract, 0.2-2 g / L of dipotassium hydrogen phosphate, 0.1-5 g / L of potassium dihydrogen phosphate, 0.1-0.3 g / L of magnesium sulfate, 0.03-0.07 g / L of ferrous sulfate, and 0.005-0.015 g / L of manganese sulfate. In some embodiments, preferably, the mixed carbon source culture medium contains 20 g / L of saccharide carbon source, 20 g / L of glycerol, 4 g / L of ammonium sulfate, 1.5 g / L of yeast extract, 0.69 g / L of dipotassium hydrogen phosphate, 0.25 g / L of potassium dihydrogen phosphate, 0.2 g / L of magnesium sulfate, 0.05 g / L of ferrous sulfate, and 0.01 g / L of manganese sulfate.

[0040] This application also provides the production strain used in the above method.

[0041] This application also provides the use of the above-mentioned production strain in the preparation of 1,3-propanediol.

[0042] In some embodiments, the producing strain can prepare 1,3-propanediol using a mixed carbon source of glycerol and sugar raw materials.

[0043] This application provides a modified 1,3-propanediol-producing bacterium, wherein the 1,3-propanediol-producing bacterium is a Klebsiella spp., and the modification is an inactivated strain of dihydroxyacetone kinase II large subunit.

[0044] This application provides a modified Klebsiella bacteria, wherein the Klebsiella bacteria inactivate the large subunit of dihydroxyacetone kinase.

[0045] In some embodiments, the Klebsiella bacteria can knock out, knock down, or silence the dhaM gene fragment.

[0046] In some embodiments, the Klebsiella bacteria may be selected from, but not limited to, Klebsiella pneumoniae, Klebsiella acidogenic bacteria, or Klebsiella variegata.

[0047] In some embodiments, the dihydroxyacetone kinase may be dihydroxyacetone kinase II.

[0048] In some embodiments, the *Klebsiella* bacteria can inactivate the large subunit of dihydroxyacetone kinase. In some embodiments, the dihydroxyacetone kinase can be phosphoenolpyruvate (PEP)-dependent dihydroxyacetone kinase II, a complex encoded by DhaK, DhaL, and DhaM. The inactivation of the large subunit of dihydroxyacetone kinase refers to strains that inactivate the protein encoded by the dhaM gene. Its gene reading frame in the *Klebsiella* genome (GenBank: CP000964.1; NC_011283) is shown in SEQ ID NO.1, and its amino acid sequence is numbered in GenBank (ACI06958.1).

[0049] SEQ ID NO.1:

[0050]

[0051] This application also provides a modified Klebsiella bacteria, which, in addition to inactivating the large subunit of dihydroxyacetone kinase II, also inactivates phosphotransferase or glucose-6-phosphate isomerase.

[0052] Phosphotransferases are proteins belonging to the phosphotransfer system (PTS), encoding the IIBC component of the glucose-specific PTS system. Phosphotransferase inactivation refers to strains in which the protein encoded by the ptsG gene is inactivated. Its gene reading frame in the Klebsiella pneumoniae genome is shown in SEQ ID NO.2, and its amino acid sequence is numbered in GenBank (ACI1024.1).

[0053] SEQ ID NO.2:

[0054]

[0055] Glucose-6-phosphate isomerase is an enzyme that catalyzes the conversion between glucose-6-phosphate and fructose-6-phosphate, and its encoding gene is named pgi. Its gene reading frame in the Klebsiella pneumoniae genome is shown in SEQ ID NO.3, and its amino acid sequence is numbered in GenBank (ACI10999.1).

[0056] SEQ ID NO.3:

[0057]

[0058] This application also provides a modified Klebsiella bacteria, which, in addition to inactivating dihydroxyacetone kinase, also inactivates phosphotransferase or glucose-6-phosphate isomerase.

[0059] In some embodiments, the dihydroxyacetone kinase may be dihydroxyacetone kinase II.

[0060] In some embodiments, the Klebsiella bacteria can inactivate the large subunit of dihydroxyacetone kinase.

[0061] In some embodiments, the Klebsiella bacteria may also inactivate glycerol kinase.

[0062] Glyceryl kinase is an enzyme that catalyzes the conversion of glycerol to glycerol-3-phosphate, and the gene encoding it is named glpK. Its gene reading frame in the genome of Klebsiella pneumoniae is shown in SEQ ID NO.4, and its amino acid sequence is numbered in GenBank (ACI1010708.1).

[0063] SEQ ID NO.4:

[0064]

[0065] In some embodiments, the Klebsiella bacteria may be selected from any one of Klebsiella pneumoniae, Klebsiella acidogenic bacteria, or Klebsiella variegata.

[0066] In some embodiments, the Klebsiella bacteria can knock out, knock down, or silence the dhaM gene fragment, as well as the ptsG or pgi gene fragment.

[0067] In some embodiments, the Klebsiella bacteria may also knock out, knock down, or silence the glpK gene fragment.

[0068] This application also provides the use of the above-mentioned Klebsiella bacteria in the preparation of 1,3-propanediol.

[0069] In some embodiments, the Klebsiella bacteria can prepare 1,3-propanediol using a mixture of glycerol and sugar raw materials as a carbon source.

[0070] This application also provides a method for preparing 1,3-propanediol, using a culture medium to culture the above-mentioned Klebsiella bacteria.

[0071] In some embodiments, the method may use a culture medium containing a mixture of sugary raw materials and glycerol as a carbon source to culture the Klebsiella bacteria.

[0072] In some embodiments, the culture temperature can be 30–40°C. For example, the culture temperature can be approximately 30, 32, 34, 36, 38, or 40°C. Any range characterized by combinations of the above values ​​is also included, which will not be elaborated here. In some embodiments, preferably, the culture temperature can be 37°C.

