SNP (Single Nucleotide Polymorphism) marker related to ovary maturation of freshwater shrimps, detection primer and application of SNP marker
By using the SNP marker T+15207C in the exon region of the cathepsin D gene of freshwater shrimp, the problems of excessively high stocking density and small growth size caused by the rapid maturation of freshwater shrimp ovaries were solved, thus achieving efficient breeding of a new late-maturing freshwater shrimp variety.
Patent Information
- Application Number
- CN202511838902.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-08
- Publication Date
- 2026-04-17
AI Technical Summary
Rapid ovarian maturation in freshwater shrimp leads to problems such as excessively high stocking density and smaller growth size. Existing technologies make it difficult to accurately select late-maturing individuals in pond-bred freshwater shrimp.
A SNP marker T+15207C located in the exon region of the cathepsin D gene in shrimp was developed. Corresponding detection primers were designed, and the genotype of female shrimp was determined by PCR amplification and sequencing to screen out female shrimp with slow ovarian development.
It can quickly and accurately screen out female shrimp with slower ovarian development without being affected by the ovarian development cycle and environmental factors, thereby improving the parent selection efficiency and shortening the breeding cycle for new late-maturing freshwater shrimp varieties.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] This invention relates to a SNP marker, detection primer and its application related to the ovarian maturation of shrimp, and belongs to the field of biotechnology. Background Technology
[0002] The freshwater prawn, scientifically known as *Macrobrachium nipponense*, is widely distributed in my country. It is characterized by rapid growth, rapid reproduction, and strong adaptability, making it an important freshwater aquaculture species. Its delicious meat, high in protein and low in fat, is highly prized. However, the rapid sexual maturation of freshwater prawns has been a significant factor hindering the efficient development of freshwater prawn farming. During the breeding season (late March to early April), when water temperature and light levels are suitable, the ovaries of freshwater prawns begin to develop from an undeveloped state (stage one) until maturity (stage four), at which point they begin mating and spawning. After spawning, the ovaries empty, and the prawns enter the next developmental stage (stage one). The ovarian maturation cycle gradually shortens as the temperature rises. Especially in summer and autumn, when the water temperature is around 30℃, the ovarian maturation cycle can be as short as about 15 days. Rapid ovarian maturation in female prawns leads to frequent mating and spawning, resulting in problems such as multiple generations living together in the same pond, high stocking density, increased feed consumption, and a significantly increased risk of oxygen deficiency. Furthermore, overbreeding causes female prawns to become smaller in size, seriously affecting the healthy development of the freshwater prawn industry. Therefore, selecting female shrimp with relatively slow ovarian maturation rates as broodstock to cultivate new late-maturing freshwater shrimp varieties and alleviate the bottleneck of multi-generational farming is of great significance for improving the farming size of freshwater shrimp and enhancing the economic benefits of the freshwater shrimp industry.
[0003] Traditional pond shrimp breeding is based on phenotypic screening, with growth traits such as body length and weight being easily observed and recorded. However, the ovarian development of shrimp is cyclical and continuous, and greatly affected by environmental factors such as temperature. It is only easy to observe in the initial stage, and the developmental sequence cannot be determined once the cycle begins. This problem has become a challenge in the breeding of new late-maturing shrimp varieties.
[0004] Molecular marker-assisted selection (MMR) utilizes molecular markers closely associated with target genes to screen individuals for specific regions, thereby obtaining individuals with desired traits and improving breeding efficiency and accuracy. Currently, MMR has become a hot topic, but in crustaceans, only a few growth- and disease-resistance-related markers have been reported, with limited applications in other areas. While the rate of gonadal development in crustaceans is significantly influenced by external environmental factors (temperature, light, etc.), it is primarily determined by endogenous genetic factors. The rate of ovarian development varies among female shrimp, leading to significant differences in the number of times different females carry eggs within the same breeding season and pond. If molecular markers associated with slow ovarian maturation are identified, the breeding process of pond-bred freshwater shrimp can be conducted without interference from the cyclical and continuous nature of ovarian development or external environmental factors. Slow-developing females can be quickly and accurately screened from candidate parent populations, accelerating the breeding process and improving breeding efficiency. Summary of the Invention
[0005] Technical issues This invention addresses the problems of rapid ovarian maturation in female freshwater shrimp during peak breeding season, leading to excessively high stocking densities and miniaturized growth. It provides an SNP marker and detection primer related to ovarian maturation in freshwater shrimp and applies them to parental screening for breeding new late-maturing freshwater shrimp varieties.
[0006] Technical solution This invention provides an SNP marker related to ovarian maturation in shrimp, located in the exon region of the shrimp cathepsin D gene. The nucleotide sequence of the shrimp cathepsin D gene is shown in SEQ ID NO: 1. The SNP marker is located at the 15207bp position at the 5' end of the cathepsin D gene sequence shown in SEQ ID NO: 1, where the base is C or T, i.e., the SNP marker T+15207C. The site exhibits homozygous CC, TT and heterozygous CT types.
