Monoclonal antibody aiming at canine adenovirus as well as application and kit thereof
By constructing hybridoma cell lines FD-CAV-2F5 and FD-CAV-4D4, monoclonal antibodies were prepared for use in kits and test strips for canine adenovirus, solving the problem of rapid detection of canine adenovirus and achieving detection results with high sensitivity and specificity.
Patent Information
- Application Number
- CN202610027127.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-09
- Publication Date
- 2026-04-14
AI Technical Summary
Existing technologies are insufficient for rapid, convenient, and specific detection of canine adenovirus, especially lacking immediate detection methods in clinical diagnosis.
Two hybridoma cell lines, FD-CAV-2F5 and FD-CAV-4D4, were constructed. The monoclonal antibodies secreted by these cells showed strong specific binding ability to canine adenovirus and were used to prepare kits and test strips. Detection methods included IFA, ELISA, and POCT.
It enables rapid, simple, and specific detection and quantification of canine adenovirus, suitable for on-site testing, with high sensitivity, quick results, and easy interpretation.
Smart Images

Figure CN121852331A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of animal disease detection technology, and in particular to a monoclonal antibody against canine adenovirus, its uses, and a reagent kit. Background Technology
[0002] Canine adenovirus (CAV) is an important pathogen in canines, with two serotypes, CAV-1 and CAV-2, and is particularly pathogenic to puppies. Infectious canine hepatitis (ICH) caused by CAV-1 can present in peracute, acute, or subacute courses: the peracute form is most common in the early stages of an outbreak, with dogs often dying suddenly without any prodromal symptoms; the acute form typically presents with high fever (body temperature ≥40℃, some cases exhibiting a characteristic "saddle-shaped" fever pattern), lethargy, loss of appetite, vomiting, diarrhea, abdominal pain (significant tenderness in the xiphoid process), visible gingival bleeding points, spontaneous hematomas, and generalized subcutaneous edema. During the recovery period, approximately 20% of cases develop temporary corneal opacity in one or both eyes, i.e., "blue eye" lesions. CAV-2 primarily attacks the respiratory tract, with an incubation period of 5-6 days. Clinically, it is characterized by persistent fever, paroxysmal dry or wet cough, lethargy, dyspnea, and serous or purulent nasal discharge. It is also prone to co-infection with other respiratory viruses.
[0003] In the clinical diagnosis of canine adenovirus, viral isolation remains the "gold standard" for etiological confirmation. However, its complex procedures and time-consuming nature (3-7 days) make it difficult to meet the immediate clinical needs. While PCR offers high sensitivity and specificity, allowing detection of viral nucleic acid in the early stages of infection, it requires sophisticated experimental platforms and techniques, making it unsuitable for outpatient and emergency room applications. Therefore, there is an urgent need to establish a simple, immediate, and rapid on-site testing technology that can be used on a single dog to fill the current diagnostic gap. Summary of the Invention
[0004] The technical problem to be solved by the present invention is to provide a monoclonal antibody against canine adenovirus, its uses, and a kit that enables rapid detection of canine adenovirus.
[0005] To address the aforementioned technical problems, as a first aspect of this invention, the present invention provides a hybridoma cell line FD-CAV-2F5, which was deposited on October 29, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 46711. The address of the CGMCC is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. This strain is classified as a hybridoma cell line secreting canine adenovirus capsid protein antibodies.
[0006] As a second aspect of the present invention, the present invention provides a hybridoma cell line FD-CAV-4D4, which was deposited on October 29, 2025 at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 46712. The address of the China General Microbiological Culture Collection Center is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The strain is classified as a hybridoma cell line secreting canine adenovirus capsid protein antibody.
[0007] As a third aspect of the present invention, the present invention provides a monoclonal antibody secreted by the above-mentioned hybridoma cell line FD-CAV-2F5.
[0008] As a fourth aspect of the present invention, the present invention provides a monoclonal antibody secreted by the above-mentioned hybridoma cell line FD-CAV-4D4.
[0009] As a fifth aspect of the present invention, the present invention provides the application of the above-described monoclonal antibody in the preparation of a kit for detecting canine adenovirus. Specifically, the kit can be used for detection by IFA, ELISA, POCT, etc., but is not limited thereto.
[0010] As a sixth aspect of the present invention, the present invention provides a test strip for detecting canine adenovirus, comprising a base plate and a colloidal gold pad and a nitrocellulose membrane disposed on the base plate, wherein the colloidal gold pad comprises colloidal gold particles and a first monoclonal antibody, and the nitrocellulose membrane is provided with a second monoclonal antibody. The first monoclonal antibody is monoclonal antibody 2F5, and the second monoclonal antibody is monoclonal antibody 4D4; or The first monoclonal antibody is monoclonal antibody 4D4, and the second monoclonal antibody is monoclonal antibody 2F5; The monoclonal antibody 2F5 was secreted by the hybridoma cell line FD-CAV-2F5, which was deposited on October 29, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 46711. This strain is classified as a hybridoma cell line that secretes antibodies against canine adenovirus capsid protein.
[0011] The monoclonal antibody 4D4 was secreted by the hybridoma cell line FD-CAV-4D4, which was deposited on October 29, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 46712. This strain is classified as a hybridoma cell line that secretes antibodies against canine adenovirus capsid protein.
