Application of a KASP molecular marker for round melon fruit type in the identification of melon fruit type
Genotyping using KASP molecular markers for round-fruited melons during the seedling stage solves the problems of long cycles and low efficiency in traditional breeding, enabling accurate early screening and efficient breeding, and improving the precision and efficiency of round-fruited melon breeding.
Patent Information
- Application Number
- CN202610346065.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-20
- Publication Date
- 2026-05-26
- Estimated Expiration
- 2046-03-20
AI Technical Summary
Traditional breeding methods are time-consuming and inefficient in improving the shape of melon fruits. They are difficult to target precisely and rely on experience and luck, making it impossible to accurately screen for round-shaped melons in the early stages.
Using the KASP molecular marker (FSI9.1-6) for round-fruited melons, PCR amplification and fluorescence detection were performed. Specific primers were designed using the SNP site chr09:21758042bp of Melon (DHL92) v4 in the genome to identify the genotype of melon seedling DNA and accurately screen for round-fruited plants.
Accurately selecting round-fruited individual plants during the seedling stage significantly shortens the breeding cycle, improves screening efficiency, reduces resource waste, lowers costs, and achieves precision breeding.
Smart Images

Figure CN121874397B_ABST
Abstract
Description
Technical Field
[0001] This application belongs to the field of genetic engineering technology, and relates to the fields of melon genetics, molecular marker technology and plant protection. Specifically, it relates to the application of a KASP molecular marker for melon round fruit type in the identification of melon fruit type. Background Technology
[0002] In recent years, marker-assisted breeding has been widely applied. This technology enables rapid screening of target materials at the molecular level, significantly shortening breeding time and improving breeding efficiency. Among numerous molecular markers, single nucleotide polymorphisms (SNPs) are DNA sequence polymorphisms caused by variations such as deletions, insertions, transitions, and transversions of single nucleotides at the genomic level. They are characterized by their large number, wide distribution, and high genetic stability. Competitive allele-specific PCR (KASP), as a haploidentical SNP genotyping technique, offers advantages such as low cost, high flexibility, and high accuracy. It is also applicable to various equipment platforms, providing strong technical support for marker-assisted breeding.
[0003] In the field of melon breeding, fruit shape is an important agronomic trait, usually defined by fruit length (FL), fruit diameter (FD), and fruit shape index (FSI, i.e., the ratio of FL to FD). Compared to wild melons, domesticated melons exhibit a richer variety of fruit shapes, including oval, oblate, elliptical, oblong, pear-shaped, and elongated. Among these, round-fruited melons show more uniform fruit development and a higher marketable fruit rate compared to long-fruited melons. Furthermore, round-fruited fruits are more resistant to impact and compression during harvesting and transportation, which is crucial for reducing mechanical damage, lowering transportation costs, and increasing market value. Therefore, the genetic improvement of round-fruited melons has become one of the current research focuses in breeding work.
[0004] However, traditional breeding methods suffer from problems such as long cycles and low efficiency, and are difficult to use for precise and targeted crop improvement. They are also highly unpredictable and lack a clear direction, leading to a significant reliance on experience and luck in breeding efforts. Summary of the Invention
[0005] The purpose of this application is to provide an application of the KASP molecular marker for round fruit type in melons in the identification of melon fruit type. This allows for the use of molecular marker-assisted selection breeding to accurately identify melon fruit type during the seedling stage, thereby efficiently screening and breeding melon varieties with round fruit type.
[0006] To achieve the above objectives, this application provides an application of a KASP molecular marker for round fruit type in melons in identifying melon fruit type. The nucleotide sequence of the KASP molecular marker (FSI9.1-6) is shown in SEQ ID NO: 1; wherein, the genotype of n is G / T; when the genotype of n is T, the corresponding phenotype is long fruit type; when the genotype of n is G, the corresponding phenotype is round fruit type.
[0007] When the KASP molecular marker is applied to identify melon fruit type, the identification method includes the following steps:
[0008] Genomic DNA of the target melon is extracted, and PCR amplification is performed using the genomic DNA of the target melon as a template. Fluorescence detection is performed based on the primer pair of the KASP molecular marker to obtain the gene type of the target melon. Based on the detected gene type, the trait of the target melon is determined.