[0073] In some embodiments, the rotation speed during cultivation can be 100–200 rpm. For example, the rotation speed during cultivation can be 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 rpm. Any range characterized by combinations of the above values ​​is also included, which will not be elaborated here. In some embodiments, preferably, the rotation speed during cultivation can be 150 rpm.

[0074] In some embodiments, the pH of the culture medium can be 6.5 to 7.5. For example, the pH of the culture medium can be 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, or 7.5. Any range characterized by combinations of the above-mentioned extreme values ​​is also included, which will not be elaborated here.

[0075] In some embodiments, the culture medium may include a glycerol culture medium or a mixed carbon source culture medium. In some embodiments, preferably, the glycerol culture medium may include, in addition to water, any one or more of glycerol, ammonium sulfate, yeast extract, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, magnesium sulfate, ferrous sulfate, or manganese sulfate.

[0076] In some embodiments, preferably, the mixed carbon source culture medium may include, in addition to water, any one or more of the following: a saccharide carbon source, glycerol, ammonium sulfate, yeast extract, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, magnesium sulfate, ferrous sulfate, or manganese sulfate. In some embodiments, more preferably, the saccharide carbon source may include any one or more of glucose, xylose, or lignocellulose hydrolysate. In some embodiments, even more preferably, the saccharide carbon source may be glucose.

[0077] In some embodiments, the concentrations of each component in the glycerol culture medium are as follows:

[0078] Glycerin 10–30 g / L, for example, 12–28 g / L, 14–26 g / L, 16–24 g / L, 18–22 g / L, 20–22 g / L;

[0079] Ammonium sulfate 2-6 g / L, for example 3-5 g / L, 4-5 g / L;

[0080] Yeast extract 1-2 g / L, for example, 1.2-1.8 g / L, 1.4-1.6 g / L;

[0081] Dipotassium hydrogen phosphate: 0.2–2 g / L, for example, 0.4–1.8 g / L, 0.6–1.6 g / L, 0.8–1.4 g / L, 1.0–1.2 g / L;

[0082] Potassium dihydrogen phosphate: 0.1–5 g / L, for example, 0.15–0.45 g / L, 0.20–0.40 g / L, 0.25–0.35 g / L, 0.30–0.35 g / L;

[0083] Magnesium sulfate 0.1–0.3 g / L, for example, 0.12–0.28 g / L, 0.14–0.26 g / L, 0.16–0.24 g / L, 0.18–0.22 g / L, 0.20–0.22 g / L;

[0084] Ferrous sulfate 0.03–0.07 g / L, for example, 0.04–0.06 g / L, 0.05–0.06 g / L;

[0085] Manganese sulfate 0.005~0.015g / L, for example, 0.007~0.013g / L, 0.009~0.011g / L.

[0086] In some embodiments, preferably, the glycerol culture medium contains 20 g / L glycerol, 4 g / L ammonium sulfate, 1.5 g / L yeast extract, 0.69 g / L dipotassium hydrogen phosphate, 0.25 g / L potassium dihydrogen phosphate, 0.2 g / L magnesium sulfate, 0.05 g / L ferrous sulfate, and 0.01 g / L manganese sulfate.

[0087] In some embodiments, the mixed carbon source culture medium contains 10–80 g / L of sugar carbon source, or added glucose, 10–30 g / L of glycerol, or added glycerol, 2–6 g / L of ammonium sulfate, 1–2 g / L of yeast extract, 0.2–2 g / L of dipotassium hydrogen phosphate, 0.1–5 g / L of potassium dihydrogen phosphate, 0.1–0.3 g / L of magnesium sulfate, 0.03–0.07 g / L of ferrous sulfate, and 0.005–0.015 g / L of manganese sulfate.

[0088] In some embodiments, preferably, the mixed carbon source culture medium contains 10-30 g / L of sugar carbon source, 10-30 g / L of glycerol, 2-6 g / L of ammonium sulfate, 1-2 g / L of yeast extract, 0.2-2 g / L of dipotassium hydrogen phosphate, 0.1-5 g / L of potassium dihydrogen phosphate, 0.1-0.3 g / L of magnesium sulfate, 0.03-0.07 g / L of ferrous sulfate, and 0.005-0.015 g / L of manganese sulfate.

[0089] In some embodiments, the concentrations of each component in the mixed carbon source culture medium are as follows:

[0090] Carbohydrate carbon source 10-30 g / L, for example 12-28 g / L, 14-26 g / L, 16-24 g / L, 18-22 g / L, 20-22 g / L;

[0091] Glycerin 10–30 g / L, for example, 12–28 g / L, 14–26 g / L, 16–24 g / L, 18–22 g / L, 20–22 g / L;

[0092] Ammonium sulfate 2-6 g / L, for example 3-5 g / L, 4-5 g / L;

[0093] Yeast extract 1-2 g / L, for example, 1.2-1.8 g / L, 1.4-1.6 g / L;

[0094] Dipotassium hydrogen phosphate: 0.2–2 g / L, for example, 0.4–1.8 g / L, 0.6–1.6 g / L, 0.8–1.4 g / L, 1.0–1.2 g / L;

[0095] Potassium dihydrogen phosphate: 0.1–5 g / L, for example, 0.15–0.45 g / L, 0.20–0.40 g / L, 0.25–0.35 g / L, 0.30–0.35 g / L;

[0096] Magnesium sulfate 0.1–0.3 g / L, for example, 0.12–0.28 g / L, 0.14–0.26 g / L, 0.16–0.24 g / L, 0.18–0.22 g / L, 0.20–0.22 g / L;

[0097] Ferrous sulfate 0.03–0.07 g / L, for example, 0.04–0.06 g / L, 0.05–0.06 g / L;

[0098] Manganese sulfate 0.005~0.015g / L, for example, 0.007~0.013g / L, 0.009~0.011g / L.

