Synthesis of specific molecular weight chondroitin sulfate by metabolic engineering of pichia pastoris

Abstract

The application discloses a method for synthesizing chondroitin sulfate with specific molecular weight by metabolic engineering of Pichia pastoris, and belongs to the technical field of metabolic engineering and synthetic biology. The application uses Pichia pastoris GS115 as a host, constructs a chondroitin synthesis pathway by heterologous expression of kfoA, kfoC and tuaD genes, realizes intracellular synthesis of chondroitin, further strengthens the supply of precursors UDP-GlcA and UDP-GalNAc and redirects carbon metabolism, and improves the yield of chondroitin to 564 mg / L, and the yield in a 5-L fermenter reaches 1.15-5.3 g / L. Further expression of chondroitin sulfate sulfotransferase C4ST and an endogenous phosphorylase system realizes synthesis of chondroitin sulfate with a molecular weight of 40-115 kDa. Finally, by integration of an inducible expression chondroitin lyase ABCI, the control of induction time is 1-20 h, and controllable regulation of chondroitin sulfate molecular weight from 500 Da to 115 kDa is realized.

Description

Technical Field

[0001] This invention relates to the synthesis of chondroitin sulfate with a specific molecular weight by metabolic modification of Pichia pastoris, and belongs to the fields of metabolic engineering and synthetic biology. Background Technology

[0002] Chondroitin sulfate (CS) is a glycosaminoglycan widely found in animal connective tissues. It is composed of alternating N-acetylgalactosamine and glucuronic acid linked by β-1,4 glycosidic bonds, and its sugar chains are typically modified by sulfation at different sites. Chondroitin sulfate plays important physiological functions in maintaining extracellular matrix structure, regulating cell signal transduction, anti-inflammation, and anti-oxidation, and has been widely used in the treatment of osteoarthritis, skin repair, corneal moisturizing, adjunctive treatment of cardiovascular diseases, and functional foods.

[0003] The bioactivity of chondroitin sulfate is closely related to its molecular weight. Chondroitin sulfate of different molecular weights exhibits significantly different functions and physicochemical properties in vivo, corresponding to different application scenarios: High molecular weight chondroitin sulfate (typically >50 kDa), due to its high viscoelasticity and good structural support, is an ideal joint lubricant and cartilage tissue engineering scaffold material, and can be used in injectable or implantable medical devices; Medium molecular weight chondroitin sulfate (approximately 10-50 kDa) shows excellent bioactivity in maintaining chondrocyte phenotype and inhibiting inflammatory responses, making it an ideal specification for oral osteoarthritis health products and pharmaceuticals, easy to process and with high bioavailability; Low molecular weight chondroitin sulfate (<10 kDa, especially <3 kDa), with its small molecular size, has extremely high bioavailability and tissue permeability, capable of penetrating the skin barrier or blood-brain barrier, thus showing unique advantages in promoting wound healing, antithrombosis, immunomodulation, neuroprotection, and as a novel drug delivery carrier. For example, chondroitin sulfate oligosaccharides with a molecular weight below 1 kDa can act as signaling molecules to regulate cellular behavior.

[0004] Currently, commercially available chondroitin sulfate is mainly extracted from animal cartilage (such as pigs, cattle, and fish). Its molecular weight distribution is wide and uncontrollable, and it suffers from drawbacks such as limited sources, complex extraction processes, and the potential introduction of pathogens. To obtain low molecular weight chondroitin sulfate, existing methods mainly include chemical degradation methods (such as acid hydrolysis and oxidative degradation) and enzymatic hydrolysis. Chemical methods involve violent reactions and difficult-to-control conditions, easily leading to damage to the sugar chain structure and loss of sulfate groups, resulting in poor product uniformity and significant environmental pollution. While enzymatic methods offer milder conditions, enzyme sources are limited, costs are high, and it is difficult to achieve precise control over the product's molecular weight.

[0005] Therefore, developing a green, efficient, and controllable microbial fermentation method for preparing low molecular weight chondroitin sulfate has become an important research direction in this field. In recent years, patents (such as CN 112708571 A) have reported the synthesis of controllable molecular weight chondroitin sulfate in Pichia pastoris, but the yield is only 2.3 g / L, and the molecular weight distribution range is limited to 1.2-40 kDa. Another patent (such as CN 119842580 A) has achieved chondroitin sulfate synthesis in Escherichia coli K12, but the products are mainly disaccharides and tetrasaccharides of 800-1500 Da, with a narrow molecular weight range that is difficult to cover the needs for medium and high molecular weights. Existing technologies all suffer from limited yield and insufficient molecular weight control range. It is impossible to achieve a wide range of precisely controllable chondroitin sulfate production from hundreds of Da to hundreds of kDa on a single platform, making it difficult to meet the aforementioned diverse and differentiated application needs.

[0006] Therefore, the technical problem to be solved by the present invention is to overcome the lack of a recombinant strain and its preparation method in the prior art that can efficiently synthesize chondroitin sulfate of different yields and molecular weights in Pichia pastoris, and whose synthesis process is simple, green and controllable. Summary of the Invention

[0007] The purpose of this invention is to provide a method for intracellular synthesis of chondroitin sulfate of different molecular weights in Pichia pastoris. By constructing a chondroitin synthesis pathway through metabolic engineering, enhancing precursor supply, optimizing fermentation process, and introducing a controllable degradation system, the invention achieves dual regulation of chondroitin sulfate yield and molecular weight.

