Genetically engineered bacterium for producing O-acetyl-L-homoserine as well as construction method and application of genetically engineered bacterium
By modifying Escherichia coli through metabolic engineering, enhancing the expression of acetyl-CoA module and OAH transport capacity, and constructing a high serine acetyltransferase overexpression plasmid, the problem of low OAH yield in engineered strains was solved, and efficient OAH synthesis and industrial production were achieved.
Patent Information
- Application Number
- CN202610386685.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-27
- Publication Date
- 2026-04-28
- Estimated Expiration
- 2046-03-27
AI Technical Summary
In the existing technology, the fermentation yield of O-acetyl-L-homoserine (OAH) engineered strains is not high, the supply of precursor substances is insufficient, the product transport efficiency is low, and the metabolic regulation is not precise enough, resulting in insufficient synthesis throughput and yield, making it difficult to meet the requirements of industrial application.
Metabolic engineering was used to modify Escherichia coli to enhance gene expression of the acetyl-CoA module, overexpress phosphoketolase and pantothenic acid kinase to increase acetyl-CoA supply, overexpress heterologous homoserine acetyltransferase to enhance OAH transport capacity, and construct plasmids to overexpress the homoserine acetyltransferase genes of Marine Circobacter and Corynebacterium glutamicum to optimize the metabolic network and improve OAH synthesis capacity.
The efficient accumulation of OAH was achieved, with a shake flask yield of 17.8 g/L and a fed fermentation yield of 105.3 g/L in a 5 L fermenter, and a sugar-acid conversion rate of 55%, laying the foundation for the industrial production of OAH.
Smart Images

Figure CN121931024A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, and relates to a genetically engineered bacterium that produces O-acetyl-L-homoserine, its construction method, and its application. Background Technology
[0002] O-acetyl-L-homoserine (OAH) is an important C4 platform compound with wide applications in food, pharmaceuticals, agriculture, and chemicals, serving as a precursor for the synthesis of various high-value-added chemicals. Its biosynthetic mechanism is complex; wild-type *E. coli* itself lacks the ability to synthesize OAH, requiring the heterologous introduction of a homoserine acetyltransferase. This enzyme catalyzes the reaction of homoserine with acetyl-CoA to generate OAH.
[0003] However, the synthesis pathway of OAH is subject to strict metabolic regulation, and traditional mutagenesis methods are insufficient to effectively increase its yield. In recent years, although some progress has been made in modifying microorganisms using metabolic engineering, many challenges remain: insufficient supply of precursor substances limits the material basis for OAH synthesis; low product transport efficiency restricts the synthesis throughput; and imprecise metabolic regulation leads to the accumulation of intermediate products and the generation of byproducts, affecting the yield of the target product.
[0004] Currently, engineered microbial strains still fall far short of the requirements for industrial application in terms of OAH yield, substrate conversion rate, and production efficiency. Although some studies have attempted strategies such as gene knockout and key gene overexpression, the results have been limited. Therefore, developing new strategies to achieve precise regulation of microbial metabolic pathways and improve the conversion efficiency of substrates to target products has become a critical issue that urgently needs to be addressed.
[0005] Therefore, it is urgent to construct a high-yield recombinant genetically engineered bacterium for OAH, break through existing technological bottlenecks, and promote the industrial production of OAH. Summary of the Invention
[0006] To address the issue of low fermentation yield of OAH engineered strains in existing technologies, this invention modifies Escherichia coli through metabolic engineering, resulting in a genetically engineered strain that produces high levels of O-acetyl-L-homoserine.
[0007] To solve the above problems, the technical solution adopted in this application is:
[0008] The first aspect of the present invention is to provide a method for constructing a genetically engineered bacterium that produces O-acetyl-L-homoserine, characterized in that, using strain OAH1 as the substrate bacterium, the genome of strain OAH1 is modified in at least one of steps 1 to 4 through the following steps:
[0009] Step 1: Enhance the expression of genes that regulate the acetyl-CoA module;
[0010] Step 2: Overexpress the heterologous phosphatidylcholine kinase encoding gene fxpK and the pantothenic acid kinase encoding gene coaA;
[0011] Step 3: Strengthen the OAH transfer module;
[0012] Step 4: Overexpress the heterologous homoserine acetyltransferase encoding genes cmmetX and cgmetX.