[0007] The gonadal development index of individuals with the SNP marker T+15207C and the CC genotype was significantly lower than that of individuals with the TT and CT genotypes. P <0.05), and the amino acid composition was not altered at this site.
[0008] The present invention provides a primer pair for detecting the SNP marker, the upstream primer SEQ ID NO: 3 and the downstream primer SEQ ID NO: 4.
[0009] This invention provides a method for screening female shrimp with slow ovarian development using the primer pair, comprising the following steps: (1) Extract the genomic DNA of female shrimp, wherein the female shrimp may be at any different ovarian maturation stage; the genomic DNA may be derived from the muscle tissue of female shrimp. (2) Using the genomic DNA obtained in step (1) as a template, PCR amplification was performed using the primer pair (primers for detecting SNP marker T+15207C) to obtain PCR products; (3) Sequencing the PCR amplification products obtained in step (2), determining the genotype of the sample to be tested marked with T+15207C based on the sequencing results, and screening individuals marked with T+15207C as CC genotype as female shrimp with slow ovarian development.
[0010] This invention provides a kit for screening female freshwater shrimp with slow ovarian development, containing the primer pair described above.
[0011] Beneficial effects The SNP marker T+15207C related to ovarian development in female freshwater shrimp provided by this invention can isolate female shrimp with slow ovarian development at any time, regardless of the cyclical and continuous nature of ovarian development or environmental temperature. It can be used to screen female parents with slow gonadal development during the breeding of new late-maturing freshwater shrimp varieties, thereby improving the efficiency of parent selection and shortening the breeding cycle. Detailed Implementation
[0012] Example 1: Obtaining a SNP marker associated with ovarian maturation in freshwater shrimp (1) Analysis of the cathepsin D gene sequence: The genomic and cDNA sequences of the cathepsin D gene were retrieved from the prawn genome library, as shown in SEQ ID NO: 1 and SEQ ID NO: 2.
[0013] By comparing the cDNA sequence of the cathepsin D gene with the genomic sequence and using the GU-AG rule, it was determined that the cathepsin D gene contains 8 introns and 9 exons.
[0014] Exons and their upstream and downstream sequences were selected as molecular marker screening regions for primer screening and design. The primer list is shown in Table 1.
[0015] Table 1 PCR primers
[0016] (2) SNP marker filtering All the Macrobrachium nipponense used were from the Dapu Base of the Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences. Ten Macrobrachium nipponense were randomly selected, and genomic DNA was extracted according to the DNA extraction method for animal tissues in "Molecular Cloning: A Laboratory Manual". PCR amplification was carried out with DNA as the template. The reaction system was a 25-µL system, and the specific system is shown in Table 3-4. The PCR reaction program was as follows: First, pre-denature at 94 °C for 3 min; then go through 35 cycles of denaturation (94 °C, 30 s), annealing (55 °C, 30 s), and extension (72 °C, 30 s); after 35 cycles, perform an additional 10-min extension (72 °C); finally, cool down to 4 °C. The quality of the PCR products was detected by agarose gel electrophoresis. Products with single, bright bands, no trailing or miscellaneous bands, and accurate product sizes were considered qualified, and the products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The MEGA 11.0 software was used for sequence alignment and SNP marker searching, and 6 polymorphic markers were preliminarily screened, as shown in Table 2.
[0017] The primer pairs corresponding to C+5635T, T+5768A, and G+5904A are F1-R1, the primer pair corresponding to T+6404C is F2-R2, and the primer pairs corresponding to T+15139C and T+15207C are F4-R4.
[0018] (3)Association analysis of SNP and ovarian maturation All the Macrobrachium nipponense used were from the Dapu Base of the Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences. In August 2023, well-developed, uninjured, and normal-shaped male and female parents were selected and paired in a 1:1 ratio of female to male to construct full-sib families. After the offspring hatched, they were cultured in outdoor net cages and fed a formulated feed once at 8:00 am and 6:00 pm every day, with the feeding amount being 5% of the shrimp body weight. After overwintering until April 2024, the offspring grew into adults, and at this time, the gonads began to develop. 200 female shrimp were randomly selected from each family and the gonad development index was measured one by one (gonad development index = gonad weight / body weight %). Finally, 175 individuals obtained valid gonad development data, and the corresponding individual muscle tissues were placed in absolute ethanol and stored at -20 °C.
[0019] According to the DNA extraction method for animal tissues in "Molecular Cloning: A Laboratory Manual", genomic DNA was extracted from 175 full-sib female shrimp. PCR amplification and sequencing of the DNA of each shrimp were carried out using primers (F1-R1, F2-R2, and F4-R4) to obtain the genotypes of each marker. The SPSS 27.0.1 software was used to process the screened SNPs and gonad development indices, and multivariate variance and independent-sample t-tests in the general linear model were used for analysis.