[0008] To achieve the above objectives, the present invention adopts the following technical solution: This invention provides a gene expression cassette P GAP - kfoA - T2A - kfoC - T2A2 - tuaD Contains promoter P GAP The regulated, T2A-linked chondroitin synthase gene kfoC, UDP-glucosamine isomerase gene kfoA, and UDP-glucose dehydrogenase gene tuaD.

[0009] In one embodiment, the nucleotide sequence of the chondroitin synthase gene kfoC is shown in SEQ ID NO.2; the nucleotide sequence of the UDP-glucosamine isomerase gene kfoA is shown in SEQ ID NO.1; the nucleotide sequence of the UDP-glucose dehydrogenase gene tuaD is shown in SEQ ID NO.3; and the nucleotide sequence encoding the T2A peptide is: GAAGGTAGAGGTAGCCTGCTGACCTGTGGCGATGTTGAAGAGAACCCAGGACCT.

[0010] The present invention also provides recombinant microorganisms containing the said gene expression cassette.

[0011] In one embodiment, the microorganism includes, but is not limited to, Pichia pastoris.

[0012] In one embodiment, the Pichia pastoris includes, but is not limited to, Pichia pastoris GS115.

[0013] This invention also provides a recombinant Pichia pastoris capable of producing chondroitin with a molecular weight of 40-115 kDa, wherein the recombinant Pichia pastoris is based on Pichia pastoris GS115, and the gene expression cassette P is integrated at the GAP gene site. GAP - kfoA - T2A - kfoC - T2A2 - tuaD And has any of the following improvements: (1) Integration expression is generated by promoter P GAP Regulated UDP-glucose dehydrogenase gene tuaD ; (2) Integration expression is generated by promoter P GAP Regulated phosphoglucosamine mutase gene pagm or glucosamine-6-phosphate synthase gene glmS ; (3) Integration and expression of UDP-glucose dehydrogenase gene via T2A peptide tandem tuaD phosphoglucosamine mutase gene pagm and glucosamine-6-phosphate synthase gene glmS。

[0014] In one embodiment, the recombinant Pichia pastoris also inhibits key genes in the EMP and PPP pathways. pfk2 (Gene ID:8198870) and zwf The expression of (Gene ID: 8198996).

[0015] In one implementation, the inhibition of gene expression is achieved by knocking out... zwf Genes, and / or replacements pfk2 The promoter is a weak promoter P. gut1 .

[0016] In one embodiment, the recombinant Pichia pastoris also integrates and expresses HIS4. pgm (SEQ ID NO.16) 、galU (SEQ ID NO.17) 、gpat (SEQ ID NO.18)、pgi (SEQ ID NO.19) 、glmU (SEQ ID NO.20) 、cgugdA2 (SEQ ID NO.4) 、ptglmS (SEQ ID NO.5) 、sepagM (SEQ ID NO.6).

[0017] In one embodiment, the *E. coli* source... kfoA The nucleotide sequence is shown in SEQ ID NO.1, and the *E. coli* source is... kfoC The nucleotide sequence is shown in SEQ ID NO.2, and the Bacillus subtilis-derived... tuaD The nucleotide sequence is shown in SEQ ID NO.3. cgugdA2 The nucleotide sequence is shown in SEQ ID NO.4. ptglmS The nucleotide sequence is shown in SEQ ID NO.5. sepagM The nucleotide sequence is shown in SEQ ID NO.6.

[0018] In one embodiment, the recombinant Pichia pastoris also expresses chondroitin sulfate sulfotransferase C4ST and co-expresses Pichia pastoris endogenous ATP sulfonase (ATPS), adenosine sulfate kinase (APSK), polyphosphate kinase (PPK), and PAPD, enabling the production of chondroitin sulfate with a molecular weight of 40-115 kDa.

[0019] Further, the nucleotide sequence of the chondroitin sulfotransferase C4ST is shown in SEQ ID NO.7, the nucleotide sequence of the Pichia pastoris endogenous ATPS is shown in SEQ ID NO.8, the nucleotide sequence of the Pichia pastoris endogenous APSK is shown in SEQ ID NO.9, the nucleotide sequence of the Pichia pastoris endogenous PPK is shown in SEQ ID NO.10, and the nucleotide sequence of the Pichia pastoris endogenous PAPD is shown in SEQ ID NO.11.

[0020] In one embodiment, the recombinant Pichia pastoris also integrates and expresses chondroitin lyase ABCI; the encoding gene of chondroitin lyase ABCI is shown in SEQ ID NO.12.

[0021] In one embodiment, the Pichia pastoris uses pAO815 as a carrier and P... AOX (SEQ ID NO.22) serves as the promoter for expressing the ABCI gene, and a methanol-inducible expression system P is constructed. AOX -ABCI. This inducible expression system is used to express chondroitin lyase ABCI. By controlling the methanol induction time from 1 to 20 h, the molecular weight of chondroitin sulfate can be controlled to vary from 500 Da to 115 kDa.