[0012] Through in-depth research, the inventors of this invention constructed two hybridoma cell lines using canine adenovirus hexon protein as an immunogen. The monoclonal antibodies secreted by these cells exhibit strong specific binding ability to canine adenoviruses (including types 1 and 2), providing a solid foundation for the rapid detection of canine adenovirus antigens. This also provides a good basis for the quantification of canine adenovirus. It should be noted that the canine adenovirus hexon protein, also known as the hexagonal protein, is the main component of the viral capsid, forming the structural basis of the viral particle and serving as a key antigen that induces the body to produce neutralizing antibodies.
[0013] As an improvement to the above technical solution, the first monoclonal antibody is monoclonal antibody 2F5, and the second monoclonal antibody is monoclonal antibody 4D4.
[0014] As an improvement to the above technical solution, the nitrocellulose membrane further includes an anti-mouse IgG antibody, which is an anti-mouse IgG polyclonal antibody. Examples include sheep anti-mouse IgG, rabbit anti-mouse IgG, donkey anti-mouse IgG, and camel anti-mouse IgG, but it is not limited to these.
[0015] As an improvement to the above technical solution, the anti-mouse IgG antibody is goat anti-mouse IgG.
[0016] As an improvement to the above technical solution, the labeling amount of the first monoclonal antibody is 20 μg / mL to 25 μg / mL; and / or The colloidal gold particles have a particle size of 20nm~35nm and a maximum absorption peak wavelength of 520nm~525nm.
[0017] The second monoclonal antibody is monoclonal antibody 2F5, with a coating concentration of 1.0 mg / mL to 1.5 mg / mL; or The second monoclonal antibody is monoclonal antibody 4D4, with a coating concentration of 0.8 mg / mL to 1.2 mg / mL.
[0018] As an improvement to the above technical solution, the labeling amount of the first monoclonal antibody is 20 μg / mL; and / or The colloidal gold particles have a particle size of 22 nm and a maximum absorption peak wavelength of 524 nm; and / or The second monoclonal antibody is monoclonal antibody 4D4, with a coating concentration of 1.0 mg / mL; and / or The coating concentration of the anti-mouse IgG antibody was 1.2 mg / mL.
[0019] As a seventh aspect of the present invention, the present invention discloses a kit for quantitative detection of canine adenovirus, comprising an enzyme-labeled plate coated with a first monoclonal antibody and an enzyme-labeled second monoclonal antibody. The first monoclonal antibody is monoclonal antibody 2F5, and the second monoclonal antibody is monoclonal antibody 4D4; or The first monoclonal antibody is monoclonal antibody 4D4, and the second monoclonal antibody is monoclonal antibody 2F5; The monoclonal antibody 2F5 was secreted by the hybridoma cell line FD-CAV-2F5, which was deposited on October 29, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 46711. The monoclonal antibody 4D4 is secreted by the hybridoma cell line FD-CAV-4D4, which was deposited on October 29, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 46712.
[0020] As an improvement to the above technical solution, the first monoclonal antibody is monoclonal antibody 2F5, and the second monoclonal antibody is monoclonal antibody 4D4.
[0021] As an improvement to the above technical solution, the second monoclonal antibody is labeled with HRP enzyme.
[0022] Implementing this invention has the following beneficial effects: This invention utilizes canine adenovirus HEXON protein as an immunogen to construct two hybridoma cell lines, FD-CAV-2F5 and FD-CAV-4D4. The monoclonal antibodies secreted by these cells exhibit strong specific binding ability to canine adenoviruses (including types 1 and 2). Based on these monoclonal antibodies, this invention constructs test strips and kits for detecting canine adenovirus. These kits offer advantages such as simple operation, high specificity, high sensitivity, rapid results, and easy interpretation, and can be used for rapid detection and quantification of canine adenovirus. Attached Figure Description
[0023] Figure 1 Image showing SDS-PAGE analysis of purified recombinant canine adenovirus HEXON protein. Lane M: Protein molecular weight standard; Lanes 1 and 2: Purified canine adenovirus HEXON protein; Figure 2 For the detection of different TCIDs using monoclonal antibody double sandwich antigen test strips 50 Sensitivity results of diluted canine adenovirus solution; Figure 3 This is a standard curve for quantitative analysis of monoclonal antibody using a double-sandwich ELISA assay. Detailed Implementation
[0024] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be described in further detail below.
[0025] Example 1: Expression and purification of recombinant canine adenovirus HEXON protein 1. Construction and identification of recombinant plasmids The base sequences of canine adenovirus type 1 and type 2 HEXON proteins in GenBank were analyzed using analytical software. Conserved sequences of CAV1 and CAV2 in the HEXON protein were selected to design upstream and downstream primers for partial sequence amplification. The sequences are as follows: CCGTCGATGCTGCCACAATGGTCTTACATGCACATTGCTGGCCAGGACGCCGCCGAATACTTGTCTCCCGCCCTGGTTCAGTTTGCCCAAGCAACCAGTTCTTACTTTAAGTTGGACAACAAGTTCAGAAACCCCACTGTGGCCCCCACTCACGATGTAACCACTGAAAGGTCTCAGCGCTTGCAGTTGCGCTTTGTGCCAGTTATGCAAGAAGATGGCCAGTACACTTACAAAACCCGGTTCC (SEQ ID NO: 1).