[0099] In some embodiments, preferably, the mixed carbon source culture medium contains 20 g / L of saccharide carbon source, or fed saccharide carbon source, 20 g / L of glycerol, or fed glycerol, 4 g / L of ammonium sulfate, 1.5 g / L of yeast extract, 0.69 g / L of dipotassium hydrogen phosphate, 0.25 g / L of potassium dihydrogen phosphate, 0.2 g / L of magnesium sulfate, 0.05 g / L of ferrous sulfate, and 0.01 g / L of manganese sulfate.

[0100] In some embodiments, preferably, the mixed carbon source culture medium contains 20 g / L of sugar carbon source, 20 g / L of glycerol, 4 g / L of ammonium sulfate, 1.5 g / L of yeast extract, 0.69 g / L of dipotassium hydrogen phosphate, 0.25 g / L of potassium dihydrogen phosphate, 0.2 g / L of magnesium sulfate, 0.05 g / L of ferrous sulfate, and 0.01 g / L of manganese sulfate.

[0101] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were all purchased from conventional biochemical reagent companies. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0102] Unless otherwise specified, all reagents and biological materials used below are commercial products.

[0103] Example 1

[0104] A Klebsiella strain with the large subunit gene of dihydroxyacetone kinase knocked out was constructed using gene recombination to achieve the inactivation of dihydroxyacetone kinase.

[0105] Klebsiella pneumoniae strain CGMCC 1.6366 (also known as TUAC01, AC01) has been published in the literature (Journal of Microbiology & Biotechnology. 2012 39:1219-1226). This strain is used to produce 1,3-propanediol, 2,3-butanediol, acetoin, and 2-ketogluconic acid. This strain was isolated from soil; the isolation process and morphological description can be found in (World Journal of Microbiology & Biotechnology 2008, 24:1731-1740).

[0106] The Klebsiella pneumoniae M5a1 strain has been published in the literature (Appl Environ Microbiol 1991,57:2810–2815, Journal of Microbiology & Biotechnology.2012 39:1219-1226, Biotechnolog y Reports 17(2018)6–9).

[0107] Klebsiella pneumoniae S12 is a strain isolated and preserved by our unit, and has been disclosed in patents (ZL202110474528.2, ZL 202110060193.X, ZL 202010420345.8).

[0108] By using gene recombination to knock out the dhaM gene, the large subunit of dihydroxyacetone kinase, a Klebsiella strain with inactivated large subunit of dihydroxyacetone kinase was constructed.

[0109] 1) Amplification of the long homologous arm gene sequences at both ends of the dhaM gene and the resistance fragment gene sequence. Using specific primers, dhaM-up-s: CTGCAGGACGATGAAATGGAGT (SEQ ID No. 5), dhaM-up-a: GTC GACGGATCCCCGGAATGGGCGCTATGAGAAACAATAACC (SEQ ID No. 6), dhaM-down-s: CGAAGCAGCTCCAGCCTACAAGGGCGAGGCGCTGAACAGC (SEQ ID No. 7), and dhaM-down-a: GTTGGCCGAAGGCGTAAAGT (SEQ ID No. 8), and using Klebsiella pneumoniae CGMCC 1.6366 genomic DNA as a template, the upstream and downstream DNA sequences of the dhaM gene were obtained by PCR amplification. Using FRT-s: TGTAGGCTGGAGCTGCT TCG (SEQ ID No. 9) and FRT-a: ATTCCGGGGATCCGTCGAC (SEQ ID No. 10) as specific primers, PCR amplification was performed using PIJ773 plasmid (commercial product) as template to obtain the aac(3)IV gene fragment containing FRT sites at both ends and apramycin resistance in the middle.

[0110] 2) Recombination ligation of gene fragments: Using the ClonExpress Ultra One Step Cloning Kit, the three DNA fragments obtained in step 1) were ligated into one fragment. The resulting linear DNA fragment A has homologous arms of the upstream sequence of the dhaM gene at both ends and the apramycin resistance gene in the middle.

[0111] 3) The prepared DNA fragment A was transformed into Klebsiella pneumoniae CGMCC1.6366. DNA fragment A underwent homologous recombination with the dhaM gene on the chromosome. Strains with chromosome dihydroxyacetone kinase large subunit recombination inactivation were obtained by screening. The specific steps are as follows:

[0112] Linear DNA fragment A was electroporated into competent cells of strain CGMCC1.6366-pDK6-red. Resistant strains were screened using apramycin, and the resulting resistant strain was named Kp-ΔdhaM-pDK6-red. The large subunit gene of dihydroxyacetone kinase in this strain was knocked out through homologous recombination.

[0113] 4) Elimination of pDK6-red plasmid in the strain. The strain Kp-ΔdhaM-pDK6-red was inoculated into LB test tube medium, passaged, and isolated by streaking on antibiotic-free solid LB medium plates. Colonies that could grow on antibiotic-free plates but could not grow on kanamycin-resistant plates were selected. These were the mutant strains in which the pDK6-red plasmid was eliminated. The obtained strain was named Kp-ΔdhaM-aac(3)IV.

[0114] 5) Elimination of aac(3)IV resistance in the strain. After transforming the pDK6-flp plasmid into the strain Kp-ΔdhaM-aac(3)IV, the strain was inoculated into LB test tube medium, passaged, and isolated by streaking on antibiotic-free solid LB medium plates. Colonies that could grow on antibiotic-free plates but could not grow on plates containing apramycin resistance were selected. These were the mutant strains in which aac(3)IV resistance had been eliminated, and the obtained strains were named Kp-ΔdhaM-flp.