[0022] This invention also provides a method for regulating the yield and molecular weight of recombinant Pichia pastoris chondroitin sulfate, comprising: (a) Integration of the chondroitin lyase ABCI expression cassette into the recombinant Pichia pastoris genome; (b) Fermentation at 20-32℃ and controlling the methanol induction time at 1-20 h to achieve a controllable change in the molecular weight of chondroitin sulfate from 500 Da to 115 kDa.

[0023] In one embodiment, the nucleotide sequence of the chondroitin lyase ABCI is shown in SEQ ID NO.12.

[0024] In one embodiment, the fermentation temperature is 20-32°C. Temperature affects the production and metabolic flux of Pichia pastoris, and also alters the expression rate and catalytic rate of intracellular catalytic enzyme systems. Pichia pastoris can grow at temperatures between 20-32°C, but the optimum temperature is 32°C. The fermentation temperature is 30°C.

[0025] In one embodiment, the fermentation culture pH is maintained between 5 and 6, wherein the pH is 5.

[0026] In one embodiment, the inoculation ratio of the fermentation seed liquid is between 5% and 30%.

[0027] In one embodiment, the seed culture medium is YPD medium and the fermentation medium is BSM inorganic salt medium.

[0028] In one embodiment, the molecular weight of chondroitin sulfate A ranges from 500 Da to 115 kDa.

[0029] The present invention also provides the application of the recombinant Pichia pastoris or the method thereon in the preparation of chondroitin sulfate A or products containing chondroitin sulfate A.

[0030] Beneficial effects: (1) This invention provides a one-step process for preparing chondroitin sulfate A. Compared with the traditional animal tissue extraction method, this method simplifies the process flow, eliminates the need for complex extraction and purification steps, avoids the introduction of animal-derived impurities and potential pathogenic factors, and significantly improves product safety. The obtained chondroitin sulfate A has a uniform structure, high purity, and good stability, which can meet the requirements of the pharmaceutical and functional food industries for high-quality polysaccharide raw materials.

[0031] (2) This invention constructs an engineered strain capable of one-step biosynthesis of chondroitin sulfate A through metabolic engineering. The engineered strain achieves efficient coupling of key precursor substances and sulfation reactions in its metabolic pathway design, thereby enabling dual control over product yield and molecular weight. Compared with traditional multi-step synthesis or enzymatic conversion methods, this strain has advantages such as simple process, large-scale fermentation production capability, uniform molecular weight distribution, and strong controllability of the production process, providing a new technical approach for the green and efficient preparation of chondroitin sulfate A. Attached Figure Description

[0032] Figure 1 The weight-average molecular weight of the samples was determined using the HPSEC-MALLS system; (a) chicken CSA standard; (b) shark CSC standard; (c) K. phaffii Intracellular product CSA (strain CS04); (d) K. phaffii Intracellular product CSA (strain CS01); (e) K. phaffii Intracellular product CSA (strain CS09).

[0033] Figure 2 The fermentation effect of CS09 strain on CSA production in a 5 L fermenter. Detailed Implementation

[0034] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0035] 1. Strains and culture media strain: Pichia pastoris ( Komagataella phaffii GS115; Plasmid: pPIC9K; LB medium: 10 g / L NaCl, 10 g / L tryptone, 5 g / L yeast extract. Fermentation medium: 85% H3PO4 26.7 mL / L; CaSO4·2H2O 0.93 g / L; K2SO4 18.2 g / L; MgSO4·7H2O 14.9 g / L; KOH 4.13 g / L; glycerol 40.0 mL / L; biotin 0.2 mg / L; PTM1 4.35 mL / L.

[0036] Shake-flask culture: The preserved engineered strain was streaked onto YPD plates and cultured at 30°C for 3 days. A single colony was inoculated into 5 mL of liquid YPD medium and cultured at 30°C and 220 rpm for 16 h. Then, it was transferred at 10% (v / v) to 45 mL of BMGY medium and cultured at 30°C and 220 rpm for 96 h. The yeast cells were collected by centrifugation at 5,000 × g.

[0037] Fed-batch fermentation in a 5-L fermenter: Fed-batch fermentation was carried out in a 5-L bioreactor (Inter-Ferm A 5-L, parallel bioreactor, Shanghai, China). 400 mL of seed culture was inoculated into the bioreactor, which contained 1.6 L of BMGY medium. Fermentation was carried out for 96 h, with the pH maintained at 5.0 and the temperature at 30°C.