[0026] Using CAV 1 and CAV 2 nucleic acids as templates, PCR amplification was performed using upstream and downstream primers, respectively. The primer sequences are as follows: Forward primer (CAV-F): cccaagctCCGTCGATGCTGCCA (SEQ ID NO: 2); Reverse primer (CAV-R): taagcagaattcGGAACCGGGTTTTGTAA (SEQ ID NO: 3).
[0027] The specific PCR reaction system is as follows: 2×PCR MIX 25μL Forward primer (CAV-F) 1μL Reverse primer (CAV-R) 1μL Template 2μL 21μL of ultrapure water Total 50μL The PCR reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 30 s, 30 cycles; 72℃ extension for 5 min, and storage at 4℃. The PCR products were mixed with 10× loading buffer and subjected to agarose gel electrophoresis at 115V for 30 min. Bands were observed under UV gel imaging. Both CAV 1 and CAV 2 nucleic acid templates amplified the target bands, which were recovered using a gel extraction kit (Tiangen Biotech). Sequencing results from a sequencing company were consistent with the base sequence of the HEXON protein.
[0028] The amplified HEXON gene fragment and pET28a vector were digested with HindIII and EcoRI restriction endonucleases. The digestion reaction was carried out at 37°C for 2-3 hours. The recovered and purified digestion products (target gene and linearized vector) were mixed at a certain molar ratio (usually vector: insert = 1:3 to 1:7), and T4 DNA ligase and appropriate buffer were added. Ligation was carried out overnight at 16°C. The ligation product was transformed into E. coli DH 5α competent cells and plated on LB agar plates containing kanamycin (final concentration generally 50 μg / mL). The plates were incubated upside down at 37°C overnight. Single colonies were picked and amplified by shaking, and the plasmid was extracted. The correct construction of the recombinant plasmid was confirmed by colony PCR, double enzyme digestion verification, and sequencing.
[0029] 2. Preparation and Induction of Expression Strains The identified recombinant plasmid was transformed into Escherichia coli BL21(DE3) competent cells. Transformation was performed using the heat shock method (ice bath for 30 min → heat shock at 42℃ for 90 s → ice bath for 2 min → recovery in antibiotic-free LB medium for 1 h → kanamycin-resistant plates).
[0030] Select a single positive colony and inoculate it into LB liquid medium containing kanamycin and culture until the logarithmic growth phase (OD). 600nm Add IPTG inducer (final concentration 1.0 mmol / L) to a concentration of approximately 0.6-0.8 mmol / L, and induce at 37°C for 6-8 hours. After induction, collect the bacterial cells by centrifugation.
[0031] 3. Protein purification and identification The bacterial cells were resuspended in PBS or other buffers and sonicated (150W, 3s operation, 5s interval, total time approximately 30min, ice bath operation to prevent overheating). Subsequently, the cells were centrifuged at 12000rpm for 10-30 minutes at 4℃ to separate the supernatant (containing soluble proteins) and the precipitate (containing inclusion bodies). Purification was performed using Ni-NTA affinity chromatography (His-tagged purification). Basic steps: The lysate supernatant was bound to a nickel column → eluted with imidazole eluents of varying concentrations to remove contaminating proteins and elute the target protein → SDS-PAGE analysis of the eluted fractions and collection of the target protein. The purified protein was then subjected to SDS-PAGE electrophoresis (see...). Figure 1 Western blot identification, concentration determination (such as the Bradford method), and aliquots are stored at -80°C.
[0032] Example 2 Preparation of mouse anti-CAV HEXON protein monoclonal antibody 1. Method for detecting anti-CAV HEXON protein antibody titer The purified recombinant HEXON protein was used as the coating antigen and diluted to 1 μg / mL with carbonate buffer (pH 9.6). 100 μL was added to each well and the mixture was coated overnight at 4°C. After washing 3 times with PBST, 200 μL of PBS blocking buffer containing 5% skim milk was added to each well and the mixture was blocked overnight at 4°C. After washing 5 times with PBST, the mixture was gently patted dry on absorbent paper and stored at -20°C for later use. Remove the ELISA plate from the -20℃ freezer and allow it to reach room temperature. Add 100 μL of hybridoma cell culture supernatant to each well, along with a positive control (1:2000 dilution of fusion mouse serum) and a negative control (1:2000 dilution of negative mouse serum). Incubate at 37℃ for 1 hour. Discard the culture supernatant and wash 5 times with PBST. Add 100 μL of HRP-goat anti-mouse IgG secondary antibody (SIGMA) at an optimal dilution of 1:6000 to each well and incubate at 37℃ for 1 hour. Wash 5 times with PBST. Add 100 μL of single-component TMB chromogenic solution (KPL) to each well and incubate at 37℃ for 15 minutes. Stop the reaction by adding 50 μL of 2M sulfuric acid solution to each well. Measure the OD using an ELISA reader. 450nm Value. Judgment criteria: based on positive serum OD. 450nm The value is approximately 1.0, and the OD value is negative in serum. 450nm The system is established when the value is approximately ≤0.1, and a positive result is determined when the P / N value is >2.1.