[0013] As a preferred embodiment of this application, the strain OAH1 is strain E. coli W3110, ΔmetI ΔmetJ ΔthrBΔmetB ΔldhA ΔadhE ΔpflB Ptrc-metL ΔarcA ΔiclR Ptrc-sucA sucDTTG Ptrc-zwf Δadd Ptrc-ompR.
[0014] As a preferred embodiment of this application, the method for constructing the chassis bacteria includes: using E. coli W3110, ΔmetI ΔmetJ ΔthrB ΔmetB ΔldhA ΔadhE ΔpflB Ptrc-metL ΔiclR ΔarcA as the starting strain, the genome of strain OAH1 is modified through the following steps:
[0015] The gene sucA encoding 2-ketoglutarate decarboxylase in its genome was overexpressed;
[0016] Weaken the sucD gene encoding succinyl-CoA synthase;
[0017] Increase the supply of succinyl coenzyme A;
[0018] Overexpression of the gene zwf encoding NADPH-dependent glucose-6-phosphate dehydrogenase;
[0019] Increase NADPH supply;
[0020] Delete the gene 'add' that encodes adenosine deaminase to balance ATP metabolism;
[0021] Overexpression of the gene ompR, which encodes a dual regulator of DNA-binding transcription, enhances the resistance of Escherichia coli to high osmotic pressure.
[0022] As a preferred embodiment of this application, enhancing the expression of genes regulating the acetyl-CoA module includes:
[0023] a. Enhance the expression of the phosphorylacetyltransferase-encoding gene pta;
[0024] b. Enhance the expression of the acetate kinase-encoding gene ackA; and / or
[0025] c. Enhance the expression of the acetyl-CoA synthase encoding gene acs.
[0026] As a preferred embodiment of this application, the expression of genes that enhance the regulation of the acetyl-CoA module is achieved by replacing the original promoters on the OAH1 genome used to regulate the ackA, pta, and / or acs genes with the strong promoter Trc.
[0027] As a preferred embodiment of this application, enhancing the expression of genes that regulate the acetyl-CoA module means enhancing the expression of the acetyl-CoA synthase encoding gene acs.
[0028] As a preferred embodiment of this application, the phosphatidylcholine kinase encoding gene fxpK and the pantothenic acid kinase encoding gene coaA are derived from Bifidobacterium adolescentis.
[0029] As a preferred embodiment of this application, step 2 involves replacing the pseudogene nmpC in the genome of the basal bacteria or the intermediate strain modified in step 1 with the Ptrc-fxpK-coaA gene.
[0030] As a preferred embodiment of this application, step 3 includes overexpressing the amino acid efflux pump encoding genes eamA, eamB, and / or rhtA. eamA is preferred.
[0031] As a preferred embodiment of this application, overexpression of the heterologous homoserine acetyltransferase encoding genes cmmetX and cgmetX includes:
[0032] (I) Constructing overexpression plasmids Ptrc99a-cmmetX-cgmetX for the homoserine acetyltransferase encoding gene cmmetX from Cyclobacterium marinum and the cgmetX gene from Corynebacterium glutamicum; and
[0033] (II) The overexpression plasmid is introduced into a basal strain or an intermediate strain modified in at least one of steps 1 to 3 to obtain a genetically engineered strain that produces O-acetyl-L-homoserine.
[0034] As a preferred embodiment of this application, in step (I), the homoserine acetyltransferase encoding gene cmmetX from Cyclobacterium marinum and cgmetX from Corynebacterium glutamicum are co-cloned into the Ptrc99A vector to construct an engineered plasmid for overexpressing homoserine acetyltransferase.
[0035] Specifically, the method for constructing the genetically engineered bacteria described in this invention includes:
[0036] (1) Using strain OAH1 as the chassis strain, CRISPR-Cas9 gene editing technology was applied to replace the original promoters regulating the ackA-pta gene and acs gene on the genome of strain OAH1 with the strong promoter Trc to obtain engineered strains OAH2 and OAH3; the strain OAH1 is strain E. coli W3110, ΔmetI ΔmetJ ΔthrB ΔmetB ΔldhAΔadhE ΔpflB Ptrc-metL ΔarcA ΔiclR Ptrc-sucA sucDTTG Ptrc-zwf Δadd Ptrc-ompR;
[0037] (2) Replace the pseudogene nmpC on the genome of engineered bacterium OAH3 with the Ptrc-fxpK-coaA gene, and use Trc as a strong promoter before the gene to obtain engineered bacterium OAH4;
[0038] (3) The rhtA, eamB and eamA genes were inserted into the genome of the engineered strain OAH4 to obtain engineered strains OAH5, OAH6 and OAH7;
[0039] (4) The cmmetX gene, which encodes homoserine acetyltransferase derived from Cyclobacterium marinum, and the cgmetX gene, derived from Corynebacterium glutamicum, were overexpressed on plasmid Ptrc99a to construct plasmid Ptrc99a-cmmetX-cgmetX and transformed into the aforementioned strain OAH7 to obtain the recombinant genetically engineered bacterium OAH-7X that produces OAH.