[0038] 2. Analytical Methods Preparation of competent yeast cells: First, a single Pichia pastoris colony was inoculated into YPD liquid medium containing 1% yeast extract, 2% peptone, and 2% glucose, and cultured with shaking at 30°C and 220 rpm for 12–16 hours to obtain an overnight seed culture. Subsequently, the seed culture was inoculated at a ratio of 1:100 into a 500 mL Erlenmeyer flask containing 50 mL of fresh YPD medium and cultured at 30°C and 220 rpm until the cells reached the logarithmic growth phase. The OD... 600The value is 1.3–1.5. Once the cells reach the target growth stage, the culture system is rapidly cooled on ice for 10–15 minutes, then centrifuged at 3000×g for 5 minutes at 4°C to collect the cells. After discarding the supernatant, the cells are washed three times with ice-cold sterile water, and then twice with ice-cold 1 M sorbitol solution. All washing steps are performed at low temperature (4°C or ice bath) to maintain cell membrane integrity and reduce cell death. After washing, the obtained cells are resuspended in 1 mL of ice-cold 1 M sorbitol to obtain Pichia pastoris electroporation competent cells. These competent cells can be used immediately for electroporation, or aliquoted and flash-frozen in liquid nitrogen at -80°C, and slowly thawed on ice before use. In the electroporation step, 50 μL of the competent cells are added to 1–5 μg of linearized recombinant plasmid DNA, thoroughly mixed, and then transferred to a pre-cooled 0.2 cm electroporation cuvette for electroporation. The electroporation parameters were set as follows: voltage 1500 V, capacitance 25 μF, resistance 200 Ω, gap 0.2 cm, and electroporation time constant 5–10 ms. Immediately after electroporation, 1 mL of ice-cold 1 M sorbitol solution was added to the electroporation vessel to revive the cells, and the revival solution was transferred to a sterile centrifuge tube and incubated at 30°C and 220 rpm with shaking for 1–2 hours. After revival, the cells were plated on YPD solid plates containing the appropriate resistance selection agent (such as G418 or Zeocin) and incubated at 30°C for 2–3 days until single colonies were visible.

[0039] Chondroitin or chondroitin sulfate content determination: First, prepare a 9.54 g / L borax sulfate solution by accurately weighing anhydrous sodium tetraborate and dissolving it in concentrated sulfuric acid, then mixing thoroughly. Simultaneously, prepare a 2.5 g / L carbazole ethanol solution by weighing an appropriate amount of carbazole and dissolving it in anhydrous ethanol, then storing it protected from light. To establish a quantitative standard curve for GlcA, accurately prepare standard solutions of different concentrations: 10 mg / L, 20 mg / L, 30 mg / L, 40 mg / L, 50 mg / L, and 100 mg / L. Accurately pipette a certain volume of each standard solution and add appropriate amounts of borax sulfate solution and carbazole ethanol solution in a predetermined order, ensuring thorough mixing before proceeding with the colorimetric reaction. After the reaction is complete, measure the absorbance of each standard solution at a wavelength of 530 nm. A standard curve was plotted with the concentration of the standard on the x-axis and the corresponding absorbance value on the y-axis. A linear regression equation was then calculated to quantitatively determine the GlcA content in an unknown sample. The test sample (chondroitin solution) was reacted under the same conditions, and its absorbance value was measured. The obtained data was substituted into the regression equation of the standard curve to calculate the GlcA concentration in the sample. The chondroitin concentration was then converted from the GlcA content using the following formula: .

[0040] Example 1: Construction and optimization of chondroitin synthesis pathway (1) Construction of chondroitin synthesis pathway To achieve de novo synthesis of chondroitin, key enzyme genes from different microorganisms were selected, and their Pichia pastoris-preferred codons were optimized. The optimized chondroitin synthase gene derived from *E. coli* was then synthesized. kfoC (SEQ ID NO.2) and UDP-glucosamine isomerase gene kfoA The gene (SEQ ID NO.1) and the UDP-glucose dehydrogenase gene tuaD (SEQ ID NO.3) derived from Bacillus subtilis were linked into a polycistronic expression cassette via the T2A peptide (nucleotide sequence: GAAGGTAGAGGTAGCCTGCTGACCTGTGGCGATGTTGAAGAGAACCCAGGACCT), and cloned downstream of the GAP promoter in the constitutive expression vector pGAPZB. Restriction endonucleases were then used to... PasI The linearized recombinant plasmid was integrated into the GAP gene (Gene ID: 8198905) of the host strain *Pichia pastoris* GS115 via electroporation. Transformants were screened on YPD plates containing 100 μg / mL Zeocin, and the recombinant strain was obtained by colony PCR verification and named CS01 (genotype: GS115-P). GAP - kfoA - T2A - kfoC - T2A2 - tuaD ).

[0041] A single colony of CS01 was inoculated into 5 mL of YPD medium and activated at 30℃ and 220 rpm for 24 h. The inoculum was then transferred at a 1% inoculation rate to a 250 mL shake flask containing 50 mL of BMGY medium and fermented at 30℃ and 220 rpm for 96 h. After fermentation, intracellular chondroitin production was extracted and measured using the aforementioned method. The results showed that the recombinant strain CS01 achieved intracellular synthesis of chondroitin, with a yield of 114 mg / L, indicating that the chondroitin biosynthetic pathway was successfully constructed.

[0042] (2) Enhancement of the chondroitin precursor pathway To improve synthesis efficiency, based on the recombinant strain CS01 constructed in step (1), the two key precursor pathways UDP-glucuronic acid (UDP-GlcA) and UDP-N-acetylgalactosamine (UDP-GalNAc) were optimized. The enhancement strategy was to use the constitutive strong promoter P. GAP Overexpression of the relevant rate-limiting enzyme gene.