[0020] The results showed that among the six SNP loci, the T+15207C marker was significantly associated with ovarian maturation. P <0.05). The gonadal development index of individuals with the CC genotype T+15207C was 1.01±0.13, significantly lower than that of individuals with the TT genotype (2.49±1.34) and the CT genotype (2.56±1.54). P <0.05 (Table 2), there was no significant difference in the gonadal development index between the TT genotype and the CT genotype. P >0.05). The genotypes of the other five SNP loci were not associated with ovarian maturation. P >0.05).
[0021] Table 2. Correlation between SNP sites and ovarian maturity ( P< 0.05)
[0022] Example 2: Application of the T+15207C marker in late-maturing breeding of freshwater shrimp (1) Preparation of family materials The freshwater shrimp used all came from the Dapu Base of the Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences. In August 2024, well-developed, uninjured, and normal-shaped male and female parent shrimp were selected and paired at a female:male ratio of 1:1 to establish full-sib families. After hatching, they were placed in outdoor net cages for rearing, and fed formulated feed twice a day, at 8:00 AM and 6:00 PM, at a rate of 5% of the shrimp's body weight. Until September 2024, when the sex could be distinguished by the fifth walking legs but the ovaries had not yet developed (stage one), 200 female shrimp (weight: 0.371±0.12g, body length: 19.38±2.23mm) were randomly selected from the families for temporary rearing in individual net cages.
[0023] (2) Genotyping analysis of the T+15207C locus in the screening of late-maturing populations DNA was extracted from the last pair of swimming legs of each individual, and the T+15207C locus region of each individual was amplified using primers F4-R4. The amplified products were sequenced, and the T+15207C locus was genotyped based on the sequencing peak diagram. Individuals with the CC genotype were separated and cultured in the same pond as individuals with the TT and CT genotypes in separate net cages. After overwintering until April 2025, the offspring grew into adults and their gonads began to develop. The gonadal development index of individuals with the CC genotype and individuals with the TT and CT genotypes was measured. SPSS 27.0.1 software was used to process the gonadal development index of the two groups, and independent samples t-tests were performed for analysis. The results showed that the mean gonadal development indices of individuals with the detected CC, CT, and TT genotypes were 1.66±0.32, 5.32±2.01, and 4.88±1.82, respectively (Table 3).
[0024] Table 3. Genotyping ratio of T+15207C locus in late-maturing populations ( P< 0.05)
[0025] In summary, by selecting the CC genotype at the T+15207C locus, female shrimp with slower ovarian development can be isolated at any time, regardless of the cyclical and continuous nature of ovarian development or the influence of environmental temperature. In the breeding of new late-maturing varieties of freshwater shrimp, the application of this marker can significantly improve the screening efficiency of late-maturing female parents and greatly shorten the breeding cycle.
[0026] SEQ ID NO: 1 Crawfish cathepsin D gene SEQ ID NO: 2 CDNA of cathepsin D gene in freshwater shrimp SEQ ID NO: 3 Upstream primer TATACAAAGCCCTAACGGCATGA SEQ ID NO: 4 Downstream primer CTGAGAATGTAGTCCTTGCCCTC.
Claims
1. A SNP marker associated with ovarian maturation in freshwater shrimp, characterized in that, Located at 15207 bp at the 5' end of the shrimp cathepsin D encoding gene, the nucleotide sequence of the shrimp cathepsin D encoding gene is shown in SEQ ID NO: 1, where the bases are C or T.
2. The SNP marker according to claim 1, characterized in that, The gonadal development index of individuals with the CC genotype was significantly lower than that of individuals with the TT and CT genotypes.
3. The SNP marker according to claim 1, characterized in that, The gonadal development index is the percentage of gonadal weight to the total weight of the shrimp.
4. A primer pair for detecting the SNP marker of claim 1, characterized in that, Upstream primer SEQ ID NO: 3 and downstream primer SEQ ID NO:
4.
5. A method for screening female shrimp with slow ovarian development using the primer pair described in claim 4, characterized in that, Includes the following steps: (1) Extract genomic DNA from female freshwater shrimp; the female freshwater shrimp belong to any different ovarian maturation stage; the genomic DNA can be derived from the muscle tissue of female freshwater shrimp; (2) Using the genomic DNA obtained in step (1) as a template, PCR amplification was performed using the primer pair (primers for detecting SNP marker T+15207C) to obtain PCR products; (3) Sequencing the PCR amplification products obtained in step (2), determining the genotype of the sample to be tested marked with T+15207C based on the sequencing results, and screening individuals marked with T+15207C as CC genotype for female shrimp used for late-maturing breeding.
6. A kit for screening female shrimp with slow ovarian development, characterized in that, It contains the primer pair as described in claim 4.
7. The application of the SNP marker of claim 1, the primer pair of claim 4, or the kit of claim 6 in screening female shrimp with slow ovarian development.