[0033] 2. Monoclonal antibody preparation The purified recombinant HEXON protein was emulsified with an equal volume of Freund's complete adjuvant at a dose of 30 μg / mouse and injected subcutaneously into 6-week-old female BALB / c mice at multiple sites in the abdomen. Subsequently, the mice were immunized four times every 3 weeks with the same dose of antigen and an equal volume of Freund's incomplete adjuvant. Three days before cell fusion, a booster immunization was administered via intraperitoneal injection.
[0034] BALB / c mice were euthanized by enucleation and bloodletting after booster immunization. Serum was collected as a positive control for hybridoma cell screening. The serum was immediately immersed in 75% medical alcohol and left to stand for 10 minutes. The mice were then transferred to a laminar flow hood and placed supine in a sterile culture dish. The abdominal skin of the mice was aseptically opened to fully expose the abdominal wall. A separate set of sterile scissors and forceps was used to open the left abdominal wall of the mice to fully expose the spleen. The spleen was separated and placed in a petri dish pre-filled with DMEM medium containing 10% FBS. One end of the spleen was held with sterile forceps, and the culture medium in the petri dish was drawn into the spleen from the other end with a 5 mL sterile syringe. The spleen was repeatedly rinsed until it turned pale white. The separated spleen cells were injected into a 50 mL sterile centrifuge tube, thoroughly mixed, and a small amount was taken for cell counting.
[0035] Separated spleen cells were mixed with logarithmic growth phase SP2 / 0 myeloma cells at a ratio of 3:1-5:1 using PEG4000 as a fusion agent. The fused cells were added to 96-well cell culture plates pre-coated with feeder cells. Hybridoma cells were cultured in HAT-containing selective medium for 3-4 days, followed by half-volume replenishment (avoid moving the cell plate as much as possible for the first 3 days after fusion). At days 7-9, the medium was completely replaced with HT-containing medium for continued culture. When the cell clones reached 1 / 4-1 / 3 of the well bottom area, the cell supernatant was collected. The antibody level against HEXON in the cell supernatant was detected by indirect ELISA, and cell lines with high P / N ratios were screened.
[0036] 3. Subcloning and fixation of monoclonal antibody cell lines The selected positive hybridoma cell lines were subcloned using a limiting dilution method. When the cell clones reached 1 / 4-1 / 3 of the well bottom area, the cell supernatant was collected, and the antibody level against HEXON in the supernatant was detected by indirect ELISA. Cell lines with high p / n ratios were selected. After three subcloning processes, stable antibody-secreting cell lines were monocloned, resulting in four monoclonal cell lines: 1D6, 2F5, 4D4, and 8E2. The titers of the hybridoma cell culture supernatant, ascites fluid, and purified monoclonal antibodies were measured using indirect ELISA. The highest antibody titer in the cell supernatant reached over 6400, and the antibody titer in the ascites fluid reached 10. 6 The purified monoclonal antibody titer can reach over 128,000. The concentrations of purified monoclonal antibodies 2F5 and 4D4 were determined using the BCA protein quantification method.
[0037] Table 1. Antibody titer determination in hybridoma cell culture supernatant
[0038] Monoclonal antibody subclass identification kit (Sigma) was used to detect the monoclonal antibody subclass. 1D6 and 2F5 were IgG1 type, and 4D4 and 8E2 were Ig2b type.
[0039] The additive index method was used to detect the five monoclonal antibodies against two different antigenic epitopes (see Table 2).
[0040] Two high-titer monoclonal antibody hybridoma cell lines, FD-CAV-2F5 and FD-CAV-4D4, were deposited on October 29, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession numbers CGMCC No. 43711 and CGMCC No. 43712, respectively. The address of CGMCC is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The two strains are classified as hybridoma cell lines secreting canine adenovirus capsid protein antibodies.
[0041] Table 2. Results of AI analysis of antigenic epitopes recognized by clonal antibodies
[0042] It should be noted that the table uses the formula AI=(A (1+2) The overlap ratio of the two monoclonal antibodies is calculated as (A1) / A2 × 100%. Where A1 represents the OD of the first monoclonal antibody. 450nm Value; A2 represents the OD value of the second monoclonal antibody. 450nm Value; A (1+2) This indicates the OD after the superposition of two monoclonal antibodies. 450nm The AI value is determined by the superposition of the two antibodies. If the AI value is greater than 30%, the two monoclonal antibodies are considered to recognize different sites.
[0043] 4. Identification of CAV HEXON protein monoclonal antibody 2F5 and 4D4 antigenic epitopes (1) Using phage display technology, monoclonal antibodies 2F5 and 4D4 were diluted to 100 μg / mL with 0.1 M carbonate buffer (pH 9.6), coated with ELISA plates, 100 μL per well, and incubated overnight at 4°C. The coating solution was discarded, blocking buffer was added, and the plates were incubated at 4°C for 1 h. After washing, 100 μL of a solution containing 4 × 10⁻⁶ phage peptides was added. 10Phages were incubated in TBST buffer at room temperature with shaking for 1 hour. Unbound phages were discarded, and the plate was washed. 100 μL of the corresponding monoclonal antibody solution (100 μg / mL) was added to competitively elute the bound phages. The plate was then transferred to *E. coli* for amplification and phage extraction. After five rounds of washing as described above, two monoclonal antibody-enriched phage strains were obtained. After titration, ten single phage plaques from each strain were randomly selected for amplification and DNA extraction for sequencing. The core epitope sequences of the antigens bound by the two monoclonal antibodies 2F5 and 4D4 were RLQLRFVPVMQED and VQFAQATSSYFKLD, respectively. BLAST analysis of these protein sequences on NCBI revealed that they were located at amino acid positions 63–75 and 29–42 of the Hexon amino acid sequence, respectively, which are conserved sequences identical to those of canine adenovirus type 1 and type 2 in the Hexon protein.