[0043] Strengthening the UDP-GlcA pathway: Adding the rate-limiting enzyme UDP-glucose dehydrogenase gene tuaD (SEQ ID NO.3) P constructed into the expression vector pPIC9K GAP (SEQ ID NO.13) Downstream of the promoter. Using SalI Linearized strain CS01 was electroporated and integrated into the HIS4 locus of the genome via homologous recombination. Transformants were screened on YPD plates containing 0.5 mg / mL G418 to obtain strain CS02 (GS115-P). GAP - kfoA-T2A-kfoC-T2A2-tuaD -P GAP - tuaD Following the same fermentation method as strain CS01, after 96 h of shake-flask fermentation, the chondroitin yield increased to 194 mg / L.

[0044] Strengthening the UDP-GalNAc pathway: Following the same method described above, the phosphoglucosamine mutase gene was... pagm (Derived from Pichia pastoris, Gene ID: 8199420) and glucosamine-6-phosphate synthase gene glmS (Derived from Pichia pastoris, Gene ID: 8200761) Constructed into pPIC9K-P GAP The vectors were integrated into the HIS4 site of CS01 to obtain strain CS03 (GS115-P). GAP - kfoA-T2A-kfoC-T2A2-tuaD- P GAP -pag m) and CS04 (GS115-P GAP - [[ID=, ​ -P GAP - ​ Following the same fermentation method as strain CS01, strains CS03 and CS04 were fermented in shake flasks for 96 h, and the chondroitin yields reached 186 mg / L and 176 mg / L, respectively.

[0045] Joint Enhancement: To further enhance the effect, ​ , ​ and ​ The three genes were tandemly linked via the T2A peptide to construct pPIC9K-P GAP Carrier, forming P GAP - ​ Expression cassette. After linearization, it was integrated into the HIS4 site of CS01 to obtain strain CS05 (GS115-P). GAP - ​ -P GAP - ​ ​Following the same fermentation method as strain CS01, strain CS05 was fermented in shake flasks for 96 h, and the yield increased to 232 mg / L, which is 2.03 times that of CS01, indicating that the synergistic optimization of the two precursor supply pathways can significantly enhance product accumulation.

[0046] (3) Screening and combination optimization of heterozymes Based on the strain CS05 constructed in step (2), to further overcome metabolic bottlenecks, a cross-species enzyme combination strategy was adopted to screen for highly efficient homologous enzymes from different microorganisms. The construction method was the same as in step (2), that is, the screened heterologous genes were integrated into the HIS4 site of the strain through T2A peptide tandem. The results showed that the enzymes from different microorganisms were combined to form a cross-species enzyme combination. ​ ​ UDP-glucose dehydrogenase gene ​ (SEQ ID NO.4) ​ L-glutamine-D-fructose-6-phosphate aminotransferase gene ​ (SEQ ID NO.5) and ​ phosphoglucosamine mutase gene ​ (SEQ ID NO.6) Combination optimization yielded the best results. The resulting strain was CS06 (GS115-P). GAP - ​ -P GAP - ​ Following the same fermentation method as strain CS01, strain CS06 was fermented in shake flasks for 96 h, and the chondroitin yield increased to 338 mg / L, which is nearly 3.0 times higher than that of the initial strain CS01.

[0047] (4) Metabolic flux regulation and carbon source optimization Based on the recombinant strain CS06 constructed in step (3), in order to achieve directional carbon flow allocation, key genes of the EMP and PPP pathways were inhibited using CRISPR-Cas9 technology. ​ (Gene ID:8198870) and ​ Expression of (Gene ID: 8198996) (Table 1) weakens competitive metabolic flux and improves substrate utilization efficiency.

[0048] Knockout ​ Gene: In strain CS06, electroporation targets ​ gRNA expression plasmids and containing ​ Donor DNA fragments from upstream and downstream homologous arms of a gene (UpPAPR-DoPAPR) are used to achieve homologous recombination. ​ Complete gene knockout yielded strain CS07. Following the same fermentation method as strain CS01, strain CS07 was fermented in shake flasks for 96 h, resulting in a chondroitin yield of 365 mg / L.

[0049] replace ​ Promoter: To achieve precise control and avoid growth defects caused by complete knockout, the promoter is... ​ The natural promoter of a gene is replaced with the weak promoter P. gut1 (SEQ ID NO.14). Specifically, it involves electroporation targeting. ​ promoter gRNA and P gut1 And the donor fragment of the homologous arm. Strains CS08 (based on CS06, with...) were obtained. ​ Replace the promoter with P gut1 Following the same fermentation method as strain CS01, strain CS08 was fermented in shake flasks for 96 h, and the chondroitin yield was 398 mg / L. This indicates that the promoter substitution strategy is more conducive to product accumulation than complete knockout, and the yield is 17.8% higher than that of CS06.