[0115] 6) Elimination of the pDK6-flp plasmid in the strain. The strain Kp-ΔdhaM-flp was inoculated into LB test tube medium, passaged, and isolated by streaking on antibiotic-free solid LB agar plates. Colonies that could grow on antibiotic-free plates but could not grow on kanamycin-resistant plates were selected. These were the mutant strains in which the pDK6-flp plasmid was eliminated, and the obtained strains were named Kp-ΔdhaM.

[0116] Using the same method, Ko-ΔdhaM strain and Kv-ΔdhaM strain were constructed from Klebsiella acidogenetic strain M5a1 and Klebsiella variegata strain S12, respectively.

[0117] Example 2

[0118] By using gene recombination to knock out the phosphotransferase ptsG gene, a Klebsiella strain with inactivated dihydroxyacetone kinase large subunit and phosphotransferase was constructed.

[0119] 1) Amplification of upstream and downstream gene fragments of the knocked-out phosphotransferase gene (ptsG). Using Klebsiella pneumoniae CGMCC 1.6366 as a template, PCR amplification was performed using primers ptsG-up-s (SEQ ID No. 11), ptsG-up-a (SEQ ID No. 12), ptsG-down-s (SEQ ID No. 13), and ptsG-down-a (SEQ ID No. 14), respectively, to obtain the upstream and downstream fragment sequences of the ptsG gene.

[0120] SEQ ID No. 11:

[0121] CCTGCTGCGCTGGGAACATT

[0122] SEQ ID No. 12:

[0123] GTCGACGGATCCCCGGAATGCCGACCTTCTGCAGGTTAGCA

[0124] SEQ ID No. 13:

[0125] CGAAGCAGCTCCAGCCTACAGTAACAGTTAAGACGTAGTATCGG

[0126] SEQ ID No. 14:

[0127] TGGCTGTGACGGGACGGATG

[0128] 2) The upstream and downstream fragments of the ptsG gene were ligated to the resistance fragment. Using the ClonExpress Ultra One Step Cloning Kit, the two DNA fragments obtained from step 1) were ligated to the aac(3)IV gene fragment with apramycin resistance amplified in Example 1 to form a single fragment. The ligation yielded linear DNA fragment B, which has homologous arms of the upstream sequence of the ptsG gene at both ends and contains the apramycin resistance gene in the middle.

[0129] 3) The prepared DNA fragment B was transformed into Kp-ΔdhaM containing pDK6-red. DNA fragment B underwent homologous recombination with the ptsG gene on the chromosome, and strains with ptsG knockout on the chromosome were screened. The specific steps are as follows:

[0130] Linear DNA fragment B was electroporated into competent cells of the Kp-ΔdhaM strain containing pDK6-red. Resistant strains were screened using apramycin, and the resulting resistant strain was named Kp-ΔdhaMΔptsG-pDK6-red. The ptsG gene in this strain was knocked out through homologous recombination.

[0131] 4) Elimination of pDK6-red plasmid in the strain. The strain Kp-ΔdhaMΔptsG-pDK6-red was inoculated into LB test tube medium, passaged, and isolated by streaking on antibiotic-free solid LB medium plates. Colonies that could grow on antibiotic-free plates but could not grow on kanamycin-resistant plates were selected. These were the mutant strains in which the pDK6-red plasmid was eliminated. The obtained strain was named Kp-ΔdhaMΔptsG-aac(3)IV.

[0132] 5) Elimination of aac(3)IV resistance in the strain. After transforming the pDK6-flp plasmid into the strain Kp-ΔdhaMΔptsG-aac(3)IV, the strain was inoculated into LB test tube medium and passaged. Colonies were streaked on antibiotic-free solid LB medium plates and selected from those that could grow on antibiotic-free plates but could not grow on plates containing apramycin resistance. These were the mutant strains in which aac(3)IV resistance had been eliminated, and the obtained strains were named Kp-ΔdhaMΔptsG-flp.

[0133] 6) Elimination of the pDK6-flp plasmid in the strain. The strain Kp-ΔdhaMΔptsG-flp was inoculated into LB broth and passaged. Colonies were streaked onto antibiotic-free solid LB agar plates. Colonies that could grow on antibiotic-free plates but not on kanamycin-resistant plates were selected. These were the mutant strains in which the pDK6-flp plasmid had been eliminated, and the obtained strains were named Kp-ΔdhaMΔptsG.

[0134] Using the same method, Ko-ΔdhaMΔptsG and Kv-ΔdhaMΔptsG strains were constructed, respectively, with Ko-ΔdhaM and Kv-ΔdhaM as the starting strains.

[0135] Example 3

[0136] By using gene recombination to knock out the glycerol kinase glpK gene, a Klebsiella strain with inactivated dihydroxyacetone kinase large subunit and glycerol kinase was constructed.

[0137] 1) Amplification of upstream and downstream gene fragments of the knocked-out glycerol kinase gene (glpK). Using Klebsiella pneumoniae CG MCC1.6366 as a template, PCR amplification was performed using primers glpK-up-s (SEQ ID No. 15), glpK-up-a (SEQ ID No. 16), glpK-down-s (SEQ ID No. 17), and glpK-down-a (SEQ ID No. 18), respectively, to obtain the upstream and downstream fragment sequences of the glpK gene.