[0009] Furthermore, the KASP molecular marker was designed based on the SNP site chr09:21758042bp of Melon (DHL92) v4 in the melon genome.
[0010] Furthermore, the SNP site is located at the 51st base of the nucleotide sequence shown in SEQ ID NO: 1, and the base of the SNP site is mutated from G to T.
[0011] Furthermore, the polymorphism of the KASP molecular marker is G or T, the TT genotype is long fruit type, the GG genotype is round fruit type, and the GT genotype is pear type.
[0012] Furthermore, the primer pairs for the KASP molecular marker include forward primer F1 as shown in SEQ ID NO.2, forward primer F2 as shown in SEQ ID NO.3, and reverse primer R as shown in SEQ ID NO.4.
[0013] Furthermore, the PCR amplification reaction system is as follows: 1 μL of Hanchen Guangyi 2× PACE Master Mix, 0.003 μL of forward primer F1, 0.003 μL of forward primer F2, 0.008 μL of reverse primer R, and 1 μL of genomic DNA at concentrations of 10 ng / μL-100 ng / μL, for a total reaction volume of 2.014 μL.
[0014] Furthermore, the PCR amplification reaction procedure includes the following steps:
[0015] Pre-denaturation at 94℃ for 10 min;
[0016] The annealing process was repeated 10 times, starting at 61℃ and followed by denaturation at 95℃ for 20 seconds. The annealing temperature was then reduced by 0.6℃ each time.
[0017] Denaturation at 95℃ for 20 seconds, annealing at 55℃ for 40 seconds, repeated 48 times;
[0018] Extend for 30 seconds at 30℃;
[0019] Store at 4°C.
[0020] Furthermore, the primer pairs of the KASP molecular marker can be used to prepare a kit for identifying KASP molecular markers for melon fruit types.
[0021] Furthermore, the primer pairs of the KASP molecular marker can be used for the breeding of melon fruit-type germplasm.
[0022] In summary, this application has the following advantages:
[0023] 1. This application utilizes the provided KASP molecular marker (FSI9.1-6) to perform genotyping solely through cotyledon DNA extraction during the melon seedling stage, accurately screening for round-fruited individual plants. This overcomes the limitation of traditional breeding, which requires waiting for fruit maturity and phenotypic observation before selection, thus significantly shortening the breeding cycle and accelerating the breeding process. This molecular marker is located at a key SNP site (21758042 bp) on melon chromosome 9 and is closely linked to the round-fruited trait. Genotyping results obtained using KASP technology are accurate and reliable, unaffected by environmental factors or phenotypic observation errors. Compared to traditional phenotypic selection relying on experience and luck, the molecular marker-assisted selection technology provided in this application is more precise and objective, greatly improving screening efficiency.
[0024] 2. By applying the KASP molecular marker and identification method of this application, breeders can eliminate non-round-fruited plants (such as long-fruited T:T genotypes) that do not meet breeding objectives at the seedling stage, thereby significantly reducing the size of the breeding population subsequently transplanted to the field. This not only reduces the manpower, material resources, and land costs required for field management, phenotypic surveys, and fruit trait testing, but also effectively reduces resource waste. Attached Figure Description
[0025] To more clearly illustrate the technical solutions of the embodiments of this application, the drawings used in the description of the embodiments of this application will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0026] Figure 1 This is a phenotypic diagram of the parent fruits proposed in Example 1 of this application.
[0027] Figure 2 This is the QTL positioning diagram of the round melon fruit based on GBS proposed in Embodiment 1 of this application.
[0028] Figure 3 This is a typing diagram of the FSI9.1-6 molecular marker proposed in Example 2 of this application in the parental materials, Yangjiaomi and VED and their F1 generation.
[0029] Figure 4 This is the typing diagram of the FSI9.1-6 molecular marker proposed in Example 3 of this application in the BC1P1 population.
[0030] Figure 5 This is the typing diagram of the FSI9.1-6 molecular marker proposed in Example 3 of this application in the BC1P2 population. Detailed Implementation
[0031] The technical solutions of the embodiments of this application will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this application, not all embodiments. Based on the embodiments of this application, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this application.