[0050] Furthermore, a two-stage carbon source fermentation strategy was employed for strain CS08: YPD was used as the fermentation medium. In the early stage (0-24 h), glycerol with a final concentration of 20 g / L was used as the carbon source to promote cell growth. In the later stage (24-96 h), glucose was fed in (to achieve a glucose concentration of 5-10 g / L in the fermentation system) as the carbon source for chondroitin synthesis. Fermentation was carried out in a 5 L fermenter with an initial liquid volume of 2 L and an inoculum size of 10%. The temperature was controlled at 30℃, pH 5.0, and dissolved oxygen was controlled to be >30% by linking the rotation speed (300-900 rpm) and aeration rate (1-3 vvm). The results showed that the yield increased to 363 mg / L after 96 h of shake-flask fermentation, and the yield in the 5 L fermenter reached 4.2 g / L.

[0051] Table 1 Primers and Sequences

[0052] (5) Genome rearrangement and co-expression To address the transcriptional asynchrony caused by gene dispersion, key genes from the UDP-GlcA and UDP-GalNAc pathways (nucleotide sequences shown in SEQ ID NO. 4-6 and 16-20, respectively) were co-integrated into the HIS4 site of the genome in strain GS115, achieving synergistic expression of the pathways. These genes were constructed on three different integrative plasmids via T2A peptide tandem, and were sequentially integrated using the repeatable integration characteristic of the HIS4 site.

[0053] Plasmid 1 was constructed separately: pPPIC-9k-P GAP - ​ Plasmid 2: pPIC3.5k-P GAP - ​ Plasmid 3: pGAP815-PGAP - ​ M.

[0054] The above three plasmids were subjected to ​ After linearization, the cells were sequentially electroporated into GS115 competent cells. Positive clones were selected after each integration using the corresponding antibiotic marker (e.g., G418), ultimately yielding strain CS09 (GS115-P). GAP - ​ ​ :: P GAP - ​ :: P GAP - ​ ​ ,and ​ The f gene promoter is P gut1 (Replacement). Following the same fermentation method as strain CS01, strain CS09 was fermented in shake flasks for 96 h. The chondroitin yield of strain CS09 reached 564 mg / L, which was 67% higher than that of strain CS06.

[0055] Table 2 Primers and Sequences

[0056] Example 2: One-step biosynthesis of chondroitin sulfate A (1) Construction of PAPS donor regeneration system The sulfation reaction depends on PAPS as a sulfate donor, and its intracellular supply usually limits the overall sulfation efficiency. Therefore, using CRISPR-Cas9 technology, co-expression cassettes of PAPS cycle-related enzymes were integrated into the AOX1 site of the genomes of strains CS01 and CS09 constructed in Example 1 (Table 3). The co-expression cassettes contained four enzymes: endogenous ATP sulfatase (ATPS, SEQ ID NO. 8), adenosine sulfate kinase (APSK, SEQ ID NO. 9), polyphosphate kinase (PPK, SEQ ID NO. 10), and PAP phosphodiesterase (PAPD, SEQ ID NO. 11). The four genes were synthesized separately and tandemly linked via T2A, T2A2, or T2A3 peptides. The nucleotide sequence encoding T2A peptide is: GAAGGTAGAGGTAGCCTGCTGACCTGTGGCGATGTTGAAGAGAACCCAGGACCT; the sequence encoding T2A2 is: GAGGGCGGCAGCCTGCTGACCTGTGGCGACGTGGAGGAGAACCCTGGACCT; and the nucleotide sequence encoding T2A3 is: GCCACCAACTTCAGCCTGCTGAAGCAGGCGGGCGACGTGGAGGAGAACCCTGGACCT. These genes were then placed in the constitutive promoter P. GCW14 (The nucleotide sequence is shown in SEQ ID NO.21) downstream. After screening of transformants, strains CS10-CS18 were obtained. Strains CS10 (GS115-P) were then formed. GAP - ​ ​ -P GCW14 - ATPS-T2A-APSK-T2A2-PPK-T2A3-PAPD); CS11 (GS115-P) GAP - ​ -P GAP - ​ - P GCW14 - ATPS-T2A-APSK-T2A2-PPK-T2A3-PAPD); CS12 (GS115-P) GAP - ​ -P GAP - ​ - P GCW14 - ATPS-T2A-APSK-T2A2- PPK-T2A3-PAPD); CS13 (GS115-PGAP-kfoA-T2A-kfoC-T2A2-tuaD-PGAP-glmS-P GCW14- ATPS-T2A-APSK- T2A2-PPK-T2A3-PAPD); CS14 (GS115-P) GAP - ​ -P GAP - ​ -P GCW14 - ATPS-T2A-APSK- T2A2-PPK-T2A3-PAPD); CS15 (GS115-P) GAP - ​ -P GAP - ​ ​ - P GCW14 - ATPS-T2A-APSK- T2A2-PPK-T2A3-PAPD); CS16 (GS115-P) GAP - ​ -P GAP - ​ ​ - P GCW14 - ATPS-T2A-APSK- T2A2-PPK-T2A3-PAPD ​ ); CS17 (GS115-P) GAP - ​ -P GAP - cgugdA2- T2A-ptglmS-T2A2- sepagM - P gut1 - pfk2 - P GCW14 - ATPS-T2A-APSK- T2A2-PPK-T2A3-PAPD △zwf ); CS18 (GS115-P) GAP - pgm-T2A-galU-T2A2-sgugdA2-kfoC - P GAP - pgi-T2A-glmU- T2A2-gpaT- P GAP - cgugdA2-T2A-ptglmS-T2A2sepagM △zwf ).