[0044] (2) Dilute monoclonal antibodies 2F5 and 4D4 to 5 μg / mL and coat them onto ELISA plates. Add 100 μL to each well. After blocking and washing, add 100 μL of two phage strains with different antigen core sequences (containing 5 × 10⁴ phages), i.e., each monoclonal antibody reacts with two phage strains. After washing the plate, add 10,000-fold diluted HRP-goat anti-M13 monoclonal antibody to each well. After color development, read the OD. 450nm The monoclonal antibodies 2F5 and 4D4 showed strong reactions only with phages expressing their core antigenic epitope sequences, and almost no reaction with another phage strain, verifying that monoclonal antibodies 2F5 and 4D4 bind to different antigenic epitopes.
[0045] 5. Identification of cross-reactivity between monoclonal antibodies and other viral fluids The purified monoclonal antibodies 2F5 and 4D4 were coated into ELISA plates at a rate of 100 ng / well, respectively, and coated overnight at 4°C. After washing three times with PBST, 200 μL of PBS blocking buffer containing 5% skim milk was added to each well, and the plates were blocked overnight at 4°C. After washing five times with PBST, the plates were gently patted dry on absorbent paper and stored at -20°C for later use. Remove the ELISA plate from the -20℃ freezer and allow it to reach room temperature. Add 100 μL each of 1:100 diluted canine parvovirus, canine coronavirus, canine parainfluenza virus, and canine distemper virus solutions, respectively. Add PBS as a negative control. Incubate at 37℃ for 30 min. Discard the culture supernatant and wash 5 times with PBST. Add 100 μL of diluted HRP-rabbit anti-secondary antibody (anti-canine parvovirus, canine coronavirus, canine parainfluenza virus, and canine distemper virus, respectively) to each well and incubate at 37℃ for 30 min. Wash 5 times with PBST. Add 100 μL of single-component TMB chromogenic solution (KPL) to each well and incubate at 37℃ for 15 min. Stop the reaction by adding 50 μL of 2M sulfuric acid solution to each well. Measure the OD using an ELISA reader. 450nmCross-reactivity was determined by a P / N ratio greater than 2.1. Results showed that the prepared monoclonal antibody showed no cross-reactivity with other viruses (P / N ratio < 1.5), demonstrating good specificity.
[0046] Table 3. Response of Monoclonal Antibody 4D4 to Other Viruses
[0047] In the table: P / N values represent the sample OD. 450nm Value / Negative Control OD 450nm value.
[0048] Example 3: Establishment of an immunochromatographic method for detecting antigens using a double-antibody sandwich assay 1. Preparation of colloidal gold solution The test strips developed in this study used a reduction method to prepare colloidal gold. Different amounts of 1% trisodium citrate solution were added, and the colors and maximum absorption peaks of the prepared colloidal gold solutions are shown in Table 4. The colloidal gold particle size was 22 nm when the color of the solution was purplish-red, and the maximum absorption peak was 524 nm. Therefore, the optimal colloidal gold solution was prepared by adding 5 mL of 1% trisodium citrate solution to 100 mL of 0.03% chloroauric acid solution. The specific preparation method was as follows: 3 mL of 1% chloroauric acid solution was added to 97 mL of purified water, heated to boiling in a magnetic heater, and then 5 mL of 1% trisodium citrate solution was quickly added. Heating was continued for 5 minutes, and then cooled to room temperature. The maximum absorption peak of the colloidal gold solution prepared by this method was measured using a UV-Vis spectrophotometer in the 200 nm-1000 nm range. Ten repeated measurements were performed, and the results are shown in Table 5.
[0049] Table 4 shows the ratio of chloroauric acid to trisodium citrate and the maximum absorption peak corresponding to colloidal gold particles of different sizes.
[0050] Table 5. Results of repeated measurements of the maximum absorption peak in colloidal gold solution
[0051] 2. Determination of the optimal amount of colloidal gold-labeled monoclonal antibody Adjust the pH of the colloidal gold solution by adding 100 μL of 0.02 M borate buffer per mL. Then, add 5 μg, 10 μg, 15 μg, 20 μg, and 25 μg of monoclonal antibody 2F5 or 4D4 to 1 mL of colloidal gold, respectively. Mix well and incubate at room temperature for 10 min. Then, add 100 μL of 10% bovine serum albumin (BSA) solution, mix well, and incubate at room temperature for 10 min. Observe the color change of the colloidal gold. The minimum protein amount that maintains the colloidal gold solution in a purple-red color after adding canine adenovirus monoclonal antibody 2F5 or 4D4 is 20 μg, which is the optimal amount of labeled monoclonal antibody. The results are shown in Table 6.
[0052] Table 6. Color development of colloidal gold solution with different levels of canine adenovirus monoclonal antibody labeling.