[0138] SEQ ID No. 15:

[0139] GGCGATCGCGTCGACGTCGT

[0140] SEQ ID No. 16:

[0141] GTCGACGGATCCCCGGAATGGGTCATAGTCGGTGTCCCGTA

[0142] SEQ ID No. 17:

[0143] CGAAGCAGCTCCAGCCTACACGACGAAGCGTAAGATTGTTGA

[0144] SEQ ID No. 18:

[0145] GCCCCAGGCTTTGATCTGAA

[0146] 2) The upstream and downstream fragments of the glpK gene were ligated to the resistance fragment. Using the ClonExpress Ultra One Step Cloning Kit, the two DNA fragments obtained in step 1) were ligated to the aac(3)IV gene fragment with apramycin resistance amplified in Example 1 to form a single fragment. The ligation yielded a linear DNA fragment C, which has homologous arms of the upstream sequence of the glpK gene at both ends and contains the apramycin resistance gene in the middle.

[0147] 3) The prepared DNA fragment C was transformed into the Kp-ΔdhaM (Kp-ΔdhaM-pDK6-red) containing pDK6-red constructed in Example 1. The DNA fragment C underwent homologous recombination with the glpK gene on the chromosome, and strains with glpK knockout on the chromosome were screened. The specific steps are as follows:

[0148] Linear DNA fragment C was electroporated into competent cells of strain Kp-ΔdhaM-pDK6-red. Resistant strains were screened using apramycin, and the resulting resistant strain was named Kp-ΔdhaMΔglpK-pDK6-red. The glpK gene in this strain was knocked out through homologous recombination.

[0149] 4) Elimination of pDK6-red plasmid in the strain. The strain Kp-ΔdhaMΔglpK-pDK6-red was inoculated into LB test tube medium, passaged, and isolated by streaking on antibiotic-free solid LB medium plates. Colonies that could grow on antibiotic-free plates but could not grow on kanamycin-resistant plates were selected. These were the mutant strains in which the pDK6-red plasmid was eliminated. The obtained strain was named Kp-ΔdhaMΔglpK-aac(3)IV.

[0150] 5) Elimination of aac(3)IV resistance in the strain. After transforming the pDK6-flp plasmid into the strain Kp-ΔdhaMΔglpK-aac(3)IV, the strain was inoculated into LB test tube medium and passaged. Colonies were streaked on antibiotic-free solid LB medium plates and selected from those that could grow on antibiotic-free plates but could not grow on plates containing apramycin resistance. These were the mutant strains in which aac(3)IV resistance had been eliminated, and the obtained strains were named Kp-ΔdhaMΔglpK-flp.

[0151] 6) Elimination of the pDK6-flp plasmid in the strain. The strain Kp-ΔdhaMΔglpK-flp was inoculated into LB broth and passaged. Colonies were streaked onto antibiotic-free solid LB agar plates. Colonies that could grow on antibiotic-free plates but not on kanamycin-resistant plates were selected. These were the mutant strains in which the pDK6-flp plasmid had been eliminated, and the obtained strains were named Kp-ΔdhaMΔglpK.

[0152] Using the same method, Ko-ΔdhaMΔglpK strain and Kv-ΔdhaMΔglpK strain were constructed from Ko-ΔdhaM and Kv-ΔdhaMΔglpK strains, respectively.

[0153] Example 4

[0154] By using gene recombination to knock out the glycerol kinase glpK gene, a Klebsiella strain with inactivated dihydroxyacetone kinase large subunit, phosphotransferase, and glycerol kinase was constructed.

[0155] Using the same steps as in Example 3, Kp-ΔdhaMΔpts G(Kp-ΔdhaMΔptsG-pDK6-red) containing pDK6-red was used to replace Kp-ΔdhaM(Kp-ΔdhaM-pDK6-red) containing pDK6-red in Example 3 to obtain Kp-ΔdhaMΔptsGΔglpK.

[0156] Using the same method, Ko-ΔdhaMΔptsG and Kv-ΔdhaMΔptsGΔglpK strains were constructed from Ko-ΔdhaMΔptsG and Kv-ΔdhaMΔptsGΔglpK strains, respectively.

[0157] Example 5

[0158] By using gene recombination to knock out the glucose-6-phosphate isomerase gene, a Klebsiella strain with inactivated dihydroxyacetone kinase large subunit and glucose-6-phosphate isomerase was constructed.

[0159] 1) Amplification of upstream and downstream gene fragments of the knockout gene (pgi). Using Klebsiella pneumoniae CGMCC 1.6366 as a template, PCR amplification was performed using primers pgi-up-s (SEQ ID No. 19), pgi-up-a (SEQ ID No. 20), pgi-down-s (SEQ ID No. 21), and pgi-down-a (SEQ ID No. 22), respectively, to obtain the upstream and downstream fragment sequences of the pgi gene.

[0160] SEQ ID No. 19:

[0161] GAACTGGATCTGGCGCAGAGC

[0162] SEQ ID No. 20:

[0163] GTCGACGGATCCCCGGAATGCAATACTCTTCTGATTTGAGATTGTG

[0164] SEQ ID No. 21:

[0165] CGAAGCAGCTCCAGCCTACAACGCTTGCGCCGTTAAGAC

[0166] SEQ ID No. 22:

[0167] CCGAAAGGCATTGCCCGAG

[0168] 2) The upstream and downstream fragments of the pgi gene were ligated to the resistance fragment. Using the ClonExpress Ultra One Step Cloning Kit, the two DNA fragments obtained from step 1) were ligated to the aac(3)IV gene fragment with apramycin resistance amplified in Example 1 to form a single fragment. The ligation yielded a linear DNA fragment D, which had homologous arms of the upstream sequence of the pgi gene at both ends and contained the apramycin resistance gene in the middle.

[0169] 3) Kp-ΔdhaM strain competent cells containing pDK6-red were transformed using linear DNA fragment D via electroporation. Resistant strains were screened using apramycin, and the resulting resistant strain was named Kp-ΔdhaMΔpgi-pDK6-red. The pgi gene in this strain was knocked out through homologous recombination.