[0040] As a preferred embodiment of this application, the nucleotide sequence of the ackA gene is shown in SEQ ID NO.1.
[0041] As a preferred embodiment of this application, the nucleotide sequence of the pta gene is shown in SEQ ID NO.2.
[0042] As a preferred embodiment of this application, the nucleotide sequence of the fxpK gene is shown in SEQ ID NO.3.
[0043] As a preferred embodiment of this application, the nucleotide sequence of the coaA gene is shown in SEQ ID NO.4.
[0044] As a preferred embodiment of this application, the nucleotide sequence of the rhtA gene is shown in SEQ ID NO.5.
[0045] As a preferred embodiment of this application, the nucleotide sequence of the eamB gene is shown in SEQ ID NO.6.
[0046] As a preferred embodiment of this application, the nucleotide sequence of the eamA gene is shown in SEQ ID NO.7.
[0047] As a preferred embodiment of this application, the nucleotide sequence of the cmmetX gene is shown in SEQ ID NO.8.
[0048] As a preferred embodiment of this application, the nucleotide sequence of the cgmetX gene is shown in SEQ ID NO.9.
[0049] As a preferred embodiment of this application, the nucleotide sequence of the Ptrc promoter is shown in SEQ ID NO.10.
[0050] As a preferred embodiment of this application, the nucleotide sequence of the acs gene is shown in SEQ ID NO.11, and acs is located in GenBank accession number NC_000913.3.
[0051] This invention modifies the OAH synthesis network of *E. coli* by overexpressing the gene *pta* encoding phosphoacetyltransferase, the gene *ackA* encoding acetate kinase, and the gene *acs* encoding acetyl-CoA synthase. Simultaneously, it overexpresses the gene *fxpK*, a phosphatidylcholine kinase derived from *Bifidobacterium adolescentis*, and enhances the expression of the gene *coaA*, thereby increasing the supply of acetyl-CoA. It also heterologously expresses the gene encoding homoserine acetyltransferase; overexpresses different amino acid efflux pump genes *eamA*, *eamB*, and *rhtA*, enhancing the strain's ability to transport OAH; and finally, it simultaneously overexpresses the genes *cmmetX* and *cgmetX* on plasmid *Ptrc99A*, constructing plasmid *Ptrc99a-cmmetX-cgmetX*, which is then transformed into the engineered strain. This overcomes the problem of endogenous lack of OAH synthase catalysis in *E. coli*, directing carbon flux towards OAH synthesis.
[0052] A second aspect of the present invention is to provide a genetically engineered bacterium for producing O-acetyl-L-homoserine, constructed according to the said construction method.
[0053] As a preferred embodiment of this application, the genetically engineered bacterium is E. coli W3110, ΔmetI ΔmetJ ΔthrBΔmetB ΔldhA ΔadhE ΔpflB Ptrc-metL ΔarcA ΔiclR Ptrc-sucA sucDTTG Ptrc-zwf Δadd Ptrc-ompR Ptrc-acs ΔnmpC::fxpK-Ptrc-coaA ΔygaY::Ptrc-eamA / Ptrc99a-cmmetX-cgmetX.
[0054] A third aspect of the present invention is to provide the application of the genetically engineered bacteria in the microbial fermentation production of O-acetyl-L-homoserine.
[0055] As a preferred embodiment of this application, the genetically engineered bacteria are inoculated into a fermentation medium and fermented at 28-37℃ and 100-700 rpm for 70-90 h. After fermentation, the supernatant of the fermentation broth is separated and purified to obtain O-acetyl-L-homoserine. The fermentation medium has the following composition: glucose 10-30 g / L, ammonium sulfate 10-20 g / L, yeast extract 1-5 g / L, KH2PO4 0.5-3 g / L, MgSO4 0.1-2.0 g / L, trace metal salt solution 0.5-5 mL / L, betaine 1.0-3.0 g / L, pH 6.5-7.0, and deionized water as the solvent. The trace metal salt solution consists of: 0.01 g / L FeSO4, 0.005 g / L MnSO4, and 0.0025 g / L ZnSO4, and deionized water as the solvent.