[0053] 3. Preparation of gold-labeled conjugate pads Based on the determined optimal amount of labeled monoclonal antibody in colloidal gold, add 20 μg of canine adenovirus monoclonal antibody 2F5 or 4D4 per mL of colloidal gold. Stir at medium speed with a magnetic stirrer for 30 min. Then, add 100 μL of 10% bovine serum albumin (BSA) solution per mL of colloidal gold and continue stirring for 1 hour. Centrifuge at 12000 rpm for 30 min at 4°C, discard the supernatant, and resuspend the precipitate in gold-labeled diluent to 10% of the initial colloidal gold volume. Cut a 10 mm wide strip of fiberglass membrane to serve as a gold pad. Adjust the parameters of the gold spraying machine and spray the prepared gold-labeled canine adenovirus monoclonal antibody 2F5 or 4D4 solution evenly onto the gold pad at a rate of 1.5 μL / cm. Ensure the gold particles are evenly dispersed and uniformly colored. Air dry naturally at 25°C under 40% humidity and seal for later use.
[0054] 4. Determination of the concentration of the T-line coated monoclonal antibody Canine adenovirus monoclonal antibodies 4D4 or 2F5 were diluted to 0.5 mg / mL, 1.0 mg / mL, and 1.5 mg / mL, respectively, and coated onto nitrocellulose membranes to form the detection line T. These were then combined with another monoclonal antibody-labeled gold pad to prepare test strips. The TCID levels were then measured... 50 Canine adenovirus type 1 and type 2 viral suspensions were serially diluted with PBS to 10000, 1000, 100, and 10 TCID values. 500.1 mL of virus diluent was added to each test strip for detection, and PBS was added as a negative control. Results showed that when using monoclonal antibody 4D4 as the capture antibody to coat the detection T line at a concentration of 1.0 mg / mL, the T line showed the strongest color development at all dilutions, while the negative control showed no color development. However, when using monoclonal antibody 2F5 as the capture antibody, the coating concentration needed to be increased to 1.5 mg / mL to achieve the same color development effect (see Table 7). Therefore, canine adenovirus monoclonal antibody 4D4 (monoclonal antibody 2F5 gold-labeled pad) was selected to coat the detection T line, with an optimal coating concentration of 1.0 mg / mL.
[0055] Table 7. Colorimetric results of detecting T-line coated with different concentrations of monoclonal antibody.
[0056] In Table 7: "+" indicates color development, and the degree of color development increases with the number of "+" signs; "-" indicates no color development.
[0057] 5. Determination of the coating concentration of the quality control C line Goat anti-mouse IgG was diluted to 1.0 mg / mL and 1.2 mg / mL, respectively, and coated to prepare test strips. The TCID levels were then measured... 50 Canine adenovirus type 1 and type 2 viral fluids were serially diluted with PBS to 10,000 and 1,000 TCID. 50 0.1 mL of virus diluent was added to each test strip for detection. Results showed that when the control C-line coating concentration was 1.2 mg / mL, the C-line color development was closest to that of the high-virus-concentration T-line. Therefore, the optimal control C-line coating concentration was selected as 1.2 mg / mL.
[0058] Table 8. Color development of different concentrations of goat anti-mouse IgG coated on the quality control C line.
[0059] In Table 8, "+" indicates color development, and the degree of color development increases with the number of "+" signs; "-" indicates no color development.
[0060] 6. Determination of Sample Diluent Three solutions were used as sample diluents: 0.02 mol / L PBS (sample #1), 0.02 mol / L PBS + 0.2% Tween-20 (sample #2), and 0.02 mol / L PBS + 0.5% BSA (sample #3). The TCID values were then measured. 50 Canine adenovirus type 1 and type 2 viral fluids were diluted to 10,000 TCID using sample dilution buffer. 50 / 0.1mL, 0.1mL of virus diluent was added to each test strip for detection, and the corresponding sample diluent was added as a negative control. The results showed that the positive virus solution of sample diluent #2 (0.02mol / L PBS + 0.2% Tween-20) showed the strongest color development, and sample diluent #2 did not show color development as a negative control.
[0061] Table 9. Color development using different sample diluents
[0062] In Table 9, "+" indicates color development, and the degree of color development increases with the number of "+" signs; "-" indicates no color development.
[0063] 7. Determination of detection sensitivity TCID already measured 50 Canine adenovirus type 1 and type 2 viral fluids were serially diluted with sample diluent to 1000, 100, 10, and 1 TCID. 50 / 0.1mL, 0.1mL of virus diluent was added to each test strip for detection. The results showed that the test strip method established in this invention was effective in detecting TCID in samples. 50 TCID can be detected when the value is ≥10. 50 When the T line is less than 10, it is either not obvious or absent. Therefore, the sensitivity of the test strip for detecting canine adenovirus type 1 and type 2 is 10 TCID. 50 / 0.1mL, the results are shown in Table 10 and Figure 2 Furthermore, compared with commercially available test strips, the method established in this invention exhibits higher sensitivity for canine adenovirus type 1 detection than commercially available test strips; however, its sensitivity for canine adenovirus type 2 is the same as that of commercially available test strips.
[0064] Table 10 Results of sensitivity testing for different subtypes of canine adenovirus
[0065] In Table 10, "+" indicates color development, and the degree of color development increases with the number of "+" signs; "-" indicates no color development.