[0170] 4) Elimination of the pDK6-red plasmid in the strain. The strain Kp-ΔdhaMΔpgi-pDK6-red was inoculated into LB broth and passaged. Colonies were streaked onto antibiotic-free solid LB agar plates. Colonies that grew on antibiotic-free plates but not on kanamycin-resistant plates were selected; these were the mutant strains with the pDK6-red plasmid eliminated. The obtained strain was named Kp-ΔdhaMΔpgi-aac(3)IV. The tool plasmid and resistance were eliminated using the same method as in Example 1 to obtain Kp-ΔdhaMΔpgi.

[0171] Using the same method, Ko-ΔdhaMΔpgi strain and Kv-ΔdhaMΔpgi strain were constructed using Ko-ΔdhaM and Kv-ΔdhaM as the starting strains, respectively.

[0172] Example 6

[0173] By using gene recombination to knock out the phosphotransferase glpK gene, a Klebsiella strain with inactivated dihydroxyacetone kinase large subunit, glucose-6-phosphate isomerase, and glycerol kinase was constructed.

[0174] Using the same method as in Example 3, the glpK gene of the strain was knocked out by replacing Kp-ΔdhaM with Kp-ΔdhaMΔpgi, resulting in the Kp-ΔdhaMΔpgiΔglpK strain. The Ko-ΔdhaMΔpgiΔglpK and Kv-ΔdhaMΔpgiΔglpK strains were constructed using the same method.

[0175] Example 7

[0176] The modified Klebsiella pneumoniae strains obtained in Examples 1-4 were inoculated into 250ml Erlenmeyer flasks containing 50ml of fermentation medium. Fermentation was carried out in a shaker at 150 rpm and a constant temperature of 37°C.

[0177] The glycerol culture medium consisted of: glycerol 20 g / L, ammonium sulfate 4 g / L, yeast extract 1.5 g / L, dipotassium hydrogen phosphate 0.69 g / L, potassium dihydrogen phosphate 0.25 g / L, magnesium sulfate 0.2 g / L, ferrous sulfate 0.05 g / L, and manganese sulfate 0.01 g / L.

[0178] The mixed carbon source culture medium consisted of: glucose 20 g / L, glycerol 20 g / L, ammonium sulfate 4 g / L, yeast extract 1.5 g / L, dipotassium hydrogen phosphate 0.69 g / L, potassium dihydrogen phosphate 0.25 g / L, magnesium sulfate 0.2 g / L, ferrous sulfate 0.05 g / L, and manganese sulfate 0.01 g / L.

[0179] After 16 hours of cultivation, the components in the fermentation broth were determined by liquid chromatography (LC). The LC method employed an HP X-87H column for separation of the fermentation broth components, and detection was performed using parallax and UV detectors. The mobile phase was 0.025 mol / L sulfuric acid aqueous solution, the flow rate was 0.8 mL / min, and the column temperature was 65 °C. The results of the fermentation broth analysis are shown in Tables 1 and 2.

[0180] Table 1. Results of shake-flask fermentation experiments on glycerol medium for Klebsiella pneumoniae and its modified strains.

[0181]

[0182] Table 2. Results of shake-flask fermentation experiments of Klebsiella pneumoniae and its modified strains on mixed carbon source medium.

[0183]

[0184] Using the same method as for Klebsiella pneumoniae, the starting strains Klebsiella variegata, Klebsiella acidogenic bacteria and the modified strains obtained in Examples 1-4 were inoculated and subjected to shake-flask fermentation. The results of the fermentation broth test are shown in Tables 3 and 4.

[0185] Table 3. Results of shake-flask fermentation experiments on glycerol medium for Bacillus leukogenis, Bacillus leukogenis acidogenis, and their modified strains.

[0186]

[0187] Table 4. Results of shake-flask fermentation experiments of *Klebsiella pneumoniae*, *Klebsiella pneumoniae* acid-producing bacteria and their modified strains on mixed carbon source medium.

[0188]

[0189] In glycerol fermentation, wild-type Klebsiella bacteria can synthesize 1,3-propanediol from glycerol, with a conversion rate between 0.3 and 0.38. The engineered strain with the dhaM gene knocked out grows more slowly, but its ability to produce 1,3-propanediol from glycerol is significantly enhanced. Further knockout of the ptsG gene weakens the glycerol utilization of the strain. Further knockout of the glpK gene results in the strain being unable to utilize glycerol for growth.

[0190] In fermentation using a mixed carbon source medium, wild-type Klebsiella bacteria and kp-ΔdhaM, due to carbon metabolism repression, preferentially utilized glucose when it was present, only metabolizing glycerol when the glucose concentration was low. Wild-type Klebsiella bacteria, due to their faster growth, had already consumed all the glycerol and glucose in the medium after 16 hours of cultivation. kp-ΔdhaM, however, only began consuming glycerol after 16 hours, thus consuming only 8 g / L of glycerol. The conversion rates of glycerol to 1,3-propanediol in wild-type Klebsiella bacteria and kp-ΔdhaM strains were 0.36 mol / mol and 0.74 mol / mol, respectively. This indicates that when cultured with a mixed carbon source of glucose and glycerol, the kp-ΔdhaM strain significantly outperformed the wild-type Klebsiella bacteria in synthesizing 1,3-propanediol.

[0191] After knocking out the glpK gene, the strain can utilize both glycerol and glucose in a mixed carbon source. Furthermore, the molar conversion rate of glycerol to 1,3-propanediol in strain kp-ΔdhaMΔglpK is significantly higher than that in the wild-type strain.

[0192] After knocking out the ptsG gene, the strain could simultaneously utilize glycerol and glucose in a mixed carbon source. Furthermore, the molar conversion rates of glycerol to 1,3-propanediol in strains kp-ΔdhaMΔptsG and kp-ΔdhaMΔptsGΔglpK were significantly higher than those in the wild-type strain, at 0.85 and 0.92 mol / mol, respectively. Knockout of glpK improved the conversion rate of glycerol to 1,3-propanediol.