[0057] Through the synergistic expression of the above enzymes, a highly efficient PAPS regeneration and recycling system was formed, providing a continuous sulfate donor for the C4ST catalytic reaction.

[0058] Table 3 Primers and Sequences

[0059] (2) Synthesis and detection of chondroitin sulfate A Based on the previously constructed strains CS10~CS18, chondroitin 4-O-sulfotransferase C4ST (SEQ ID NO.7) was introduced into each strain. The C4ST gene was placed in the constitutive promoter P. TEF1 Downstream of (nucleotide sequence as shown in SEQ ID NO.15), an expression cassette was constructed and integrated into the genomic GAP site, yielding strains CS19 to CS27 (Table 4). Strain CS19 (CS10-P) TEF1 -C4ST); CS20 (CS11-P) TEF1 -C4ST); CS21 (CS12-P) TEF1 -C4ST); CS22 (CS13-P) TEF1 -C4ST); CS23 (CS14-P) TEF1 -C4ST); CS24 (CS15-P) TEF1 -C4ST); CS25 (CS16-P) TEF1 -C4ST); CS26 (CS17-P) TEF1 -C4ST); and CS27 (CS18-P) TEF1 -C4ST). These strains were fed-batch fermented in a 5 L fermenter under the following conditions: initial volume 2.5 L BSM medium, inoculum size 10%, temperature 30℃, pH 5.0. Cell growth was maintained by automatically adding 50% glycerol and 12 mL / L PTM1, based on real-time monitoring of the fermenter's glycerol concentration. After glycerol depletion, 500 g / L glucose containing 12 mL / L PTM1 was added as a carbon source, and the glucose concentration was controlled at 5–10 g / L for 48 h by real-time monitoring. After fermentation, the cells were collected by centrifugation, homogenized under high pressure, precipitated with ethanol, and purified to obtain chondroitin sulfate A product. The yield was determined using the sulfuric acid-carbazole method, the product structure was identified by LC-MS, and the molecular weight was determined by HPSEC. Figure 1 The results showed that all strains successfully synthesized chondroitin sulfate A. Among them, strain CS27, constructed using CS09 as the host, had the highest yield, reaching 5.3 g / L, with a sulfonation level of 16% and a molecular weight of 97 kDa. Figure 2 ).

[0060] Table 4 Primers and Sequences

[0061] Example 3: One-step synthesis of low molecular weight chondroitin sulfate (1) Construction of lyase expression system To achieve dynamic regulation of chondroitin sulfate molecular weight, an expression cassette containing the chondroitin sulfate lysin ABCI gene was integrated into recombinant Pichia pastoris. The ABCI gene was derived from... Proteus vulgaris It can catalyze the cleavage of β-1,4 glycosidic bonds in the chondroitin backbone. Using pAO815 as a vector, the ABCI gene (SEQ ID NO.12) was placed in the methanol-inducible promoter P AOX Downstream of (nucleotide sequence as shown in SEQ ID NO.22), expression plasmid P was constructed. AOX -ABCI. Use this plasmid... SalI After linearization, the chondroitin sulfate A strains CS19-CS27 constructed in Example 2 were introduced via electroporation and integrated into the HIS4 site of the genome via homologous recombination. His... + Transformants were used to obtain engineered strains with dual "synthesis-lysis" functions, named CS28~CS36 respectively. CS28 (CS19-P AOX -ABCI); CS29 (CS20-P) AOX -ABCI); CS30 (CS21-P) AOX -ABCI); CS31 (CS22-P AOX -ABCI); CS32 (CS23-P AOX -ABCI); CS33 (CS24-P) AOX -ABCI); CS34 (CS25-P) AOX -ABCI); CS35 (CS26-P) AOX -ABCI); CS36 (CS27-P) AOX -ABCI).

[0062] (2) Establishment of an inducible expression system To achieve controlled expression of the lyase, strains CS28-CS36 were fermented in YPD medium at 30°C for 96 h. By regulating the methanol induction process at different time points (fermentation 1-20 h) and adding methanol to a final concentration of 1%, the expression timing and level of the lyase during chondroitin sulfate synthesis could be precisely controlled, thereby adjusting the molecular weight distribution of the product. Specifically, methanol with a final concentration of 10 mL / L was added at 1-3, 8-12, and 16-20 h for induction. The results (Table 5) showed that the system could achieve graded degradation of the product while maintaining a high synthesis rate.