[0032] In one aspect, this application provides a KASP molecular marker for melon round fruits, the nucleotide sequence of which is shown in SEQ ID NO: 1; wherein, SEQ ID NO: 1: ATTTTGTGCAATCATTTTCTTATCGTCTCCAGTTGGCAGTTAGTGGTAAT n CCTGGAGGAAATTTATGGATGCGCAGATGCTTGGAGTCTGGACGGTCATA.
[0033] Among them, the genotype of n is G / T. When n is T, the phenotype corresponding to the T genotype is long fruit type; when n is G, the phenotype corresponding to the G genotype is round fruit type.
[0034] In a specific implementation, the KASP molecular marker was developed based on the following method:
[0035] S101. Using the long-fruited melon material "Yangjiaomi" with significant differences in fruit shape as parents, and the round-fruited melon material "VED", the F1 population was obtained. Self-pollination was then carried out to obtain the F2 population with rich diversity in fruit shape.
[0036] S102. DNA was extracted from the leaves of the parents and the F2 population using CTAB (hexadecyltrimethylammonium bromide).
[0037] S103. Sequencing of the parents and F2 population was performed using GBS technology.
[0038] S104. During the fruit ripening period, cut the fruit along its cross-section and use a ruler to conduct a phenotypic survey of the fruit length and width, and calculate the fruit shape index.
[0039] S105. Based on the sequencing results and phenotypic survey data, round fruit type QTLs were mapped in the F2 population.
[0040] S106. Based on the parental resequencing data, identify SNP variants closely linked to the long and round fruit types of melon.
[0041] S107. Based on the Melon (DHL92) v4 genome version, high-quality SNPs were selected within the QTL mapping interval to develop the round fruit type KASP marker FSI9.1-6. This KASP marker consists of two forward primers F1 and F2 and one reverse primer R. The primers were synthesized by Shanghai Sangon Biotech Co., Ltd.
[0042] In a specific embodiment, the primer pair for the KASP molecular marker includes forward primer F1 as shown in SEQ ID NO.2, forward primer F2 as shown in SEQ ID NO.3, and reverse primer R as shown in SEQ ID NO.4. Wherein:
[0043] (1) Forward primer F1 (SEQ ID NO:2):
[0044] 5'-GAAGGTGACCAAGTTCATGCTCCAGTTGGCAGTTAGTGGTAATG-3';
[0045] (2) Forward primer F2 (SEQ ID NO:3):
[0046] 5'-GAAGGTCGGAGTCAACGGATTCTCCAGTTGGCAGTTAGTGGTAATT-3';
[0047] (3) Reverse primer R (SEQ ID NO:4):
[0048] 5'-TATGACCGTCCAGACTCCAAGCAT-3'.
[0049] Secondly, this application provides an application of the KASP molecular marker for round melon fruit type in the identification of melon fruit type. When applying the KASP molecular marker to identify melon fruit type, the identification method specifically includes the following steps:
[0050] S201. Extract genomic DNA from the cotyledons of the melon seedlings to be tested.
[0051] S202. Using genomic DNA as a template, PCR amplification was performed using the primer set forward primer F1, forward primer F2 and reverse primer R to obtain the amplification product.
[0052] In a specific implementation, the PCR amplification reaction system is as follows: 1 μL of Hanchen Guangyi 2× PACE Master Mix, 0.003 μL of forward primer F1, 0.003 μL of forward primer F2, 0.008 μL of reverse primer R, and 1 μL of genomic DNA ranging from 10 ng / μL to 100 ng / μL, for a total reaction volume of 2.014 μL.
[0053] In a specific implementation, the PCR amplification reaction procedure includes the following steps: pre-denaturation at 94℃ for 10 min; denaturation at 95℃ for 20 s, annealing at 61℃ (-0.6℃ / cycle) for 40 s, for 10 cycles; denaturation at 95℃ for 20 s, annealing at 55℃ for 40 s, for 48 cycles; extension at 30℃ for 30 s; and storage at 4℃. Specifically, it includes the following steps:
[0054] Pre-denaturation at 94℃ for 10 min;
[0055] The process involves denaturation at 95℃ for 20 seconds, annealing at 61℃ for 40 seconds, denaturation at 95℃ for 20 seconds, and annealing at 60.4℃ for 40 seconds, repeated 10 times (each cycle includes denaturation and annealing, but the annealing temperature is reduced by 0.6℃).