[0066] 8. Determination of detection specificity Cultures of susceptible cells inoculated with canine parvovirus, canine coronavirus, canine parainfluenza virus, and canine distemper virus were tested. The results showed that the test strips established in this invention had no cross-reactivity with the above-mentioned viral solutions, proving that the method established in this invention has good specificity.
[0067] Example 4: Concordance rate of double-antibody sandwich antigen test strips in detecting clinical samples The canine adenovirus antigen detection test strip based on a double-antibody sandwich assay was developed in this invention. Sixty-nose swabs collected clinically from dogs were tested. The results were then verified using the T / CVMA 45-2020 canine adenovirus PCR nucleic acid detection method. The concordance rate between the two methods was 91.3% (63 / 69), as shown in Table 11. This demonstrates that the test strip developed in this invention can specifically detect both canine adenovirus types 1 and 2, and exhibits excellent clinical application results.
[0068] Table 11 Detection results of canine adenovirus antigen test strips on clinical samples
[0069] In Table 11, "+" indicates color development and a positive result; "-" indicates no color development and a negative result.
[0070] Example 5: Establishment of a Double-Sandwich ELISA Quantitative Detection Method 1. Preparation of monoclonal antibody-coated ELISA plates Dilute the canine adenovirus monoclonal antibody 2F5 to 2 μg / mL with 0.1 M carbonate buffer (pH 9.6), add 100 μL / well, and coat the plate at 2-8℃ for 16 hours. The next day, discard the coating solution, blot dry, and wash the plate three times with PBST buffer (300 μL / well). Discard the washing buffer, add blocking buffer (PBS containing 5% BSA, pH 7.2-7.4), 200 μL / well, and block overnight at 2-8℃. The next day, discard the blocking buffer, blot dry, and wash the plate three times with PBST buffer (300 μL / well). Discard the washing buffer, blot dry, and store at -20℃ for later use.
[0071] 2. Preparation of HRP-labeled canine adenovirus monoclonal antibody 4D4 Monoclonal antibody 4D4 was dialyzed in 50 mM carbonate buffer (0.015 M Na₂CO₃, 0.035 M NaHCO₃, pH 9.6), with two buffer changes. The concentration of the monoclonal antibody was determined using the BCA protein quantification method. The concentration of 4D4 was adjusted to 2 mg / mL using carbonate buffer. 2 mg of HRP powder was weighed and dissolved in 100 μL of ultrapure water. 21 mg of NaIO₄ was weighed and dissolved in 1 mL of ultrapure water. 100 μL of NaIO₄ solution was slowly mixed with 100 μL of HRP solution and allowed to stand at 4°C for 30 min; the solution was green at this point. 2 μL of ethylene glycol was slowly added to the oxidized HRP solution and allowed to stand at room temperature in the dark; the solution was brown at this point. The oxidized HRP solution was then directly added to the dialyzed monoclonal antibody 4D4 solution, and the reaction was allowed to proceed at room temperature for 2 h. Weigh 0.4 mg of NaBH4 and dissolve it in 20 µL of ultrapure water. Add the entire solution to the reaction mixture from the previous step and incubate at 4°C for 2 hours, shaking every 30 minutes. Transfer HRP-4D4 to a 10 kDa dialysis bag and dialyze against PBS buffer for 24 hours, changing the buffer three times during this period. Collect the HRP-4D4 from the dialysis bag and filter it through a 0.2 μm sterile filter for sterilization. Store at -80°C in the dark for long-term storage. Dilute the HRP-labeled monoclonal antibody 4D4 with PBS, determine its optimal dilution using a sandwich ELISA method, add enzyme-labeled antibody stabilizer to prepare a 100× enzyme-labeled antibody stock solution, aseptically aliquot, and store at 2–8°C in the dark.
[0072] 3. Determination of the ELISA quantitative standard curve Take the measured TCID 50 Canine adenovirus type 1 and type 2 viral fluids were serially diluted with sample diluent (PBS, pH 7.2-7.4) to six gradients (100000, 10000, 1000, 100, 10, 0 TCID). 50 / 0.1mL). Add 100μL of virus dilution buffer to each well, mix gently, and incubate at 37℃ for 60 min. Discard the reaction solution, add 300μL of PBST washing buffer to each well, wash 5 times, and gently pat dry the well after the last wash. Dilute 100×HRP-labeled canine adenovirus monoclonal antibody 4D4 100-fold with enzyme-labeled antibody dilution buffer (1% BSA in PBST, pH 7.2-7.4), 100μL / well, and incubate at 37℃ for 60 min. Remove the reaction plate, discard the reaction solution, add 300μL of 1× washing buffer to each well, wash 5 times, and gently pat dry the well after the last wash. Add substrate chromogenic solution, 100μL / well, and incubate at 37℃ for 15 min. Add stop solution (2M sulfuric acid solution), 50μL / well, and read the OD. 450nm Values. The results showed that when monoclonal antibody 2F5 was used as the coating monoclonal antibody and HRP-4D4 was used as the detection monoclonal antibody, the viral load and OD value of different canine adenovirus dilutions showed a good linear relationship (Table 12). Figure 3Therefore, in ELISA quantitative detection, 100000, 10000, 1000, 100, 10, and 0 TCID values were selected. 50 Six gradient samples, including 0.1 mL, were used as standard curve quality control samples to establish a standard curve for quantitative detection of virus content in the samples.