[0056] Preferably, the fermentation medium is composed of the following: glucose 25 g / L, ammonium sulfate 16 g / L, yeast extract 2.5 g / L, KH2PO4 1 g / L, MgSO4 0.5 g / L, betaine 2.0 g / L, and trace metal salt solution 1 mL / L.
[0057] Preferably, before fermentation, the genetically engineered bacteria are inoculated into LB medium and incubated overnight at 37°C and 180 rpm to prepare a seed culture. The seed culture is then inoculated into the fermentation medium at a volume concentration of 5%. The fermentation was carried out in a 5 L fermenter: the recombinant genetically engineered bacteria were inoculated onto LB agar plates containing 50 mg / L kanamycin resistance and cultured overnight at 37°C. Single colonies were picked and cultured overnight at 37°C and 150 rpm in LB test tubes containing 50 mg / L kanamycin resistance to prepare seed culture. The seed culture was inoculated into LB medium at a volume concentration of 5% and cultured overnight at 37°C and 150 rpm to obtain secondary seed culture. The secondary seed culture was inoculated into a 5 L fermenter containing 2 L of fermentation medium at a volume concentration of 15%, and IPTG was added to a final concentration of 0.2 mM. Fermentation was carried out at 30°C, 500 rpm, and an aeration rate of 0.5 V / V·min. When the pH value was higher than 6.80 (the initial sugar in the 5 L fermenter was consumed), automatic feeding was started. Feeding medium was added until the pH value was lower than 6.80, and then feeding was stopped. After culturing for 96 h, fermentation broth containing OAH was obtained. The fed culture medium consisted of 500 g / L glucose, 16 g / L (NH₄)₂SO₄, 12.5 g / L KH₂PO₄, 4 g / L threonine, and 0.5 g / L methionine, dissolved in water, with the pH adjusted to 6.8 using 50% ammonia. The feeding rate was 25 mL / h, and the total amount of culture medium added was 1000 mL / 2 L.
[0058] In this invention, the term "enhancement" refers to increasing the activity of an enzyme encoded by a corresponding polynucleotide, which can be achieved through gene overexpression or replacement of the gene's expression regulatory sequence on the genome (promoter substitution, etc.). The vectors used in this invention are not specifically limited; any vector known in the art can be used as long as it is reproducible in the host.
[0059] Compared with the prior art, the beneficial effects of this application are as follows: This invention increases the supply of acetyl-CoA by overexpressing the gene acs encoding acetate kinase, overexpressing the gene fxpK encoding phosphoketolase from Bifidobacterium adolescentis, and strengthening the gene coaA encoding pantothenic acid kinase, thus providing sufficient precursors for OAH synthesis; it also enhances the transport capacity of the product OAH by overexpressing the gene eamA encoding the amino acid efflux pump; and it improves the OAH synthesis capacity by introducing overexpression plasmids containing the genes cmmetX and cgmetX encoding homoserine acetyltransferase from Cyclobacterium marinum and Corynebacterium glutamicum. The engineered strain obtained through the systemic metabolic engineering strategy can achieve effective accumulation of OAH, with an OAH yield of 17.8 g / L in shake flasks and 105.3 g / L in fed-batch fermentation in a 5 L fermenter, and a sugar-acid conversion rate of 55%, laying the foundation for the subsequent construction of high-yield OAH engineered strains. Attached Figure Description
[0060] Figure 1 Biomass OD of strains OAH1-X and OAH7-X 600 A bar chart showing the concentrations of OAH.
[0061] Figure 2 The biomass OD of strain OAH7-X during fed-batch fermentation in a 5 L fermenter 600 Concentration curves of OAH. Detailed Implementation
[0062] The following specific examples illustrate the implementation of this application. Those skilled in the art can easily understand other advantages and effects of this application from the content disclosed in this specification. This application can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of this application.
[0063] It should be noted that the process equipment or apparatus not specifically mentioned in the following embodiments are all conventional equipment or apparatus in the art.