[0063] (3) Molecular weight regulation and product analysis of chondroitin sulfate The recombinant strains CS28~CS36 with the inducible lysis system constructed in step (2) were fermented as follows: First, the seed strain was inoculated into BMGY medium (1% yeast extract, 2% peptone, 100 mM potassium phosphate buffer, pH 6.0, 1.34% YNB, 4×10^-5% biotin, 1% glycerol) and cultured at 30℃ and 250 rpm for 24 h with shaking to allow for sufficient cell growth. Then, the inoculum was transferred to fermentation medium BMMY (replacing 1% glycerol in BMGY with 0.5% methanol) at a 10% (v / v) inoculation rate and fermented at 30℃ for a total fermentation time of 96 h. For the first 24 h, glycerol was used as the carbon source for cell proliferation. When the cell OD600 reached 80–100, methanol induction was started, and methanol was added every 12 h to a final concentration of 0.5% (v / v), while maintaining the dissolved oxygen level above 20% to ensure stable expression of the target gene. Controllable synthesis of chondroitin sulfate with different molecular weights was achieved by adjusting the duration of methanol induction. When the induction time was short (1–3 h fermentation), the expression level of the lyase was low, cell wall degradation was weak, and the resulting product had an average molecular weight of 115 kDa and an intact structure. With prolonged induction time, the lyase gradually accumulated, cell permeability increased, and the chondroitin sulfate molecular chain underwent controlled cleavage, gradually decreasing the product molecular weight, thus achieving the targeted preparation of chondroitin sulfate with different molecular weights. This is suitable for medical and injectable applications. When the induction time was extended to 8–12 h fermentation, the average molecular weight of the product decreased to approximately 10–30 kDa, suitable for oral absorption functional formulations. When the induction time reached 16–20 h fermentation, cleavage was sufficient, and the product molecular weight was approximately 500 Da, forming chondroitin sulfate oligosaccharides. By controlling the induction time, the molecular weight of chondroitin sulfate could be continuously adjusted within the range of 500 Da to 115 kDa. The chondroitin yield, molecular weight, and sulfonation level of different strains at different induction times are shown in Table 5.

[0064] Table 5. Comparison of chondroitin / CS yield, molecular weight, and sulfonation level among different strains.

[0065] a The content and sulfonation level of chondroitin, CSA, and CSC from different sources were quantitatively determined. Commercial chicken (Macklin) and shark (Aladdin) CSA standards were reconstituted with ultrapure water to 100 mg / L according to the sulfonation degree data provided by the manufacturer. All measurements were performed in triplicate.

[0066] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A gene expression cassette, characterized in that, Contains promoter P GAP The chondroitin synthase gene kfoC, the UDP-glucosamine isomerase gene kfoA, and the UDP-glucose dehydrogenase gene tuaD are regulated and linked via T2A. The nucleotide sequence of the chondroitin synthase gene kfoC is shown in SEQ ID NO.2; the nucleotide sequence of the UDP-glucosamine isomerase gene kfoA is shown in SEQ ID NO.1; the nucleotide sequence of the UDP-glucose dehydrogenase gene tuaD is shown in SEQ ID NO.3; and the nucleotide sequence encoding the T2A peptide is: GAAGGTAGAGGTAGCCTGCTGACCTGTGGCGATGTTGAAGAGAACCCAGGACCT.

2. A recombinant microorganism containing the gene expression cassette of claim 1.

3. Recombinant Pichia pastoris, characterized in that, Using Pichia pastoris GS115 as a host, the gene expression cassette described in claim 1 was integrated and expressed.

4. The recombinant Pichia pastoris according to claim 3, characterized in that, The gene expression cassette of claim 1 is integrated into the GAP gene site, and has any of the following improvements: (1) Integration expression is generated by promoter P GAP Regulated UDP-glucose dehydrogenase gene tuaD; (2) Integrated expression by promoter P GAP Regulated phosphoglucosamine mutase gene pagm or glucosamine-6-phosphate synthase gene glmS (3) Integration expression of the UDP-glucose dehydrogenase gene tuaD and the phosphoglucosamine mutase gene tandemly via T2A peptide. pagm and glucosamine-6-phosphate synthase gene glmS .

5. The recombinant Pichia pastoris according to claim 4, characterized in that, Also knock out zwf Genes, and / or replacements pfk2 The promoter is a weak promoter P. gut1 .

6. The recombinant Pichia pastoris according to any one of claims 1 to 5, characterized in that, The recombinant Pichia pastoris also integrates and expresses one or more of the following genes: pgm, galU, gpat, pgi, glmU, cgugdA2, ptglmS, sepagM .

7. The recombinant Pichia pastoris according to any one of claims 1 to 6, characterized in that, It also expresses chondroitin sulfate sulfotransferase C4ST, and co-expresses Pichia pastoris endogenous ATP sulfotransferase ATPS, adenosine sulfate kinase APSK, polyphosphate kinase PPK, and PAP phosphatase PAPD.

8. The recombinant Pichia pastoris according to claim 7, characterized in that, The chondroitin lyase ABCI is expressed; the gene encoding the chondroitin lyase ABCI is shown in SEQ ID NO.

12.

9. A method for regulating the yield and molecular weight of recombinant Pichia pastoris chondroitin sulfate, characterized in that, include: Fermentation was carried out at 20-32℃, and the molecular weight of chondroitin sulfate was controlled to change from 500 Da to 115 kDa by controlling the methanol induction time to 1-20 h.

10. The use of the recombinant Pichia pastoris according to any one of claims 1 to 8 or the method according to claim 9 in the preparation of chondroitin sulfate A or products containing chondroitin sulfate A.

Images