[0056] Denaturation at 95℃ for 20 seconds, annealing at 55℃ for 40 seconds, for 48 cycles (each cycle consists of denaturation and annealing at constant temperature).
[0057] Extend at 30°C for 30 seconds; store at 4°C.
[0058] S203. Perform fluorescence detection on the amplification products.
[0059] In a specific implementation, based on the fluorescence detection results, if the obtained fluorescence signal corresponds to the positive control parent, Yangjiaomi, then the fruit shape of the melon to be tested is long; if the obtained fluorescence signal corresponds to the positive control, VED, then the fruit shape of the melon to be tested is round.
[0060] In this specific implementation, the KASP molecular marker was designed based on the SNP site chr09:21758042bp of the Melon (DHL92) v4 genome. The SNP site is located at the 51st base of the nucleotide sequence shown in SEQ ID NO: 1, and the base at the SNP site is mutated from G to T. The TT genotype is for long fruit, the GG genotype is for round fruit, and the GT genotype is for pear fruit.
[0061] In a specific implementation, the primer pairs of the KASP molecular marker can be used to prepare a kit for identifying KASP molecular markers for melon fruit type.
[0062] In a specific implementation, primer pairs using KASP molecular markers can be used for the breeding of melon fruit-type germplasm. The specific steps include:
[0063] S301. Genomic DNA was extracted from the cotyledons of the melon seedlings to be tested using the alkaline lysis method.
[0064] S302. The obtained genomic DNA was amplified by PCR and detected by KASP reaction using the KASP molecular marker FSI9.1-6;
[0065] S303. Read the KASP reaction to detect fluorescence signals. When the genomic DNA of the melon sample shows a blue fluorescence signal, it means that the sample carries the homozygous genotype T:T and the phenotype is long fruit. If the genomic DNA of the melon sample shows a red fluorescence signal, it means that the sample carries the homozygous genotype G:G and the phenotype is round fruit. When the genomic DNA of the melon sample shows a green fluorescence signal, it means that the sample carries the heterozygous genotype G:T and the phenotype is pear-shaped, which is intermediate between the two parents.
[0066] S304 allows for the selection of recombinant exchange single plants and backcrossing with parents to construct a gradual introgression system for melon fruit type, i.e., a system in which the melon fruit type gradually transitions from long fruit type / round fruit type to round fruit type / long fruit type.
[0067] The technical solutions described above in this application will be explained in detail below with reference to specific embodiments.
[0068] Example 1
[0069] This embodiment is used to illustrate the main effect QTL localization for round-fruited melons. Specifically:
[0070] 1. Long-fruited Goat Horn Honey and round-fruited VED melons, which have significant differences in fruit shape, were selected as parents. Figure 1 After obtaining the F1 generation through hybridization, the F2 population was obtained through self-pollination. The fruit shape phenotypic characteristics of the F2 population were investigated. Simultaneously, a modified high-throughput CTAB method was used to extract genomic DNA from the leaves of each plant. The extraction method was as follows:
[0071] 1) Select fresh melon leaves and put them into a 1.2mL deep-well 8-well tube. Add a 2mm steel ball into the tube and place it on a 96-well plate.
[0072] 2) Preheat CTAB buffer by setting the temperature to 65°C and in a water bath for 15 minutes.
[0073] 3) In a fume hood, add 100 μL of CTAB buffer to each of the 8 tubes, set the frequency to 1 / 30 and the time to 5 min, and place the 8 tubes of the deep well plate in a tissue homogenizer for grinding. If the sample is not completely ground, continue grinding for 5 min until it is fully ground.
[0074] 4) Use an electronic scale to balance the deep well plate. Once the weight difference between the two 96-well plates is less than 0.1g, place them in a 96-well centrifuge for a short period of centrifugation.
[0075] 5) In a fume hood, add 240 μL of CTAB buffer to each of the 8 tubes and incubate in a 65°C water bath for 45 min. During this period, the deep well plate is turned upside down and mixed every 15 min for a total of three times.