[0064] Furthermore, it should be understood that the existence of other method steps before or after the combined steps, or the insertion of other method steps between these explicitly mentioned steps, does not preclude the existence of other method steps before or after the combined steps, or the insertion of other method steps between these explicitly mentioned steps, unless otherwise stated. It should also be understood that the combined connection relationship between one or more devices / apparatus mentioned in this invention does not preclude the existence of other devices / apparatus before or after the combined devices / apparatus, or the insertion of other devices / apparatus between these explicitly mentioned devices / apparatus, unless otherwise stated. Moreover, unless otherwise stated, the numbering of each method step is merely a convenient tool for identifying each method step, and not for limiting the order of the method steps or limiting the scope of the invention. Changes or adjustments to their relative relationships, without substantially altering the technical content, should also be considered within the scope of the invention.
[0065] In the following examples, the final concentration of kanamycin in LB liquid medium and LB solid medium was 50 mg / L, the final concentration of spectinomycin was 50 mg / L, and the final concentration of IPTG was 0.2 mM.
[0066] Example 1: Construction of strain OAH2-OAH7
[0067] 1. Construction of strain OAH2
[0068] Using E. coli W3110, ΔmetI ΔmetJ ΔthrB ΔmetB ΔldhA ΔadhE ΔpflBPtrc-metL ΔarcA ΔiclR Ptrc-sucA sucDTTG Ptrc-zwf Δadd Ptrc-ompR (construction method disclosed in patent CN121406680A, corresponding to the OSH10 strain in that patent, this patent renames it OAH1) as the starting strain, the original promoter of the ackA-pta gene in the genome was replaced with the strong promoter Trc using CRISPR / Cas9 gene editing technology to enhance the supply of acetyl-CoA. The specific operation is as follows:
[0069] (1) Constructing the pTarget-Ptrc-ackA-pta plasmid:
[0070] Using plasmid pTarget as a template and primers pTarget-Ptrc-ackA-pta-F / pTarget-Ptrc-ackA-pta-R as primers, the PCR product was amplified. After adding Dpn I, the product was digested at 37°C for 1 h. The DNA fragments were recovered and purified using a Clean Up kit, then transformed into E. coli DH5α, plated on LB agar plates containing 50 mg / L spectinomycin, and incubated upside down at 30°C for 20 h. Colony PCR was used for preliminary verification, followed by sequencing to confirm the correctness of the pTarget-Ptrc-ackA-pta plasmid, thus obtaining the plasmid pTarget-Ptrc-ackA-pta. Using pTD-line-F / pTD-line-R as primers and plasmid pTarget-Ptrc-ackA-pta as a template, the PCR product was amplified. After adding Dpn I, the product was digested at 37°C for 3 h. The DNA fragments were recovered using a Clean Up kit, yielding the linearized plasmid pTarget-Ptrc-ackA-pta.
[0071] (2) Constructing the plasmid pTD-Ptrc-ackA-pta containing Donor:
[0072] Using the genome of E. coli W3110 (NCBI assembly accession number: GCF_048541595.1) as a template, the upstream homologous arm F1 was amplified using primers L-Ptrc-sucA-F / L-Ptrc-sucA-R; the downstream homologous arm R1 was amplified using primers R-Ptrc-ackA-pta-F / R-Ptrc-ackA-pta-R. The upstream and downstream homologous arms were then fused using primers L-Ptrc-ackA-pta-F / R-Ptrc-ackA-pta-R, and the DNA fragments were recovered using a Clean-up kit to obtain the fused fragment. The fused fragment and the linearized plasmid pTarget-Ptrc-ackA-pta from step (1) were then used to construct plasmid pTD-Ptrc-ackA-pta using a one-step cloning method. This plasmid was transformed into E. coli DH5α, plated onto LB agar plates containing 50 mg / L spectinomycin, and incubated upside down at 30°C for 20 h. Colony PCR was used to preliminarily screen for the correct strains, and finally, sequencing was used to verify the correctness of plasmid pTD-Ptrc-ackA-pta.
[0073] (3) The plasmid pCas9 was transformed into competent cells of strain OAH1, plated onto LB agar plates containing 50 mg / L kanamycin, and incubated overnight at 30°C. Single colonies were picked and transferred to LB test tubes containing 50 mg / L kanamycin resistance, and incubated overnight at 30°C. Then, 1% (v / v) of the solution was inoculated into 100 mL of LB liquid medium, and kanamycin resistance and 10 mM L-arabinose were added to a final concentration of 50 mg / L. The medium was incubated at 180 rpm and 30°C until OD500. 600 =0.5, centrifuged at 4℃ and 4000 rpm. Washed twice with pre-cooled ultrapure water at 4℃, then washed once with pre-cooled 10% glycerol, and finally resuspended in 10% glycerol and aliquoted for storage to obtain electrocompetent cells.