[0193] Klebsiella pneumoniae, Klebsiella vesiculosus, and their engineered strains exhibited the same fermentation patterns as Klebsiella pneumoniae strains in glycerol and mixed carbon source media.

[0194] Example 8

[0195] The starting strain of Klebsiella pneumoniae and the modified strains obtained in Examples 5-6 were subjected to shake-flask fermentation culture, and the culture conditions and culture medium composition were as shown in Example 6.

[0196] After 16 hours of cultivation, the components in the fermentation broth were measured, and the results of the fermentation broth for each strain are shown in Tables 5 and 6.

[0197] Table 5. Results of shake-flask fermentation experiments on glycerol medium for Klebsiella pneumoniae and its modified strains.

[0198]

[0199] Table 6. Results of shake-flask fermentation experiments of Klebsiella pneumoniae and its modified strains on mixed carbon source medium.

[0200]

[0201] Using the same method as for Klebsiella pneumoniae, the starting strains Klebsiella variegata, Klebsiella acidogenic bacteria, and the modified strains obtained in Examples 5-6 were inoculated and subjected to shake-flask fermentation. The results of the fermentation broth test are shown in Tables 7 and 8.

[0202] Table 7. Results of shake-flask fermentation experiments on glycerol medium for Bacillus leukoplakia, Bacillus leukoplakia acid-producing strains and their modified strains.

[0203]

[0204] Table 8. Results of shake-flask fermentation experiments of *Klebsiella pneumoniae*, *Klebsiella pneumoniae* acid-producing bacteria and their modified strains on mixed carbon source medium.

[0205]

[0206] In glycerol fermentation, wild-type Klebsiella bacteria can synthesize 1,3-propanediol from glycerol. Engineered strains with the dhaM gene knocked out exhibit weaker growth, but show improved conversion rates of 1,3-propanediol from glycerol. Further knockout of pgi does not significantly alter the strain's performance. Strains with glpK knockout cannot utilize glycerol for growth.

[0207] In fermentation on a mixed carbon source medium, the pgi gene knockout strain can simultaneously metabolize glucose and glycerol, while the knockout of this gene also significantly reduces the rate of glucose metabolism. Knocking out the glpK gene increases the conversion rate of glycerol to 1,3-propanediol, with a conversion rate of 0.93 mol / mol for kp-ΔdhaMΔpgiΔglpK. Klebsiella acidophilus and Klebsiella variegata and their engineered strains exhibit the same pattern.

[0208] Example 10

[0209] The engineered strain was used in a 5L fermenter fermentation experiment.

[0210] The kp-ΔdhaMΔptsGΔglpK and kp-ΔdhaMΔpgiΔglpK strains obtained in Examples 4 and 6 were inoculated into 250 mL Erlenmeyer flasks containing 50 mL of seed culture medium. Seed culture was carried out in a shaker at 150 rpm and a constant temperature of 37°C.

[0211] The seed culture medium consisted of: 10 g / L peptone, 5 g / L yeast extract, and 5 g / L sodium chloride.

[0212] The mixed carbon source fermentation medium consisted of: glucose 100 g / L, ammonium sulfate 4 g / L, yeast extract 1.5 g / L, dipotassium hydrogen phosphate 0.69 g / L, potassium dihydrogen phosphate 0.25 g / L, magnesium sulfate 0.2 g / L, ferrous sulfate 0.05 g / L, and manganese sulfate 0.01 g / L. The initial glycerol concentration in the medium was 0, and feeding was carried out during fermentation.

[0213] After 12 hours of seed culture, the seeds were inoculated into a 5L fermenter containing 1L of fermentation medium. The fermentation process was maintained with an aeration rate of 2L / min, a stirring speed of 200 rpm, and a fermentation temperature of 37℃. The pH of the fermentation broth was stabilized at 7.0 using sodium hydroxide solution. Fermentation was completed after 36 hours. The components in the fermentation broth were determined using the method shown in Example 8. The test results of the strain fermentation broth are shown in Table 9.

[0214] Table 9. Fermentation results of modified Klebsiella spp. strains in fermenters

[0215]

[0216] The data in Table 9 show that compared with kp-ΔdhaMΔptsGΔglpK, kp-ΔdhaMΔpgiΔglpK can synthesize more 1,3-propanediol, at 58.7 g / L; while kp-ΔdhaMΔptsGΔglpK has a higher conversion efficiency from glycerol to 1,3-propanediol, reaching 0.98 mol / mol.

[0217] The above embodiments of this application demonstrate that Klebsiella bacteria naturally possessing the DHA operon can improve the conversion rate of glycerol to 1,3-propanediol through the aforementioned modifications. Those skilled in the art also know that other species of Klebsiella also naturally possess the DHA operon; therefore, all species of Klebsiella can obtain the ability to improve the conversion rate of glycerol to 1,3-propanediol through the modification method of this application. Other strains naturally possessing the DHA operon also have the ability to improve the conversion rate of glycerol to 1,3-propanediol through the modification method of this application.

[0218] The basic concepts have been described above. Obviously, for those skilled in the art, the detailed disclosure above is merely illustrative and does not constitute a limitation of this specification. Although not explicitly stated herein, those skilled in the art may make various modifications, improvements, and corrections to this specification. Such modifications, improvements, and corrections are suggested in this specification and therefore remain within the spirit and scope of the exemplary embodiments described herein.