[0076] 6) After the deep well plate has cooled to room temperature after the water bath, add 340 μL of the two mixed solution (chloroform: isoamyl alcohol = 24:1), slowly invert the plate, mix thoroughly and balance the mixture, and then centrifuge it in a 96-well centrifuge at 3000 r / min for 10 min.
[0077] 7) Transfer 200 μL of supernatant to a new 8-well plate centrifuge tube, add 200 μL of isoamyl alcohol, gently invert and balance, then centrifuge in a 96-well centrifuge at 3000 rpm for 30 min. Balancing refers to weighing the 96-well plates containing the samples and reagents beforehand, and continuously adjusting the mass of the liquid in both plates to ensure the mass difference between the two plates is less than 0.1 g. This balancing operation aims to prevent potential safety accidents such as high-speed centrifuge vibration and rotor damage caused by uneven mass distribution.
[0078] 8) Slowly pour off the supernatant, add 200 μL of 70% anhydrous ethanol, wash the DNA precipitate thoroughly, balance the liquid, and centrifuge in a 96-well centrifuge at 3000 r / min for 10 min.
[0079] 9) Slowly pour out the ethanol, leave the container open at room temperature for about 12 hours until it is completely dry.
[0080] 10) Dilute with 50 μL of ddH2O containing RNase. After the DNA precipitate is completely dissolved in water, determine the concentration. Store the qualified DNA solution (i.e., OD value (260 / 280) is 1.8-2.0, concentration >50 ng / μL, and clear electrophoretic bands without degradation) at -20℃ for subsequent experiments.
[0081] 2. Using GBS technology and combined with F2 population phenotypic data, QTL mapping was performed on the round fruit type of melon. The results are as follows: Figure 2 As shown, a major-effect QTL associated with round fruit type was discovered, and the QTL region is located in the range of 52.77Mb-63.95Mb on chromosome 9.
[0082] 3. Based on the resequencing results of the parents' whole genomes, a SNP variant G / T was found at position 21,758,042 bp within this region. A KASP molecular marker related to the round fruit type of melon was developed at this site, and the genotypes of the BC1P1 and BC1P2 populations were genotyped using this marker. BC1P1 was obtained by crossing F1 as the maternal parent and Yangjiaomi (P1) as the recurrent paternal parent; BC1P2 was obtained by crossing F1 as the maternal parent and VED (P2) as the recurrent paternal parent.
[0083] Example 2
[0084] Based on the QTL mapping results of Example 1, SNPs in the chromosome 9 region of the parental materials were extracted and screened, and related molecular markers were developed using KASP technology for fine mapping and variety improvement.
[0085] Specifically:
[0086] 1. Based on the 50 bp sequence upstream and downstream of the SNP site within the interval, a KASP marker was designed, and allele-specific primers were used for amplification and detection. After molecular marker screening, a KASP molecular marker closely linked to the round fruit shape of melon was finally obtained, denoted as FSI9.1-6. This molecular marker is an SNP marker located at position 21758042 bp on chromosome 9 of melon. Its nucleotide sequence is shown in SEQ ID NO.1. The 51st base of the KASP molecular marker nucleotide sequence is G / T.
[0087] 2. Based on the SNP sites obtained in Example 1, specific primers were designed and synthesized, namely forward primer F1, forward primer F2 and reverse primer R. The nucleotide sequence of forward primer F1 is shown in SEQ ID NO: 2; the nucleotide sequence of forward primer F2 is shown in SEQ ID NO: 3; and the nucleotide sequence of reverse primer R is shown in SEQ ID NO: 4.