[0073] Table 12 ELISA Quantitative Standard Curve Detection Results
[0074] Example 6: Quantitative detection of canine adenovirus content using ELISA method Sixteen canine adenovirus-positive samples detected in Example 4 were taken, and six tubes each of diluted canine adenovirus type 1 and type 2 standard curve quality control samples were taken (virus content of 100,000, 10,000, 1,000, 100, 10, and 0 TCID, respectively). 50 (0.1 mL), along with the sample, was subjected to the above-mentioned double monoclonal antibody sandwich ELISA assay. The OD of the quality control was determined according to the standard curve. 450nm A standard curve was established using the average values (type 1 and type 2), and the OD values of the positive samples were then analyzed. 450nm Substituting the values into the standard curve, the content of canine adenovirus in the positive samples was calculated, and the results are shown in Table 13.
[0075] Table 13 ELISA Quantitative Detection Results of Positive Samples
[0076] In Table 13, "+" indicates color development and a positive result; "-" indicates no color development and a negative result.
[0077] The above description is a preferred embodiment of the invention. It should be noted that, for those skilled in the art, several improvements and modifications can be made without departing from the principle of the invention, and these improvements and modifications are also considered to be within the scope of protection of the invention.
Claims
1. A hybridoma cell line FD-CAV-2F5, which was deposited on October 29, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 46711. The address of the China General Microbiological Culture Collection Center is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.
2. A hybridoma cell line FD-CAV-4D4, which was deposited on October 29, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 46712. The address of the China General Microbiological Culture Collection Center is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.
3. A monoclonal antibody, characterized in that, It is secreted by the hybridoma cell line FD-CAV-2F5 as described in claim 1.
4. A monoclonal antibody, characterized in that, It is secreted by the hybridoma cell line FD-CAV-4D4 as described in claim 2.
5. The use of the monoclonal antibody as described in claim 1 or 2 in the preparation of reagent strips or kits for detecting canine adenovirus.
6. A test strip for detecting canine adenovirus, characterized in that, It includes a base plate and a colloidal gold pad and a nitrocellulose membrane disposed on the base plate. The colloidal gold pad includes colloidal gold particles and a first monoclonal antibody, and the nitrocellulose membrane is provided with a second monoclonal antibody. The first monoclonal antibody is monoclonal antibody 2F5, and the second monoclonal antibody is monoclonal antibody 4D4; or The first monoclonal antibody is monoclonal antibody 4D4, and the second monoclonal antibody is monoclonal antibody 2F5; The monoclonal antibody 2F5 was secreted by the hybridoma cell line FD-CAV-2F5, which was deposited on October 29, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 46711. The monoclonal antibody 4D4 is secreted by the hybridoma cell line FD-CAV-4D4, which was deposited on October 29, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 46712.
7. The test strip for detecting canine adenovirus as described in claim 6, characterized in that, The first monoclonal antibody is monoclonal antibody 2F5, and the second monoclonal antibody is monoclonal antibody 4D4.
8. The test strip for detecting canine adenovirus as described in claim 6, characterized in that, The nitrocellulose membrane also includes anti-mouse IgG antibodies, which are anti-mouse IgG polyclonal antibodies.
9. The test strip for detecting canine adenovirus as described in claim 1, characterized in that, The labeling level of the first monoclonal antibody is 20 μg / mL to 25 μg / mL; and / or The colloidal gold particles have a particle size of 20nm~35nm and a maximum absorption peak wavelength of 520nm~525nm. The second monoclonal antibody is monoclonal antibody 2F5, with a coating concentration of 1.0 mg / mL to 1.5 mg / mL; or The second monoclonal antibody is monoclonal antibody 4D4, with a coating concentration of 0.8 mg / mL to 1.2 mg / mL.
10. The test strip for detecting canine adenovirus as described in claim 8, characterized in that, The labeling level of the first monoclonal antibody was 20 μg / mL; and / or The colloidal gold particles have a particle size of 22 nm and a maximum absorption peak wavelength of 524 nm; and / or The second monoclonal antibody is monoclonal antibody 4D4, with a coating concentration of 1.0 mg / mL; and / or The coating concentration of the anti-mouse IgG antibody was 1.2 mg / mL.
11. A kit for quantitative detection of canine adenovirus, characterized in that, It includes an ELISA plate coated with a first monoclonal antibody and an enzyme-labeled second monoclonal antibody; The first monoclonal antibody is monoclonal antibody 2F5, and the second monoclonal antibody is monoclonal antibody 4D4; or The first monoclonal antibody is monoclonal antibody 4D4, and the second monoclonal antibody is monoclonal antibody 2F5; The monoclonal antibody 2F5 was secreted by the hybridoma cell line FD-CAV-2F5, which was deposited on October 29, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 46711. The monoclonal antibody 4D4 is secreted by the hybridoma cell line FD-CAV-4D4, which was deposited on October 29, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 46712.
12. The kit for detecting canine adenovirus as described in claim 11, characterized in that, The first monoclonal antibody is monoclonal antibody 2F5, and the second monoclonal antibody is monoclonal antibody 4D4.
13. The kit for detecting canine adenovirus as described in claim 11, characterized in that, The second monoclonal antibody was labeled with HRP enzyme.