[0219] Furthermore, this specification uses specific terms to describe embodiments thereof. For example, "an embodiment," "one embodiment," and / or "some embodiments" refer to a particular feature, structure, or characteristic associated with at least one embodiment of this specification. Therefore, it should be emphasized and noted that references to "an embodiment," "one embodiment," or "an alternative embodiment" in different locations throughout this specification do not necessarily refer to the same embodiment. Moreover, certain features, structures, or characteristics in one or more embodiments of this specification can be appropriately combined.

[0220] In some embodiments, numbers describing the quantity of components and attributes are used. It should be understood that such numbers used in the description of embodiments are modified in some examples with the terms "approximately," "approximately," or "generally." Unless otherwise stated, "approximately," "approximately," or "generally" indicates that the numbers are allowed to vary by ±20%. Accordingly, in some embodiments, the numerical parameters used in the specification and claims are approximate values, which may be changed depending on the characteristics required by individual embodiments. In some embodiments, numerical parameters should take into account specified significant digits and employ a general method of digit reservation. Although the numerical ranges and parameters used to confirm their breadth of range in some embodiments of this specification are approximate values, in specific embodiments, such values ​​are set as precisely as feasible.

[0221] Finally, it should be understood that the embodiments described in this specification are merely illustrative of the principles of the embodiments described herein. Other variations may also fall within the scope of this specification. Therefore, alternative configurations of the embodiments described herein are intended to be illustrative rather than limiting, and should be considered consistent with the teachings of this specification. Accordingly, the embodiments described herein are not limited to those explicitly introduced and described herein.

Claims

1. A method for preparing 1,3-propanediol, comprising culturing a production strain in a culture medium, said production strain being a starting strain modified by inactivating the large subunit of dihydroxyacetone kinase.

2. The method as described in claim 1, characterized in that, The production strain has the dhaM gene segment knocked out, knocked down, or silenced. And / or, the dihydroxyacetone kinase is dihydroxyacetone kinase II.

3. The method as described in claim 1, characterized in that, In addition to inactivating the large subunit of dihydroxyacetone kinase, the production strain also inactivates glycerol kinase.

4. The method as described in claims 1 and 3, characterized in that, In addition to inactivating the large subunit of dihydroxyacetone kinase, the production strain also inactivates phosphotransferase or glucose-6-phosphate isomerase.

5. The method as described in claim 1, characterized in that, In addition to knocking out, knocking down, or silencing the dhaM gene fragment, the production strain also knocks out, knocks down, or silences the glpK gene fragment.

6. The method as described in claims 1 and 5, characterized in that, The production strain also knocks out, knocks down, or silences ptsG or pgi gene fragments.

7. The method as described in claim 1, characterized in that, The production strain is selected from Klebsiella bacteria; And / or, the starting strain is a strain capable of producing 1,3-propanediol using glycerol as a raw material; And / or, the method uses a culture medium containing a mixture of saccharide raw materials and glycerol as a carbon source to culture the production strain; And / or, the culture temperature is 30-40°C, preferably 37°C; And / or, the rotation speed during cultivation is 100-200 rpm, preferably 150 rpm; And / or, the pH of the culture medium is 6.5–7.5; And / or, the culture medium includes a glycerol culture medium or a mixed carbon source culture medium. Preferably, the glycerol culture medium includes, in addition to water, any one or more of glycerol, ammonium sulfate, yeast extract, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, magnesium sulfate, ferrous sulfate, or manganese sulfate. The mixed carbon source culture medium includes, in addition to water, a saccharide carbon source, glycerol, ammonium sulfate, yeast extract, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, magnesium sulfate, ferrous sulfate, or manganese sulfate. More preferably, the saccharide carbon source includes any one or more of glucose, xylose, or lignocellulose hydrolysate. More preferably, the saccharide carbon source is glucose. Preferably, the glycerol culture medium contains 10-30 g / L glycerol, 2-6 g / L ammonium sulfate, 1-2 g / L yeast extract, 0.2-2 g / L dipotassium hydrogen phosphate, 0.1-5 g / L potassium dihydrogen phosphate, 0.1-0.3 g / L magnesium sulfate, 0.03-0.07 g / L ferrous sulfate, and 0.005-0.015 g / L manganese sulfate. More preferably, the glycerol culture medium contains 20 g / L glycerol, 4 g / L ammonium sulfate, 1.5 g / L yeast extract, 0.69 g / L dipotassium hydrogen phosphate, 0.25 g / L potassium dihydrogen phosphate, 0.2 g / L magnesium sulfate, and 0.05 g / L ferrous sulfate. Manganese sulfate 0.01 g / L; Preferably, the mixed carbon source culture medium contains 10-30 g / L of sugar carbon source, 10-30 g / L of glycerol, 2-6 g / L of ammonium sulfate, 1-2 g / L of yeast extract, 0.2-2 g / L of dipotassium hydrogen phosphate, 0.1-5 g / L of potassium dihydrogen phosphate, and 0.1-0.3 g / L of magnesium sulfate. Ferrous sulfate 0.03–0.07 g / L, manganese sulfate 0.005–0.015 g / L. More preferably, the mixed carbon source culture medium contains 20 g / L of sugar carbon source, 20 g / L of glycerol, 4 g / L of ammonium sulfate, 1.5 g / L of yeast extract, 0.69 g / L of dipotassium hydrogen phosphate, 0.25 g / L of potassium dihydrogen phosphate, 0.2 g / L of magnesium sulfate, 0.05 g / L of ferrous sulfate, and 0.01 g / L of manganese sulfate.

8. The production strain in the method according to any one of claims 1 to 7.

9. The use of the production strain as described in claim 8 in the preparation of 1,3-propanediol.

10. The application as described in claim 9, characterized in that, The producing strain uses a mixture of glycerol and sugar raw materials as a carbon source to prepare 1,3-propanediol.

Images