[0088] KASP genotyping results allow for plant genotyping based on the color of each reaction well. The X and Y axes represent the fluorescence signal values of the FAM and HEX fluorescent tags, respectively. FAM fluorescence signals are detected near the Y-axis, and the reaction wells are blue. HEX fluorescence signals are detected near the X-axis, and the reaction wells are red. When both HEX and FAM fluorescence signals are detected simultaneously, a green signal point is displayed in the middle area of the axes. The "█" near the origin represents a negative control without added DNA. In the KASP genotyping diagram, the red amplification signal points near the horizontal axis and the blue amplification signal points near the vertical axis are connected to the origin by straight lines. The closer the angle formed by these three lines is to 90 degrees, the better the genotyping effect. Figure 3 As shown, the KASP molecular marker FSSI9.1-6 can significantly differentiate parental materials with different fruit shapes. Different genotypes produce different fluorescence signals, thus achieving phenotypic differentiation. Among them, the long-fruited melon material Yangjiaomi is homozygous genotype T:T and exhibits blue fluorescence; the round-fruited melon material VED is homozygous genotype G:G and exhibits red fluorescence; the intermediate pear-shaped F1 obtained by crossing Yangjiaomi and VED is heterozygous genotype G:T and exhibits green fluorescence.
[0089] This indicates that the KASP molecular marker FSI9.1-6 can accurately distinguish between different genotypes and their corresponding phenotypes, and can be used for genotype identification of long-fruited and round-fruited melon populations and their offspring populations.
[0090] Example 3
[0091] This embodiment is used to validate the KASP molecular marker of round-fruited melon in the segregating populations of progeny BC1P1 and BC1P2. Specifically, it includes the following steps:
[0092] 1. Genomic DNA was extracted from the parental materials of melon, the F1 generation, and the backcross populations BC1P1 and BC1P2 using the alkaline lysis method.
[0093] 2. Sample loading and PCR amplification were performed on the HanCheng Guangyi high-throughput genotyping platform. The PCR amplification reaction system was as follows: HanCheng Guangyi 2× PACE Master Mix 1μL, forward primer F1 0.003μL, forward primer F2 0.003μL, reverse primer R 0.008μL, 10ng / μL-100ng / μL genomic DNA 1μL, with a total reaction volume of 2.014μL.
[0094] The PCR amplification reaction program was as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, 61℃ (-0.6℃ / cycle) annealing for 40 s, for 10 cycles; 95℃ denaturation for 20 s, 55℃ annealing for 40 s, for 48 cycles; 30℃ extension for 30 s; and storage at 4℃.
[0095] 3. Perform fluorescence detection on the amplification products.
[0096] The reaction plate was scanned on a fluorescence detector, and the genotyping results were analyzed to obtain the genotype information. Genotyping was performed in the segregating populations of progeny BC1P1 and BC1P2 using the FSI9.1-6 molecular marker. The genotypes of individual BC1P1 and BC1P2 plants were determined based on fluorescence signals. Plants exhibiting blue fluorescence (similar to the long-fruited parent *Eriocheir sinensis*) had the genotype T:T; plants exhibiting red fluorescence (similar to the round-fruited parent *VED*) had the genotype G:G; and plants exhibiting green fluorescence (similar to the F1 generation) had the genotype G:T.
[0097] The results are as follows Figure 4 and Figure 5 As shown, both BC1P1 and BC1P2 individual plants can achieve full genotyping. Furthermore, in the offspring of BC1P1 (Golden Horn Melon) after backcrossing with P1 (Golden Horn Melon), only the T:T and G:T genotypes appeared, while in the offspring of BC1P2 (VED) after backcrossing with P2 (VED), only the G:G and G:T genotypes appeared. This indicates that the KASP molecular marker FSI9.1-6 is closely linked to the round fruit type of melon and can be used for the identification of round-fruited melon materials. In addition, by crossing long-fruited Golden Horn Melon with round-fruited VED, and using molecular marker-assisted breeding based on the FSI9.1-6 genotyping results of the offspring, recombinant exchange plants from the segregating population can be selected for breeding. Continuous backcrossing followed by self-pollination can construct introgression lines, which can be used for the targeted improvement and fine-tuning of the round fruit type in melons.
[0098] In summary, this application first performed trait-gene association mapping (based on QTL mapping principles) through Example 1. Traits (such as fruit shape) are controlled by specific genes or QTLs (quantitative trait loci) in the genome. By constructing a parental hybrid population (F2) with trait differences, the phenotypic data (fruit length and width) and genotypic data (GBS sequencing results) of each individual were analyzed. Using linkage analysis principles, the gene controlling the round fruit shape was located to a specific region on the chromosome. Secondly, SNP and KASP detection were performed through Example 2. SNPs (single nucleotide polymorphisms) are DNA sequence variations at the genome level. KASP (competitive allele-specific PCR) technology utilizes SNP sites to design two allele-specific forward primers with different fluorescent tags (FAM and HEX) and one universal reverse primer. In the PCR reaction, the primers competitively bind to the template DNA. If the sample is homozygous (e.g., G:G), only primers with the corresponding fluorescence amplify, and the instrument detects that specific fluorescence (red); if it is another homozygous sample (T:T), another fluorescence (blue) is detected; if it is heterozygous (G:T), both primers amplify, showing mixed fluorescence (green). Finally, Example 3 utilizes the developed KASP molecular marker, which is closely linked to the target trait (round fruit type), to directly determine the genotype of plants through DNA detection during the seedling stage (not the fruit ripening stage), thereby predicting their future phenotype. This eliminates the reliance on field phenotypic observation and enables rapid and accurate screening of superior single plants containing the target gene at an early stage for backcrossing, self-pollination, or construction of introgression lines, thus significantly accelerating the breeding process.
[0099] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on its differences from other embodiments. Similar or identical parts between embodiments can be referred to interchangeably. Although preferred embodiments of the present application have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are interpreted only to include the preferred embodiments and all changes and modifications falling within the scope of the present application.
[0100] Finally, it should be noted that in this application, relational terms such as "first" and "second" are used merely to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Furthermore, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or terminal device that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or terminal device. Without further limitations, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the process, method, article, or terminal device that includes the element.
[0101] This application uses specific examples to illustrate the principles and implementation methods of this application. The description of the above embodiments is only for the purpose of helping to understand the method and core ideas of this application. At the same time, for those skilled in the art, there will be changes in the specific implementation methods and application scope based on the ideas of this application. Therefore, the content of this specification should not be construed as a limitation of this application.
Claims
1. Use of a reagent for detecting a melon round fruit type KASP molecular marker in identifying melon fruit type, characterized in that, The nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO: 1, wherein position 51 is an SNP site with a polymorphism of G / T, the TT genotype is for long fruit type, the GG genotype is for round fruit type, and the GT genotype is for pear type. When the KASP molecular marker is applied to identify melon fruit type, the identification method includes the following steps: Genomic DNA was extracted from the target melon, and PCR amplification was performed using the genomic DNA as a template. Fluorescence detection was performed based on the primer pair of the KASP molecular marker to obtain the gene type of the target melon. Based on the detected gene type, the trait of the target melon was determined. The primer pairs of the KASP molecular marker include forward primer F1 as shown in SEQ ID NO.2, forward primer F2 as shown in SEQ ID NO.3, and reverse primer R as shown in SEQ ID NO.
4.
2. Use according to claim 1, characterized in that, The KASP molecular marker was designed based on the SNP site chr09:21758042bp of Melon (DHL92) v4 in the melon genome.
3. Use according to claim 1, characterized in that, The PCR amplification reaction system consisted of: 1 μL of 2× PACEMaster Mix, 0.003 μL of forward primer F1, 0.003 μL of forward primer F2, 0.008 μL of reverse primer R, and 1 μL of genomic DNA ranging from 10 ng / μL to 100 ng / μL, for a total reaction volume of 2.014 μL.
4. The application according to claim 1, characterized in that, The PCR amplification reaction procedure includes the following steps: Pre-denaturation at 94℃ for 10 min; The annealing process was repeated 10 times, starting at 61℃ and followed by denaturation at 95℃ for 20 seconds. The annealing temperature was then reduced by 0.6℃ each time. Denaturation at 95℃ for 20 seconds, annealing at 55℃ for 40 seconds, repeated 48 times; Extend for 30 seconds at 30℃; Store at 4℃.
5. The application according to claim 1, characterized in that, The primer pairs for the KASP molecular marker can be used to prepare a kit for identifying KASP molecular markers for melon fruit types.
6. The application according to claim 1, characterized in that, The primer pairs of the KASP molecular markers can be used for the breeding of melon fruit-type germplasm.
Citation Information
Patent Citations
Muskmelon fruit length molecular marker and application thereof
CN120505443A
Application of KASP molecular marker in identification of light yellow flower color character of muskmelon
CN120945100A