[0074] (4) Take 2 μL of the pTD-Ptrc-ackA-pta plasmid constructed in step (2) and mix it with 100 μL of electrocompetent cells prepared in step (3). Transfer the mixture into a 2 mm electroporation cuvette, incubate on ice for 45 s, and then electroporate using an electroporator (MicroPluser™, BIO-RAD) at a voltage of 2500 V. Immediately after electroporation, add 700 μL of LB medium pre-cooled at 4℃, mix well, and immediately transfer to a new sterile 1.5 mL EP tube. Incubate at 30℃ and 150 rpm for 3 h with shaking. Spread the mixture on LB solid medium containing 50 mg / L kanamycin and 50 mg / L spectinomycin. Incubate upside down at 30℃ for 24 h. Use T-Ptrc-ackA-pta-F / T-Ptrc-ackA-pta-R as primers for colony PCR verification and sequence to verify the correctness of the strain construction. The strain OAH2 was successfully constructed.
[0075] (5) Elimination of pTarget and pCas9 plasmids:
[0076] Pick a single positive colony from step (4) and inoculate it into a test tube containing 2 mM IPTG and 50 mg / L kanamycin. Incubate overnight at 30°C. Streak the bacterial solution onto LB solid medium containing 50 mg / L kanamycin. Incubate upside down at 30°C for 20 h until a single colony appears. Pick a single colony onto LB solid medium containing 50 mg / L spectinomycin. Incubate upside down at 30°C for 20 h. If no single colony appears, it means that the pTarget plasmid has been eliminated from this strain. Pick a strain with the pTarget plasmid eliminated and inoculate it into an antibiotic-free LB liquid medium test tube. Incubate at 42°C for 10 h. Streak the bacterial solution onto an antibiotic-free LB solid medium. Incubate upside down at 37°C for 12 h until a single colony appears. Pick a single colony onto LB solid medium containing 50 mg / L kanamycin. If no single colony appears, it means that the pCas9 plasmid has been successfully eliminated. Finally, obtain the plasmid-free strain OAH2.
[0077] 2. Construction of strain OAH3
[0078] Using OAH1 as the starting strain, the original promoter of the acs gene in the genome was replaced with the strong promoter Trc using CRISPR / Cas9 gene editing technology to enhance the supply of acetyl-CoA. The specific operation is as follows:
[0079] (1) Constructing the pTarget-Ptrc-acs plasmid:
[0080] Using plasmid pTarget as a template and primers pTarget-Ptrc-acs-F / pTarget-Ptrc-acs-R as primers, the PCR product was amplified. After adding Dpn I, the product was digested at 37°C for 1 h. The DNA fragments were recovered and purified using a Clean Up kit, then transformed into E. coli DH5α. The transformed plasmid was plated onto LB agar plates containing 50 mg / L spectinomycin and incubated upside down at 30°C for 20 h. Preliminary colony PCR was performed to verify the colony composition, followed by sequencing to confirm the correctness of the pTarget-Ptrc-acs plasmid, thus obtaining the pTarget-Ptrc-acs plasmid. Then, using pTD-line-F / pTD-line-R as primers and pTarget-Ptrc-acs as a template, the PCR product was amplified. After adding Dpn I, the product was digested at 37°C for 3 h. The DNA fragments were recovered using a Clean Up kit, yielding the linearized pTarget-Ptrc-acs plasmid.
[0081] (2) Constructing the plasmid pTD-Ptrc-acs containing Donor:
[0082] Using the genome of E. coli W3110 as a template, the upstream homologous arm F1 was amplified using L-Ptrc-acs-F / L-Ptrc-acs-R primers; the downstream homologous arm R1 was amplified using R-Ptrc-acs-F / R-Ptrc-acs-R primers. Using the upstream and downstream homologous arms F1 and R1 as templates, the upstream and downstream homologous arms were fused using L-Ptrc-acs-F / R-Ptrc-acs-R primers. The DNA fragments were then recovered using a Cleanup kit to obtain the fused fragments. The fused fragment and the linearized plasmid pTarget-Ptrc-acs from step (1) were then used to construct plasmid pTD-Ptrc-acs using a one-step cloning method. This plasmid was transformed into E. coli DH5α, plated onto LB solid plates containing 50 mg / L spectinomycin, and incubated upside down at 30°C for 20 h. Colony PCR was used to preliminarily screen for the correct strains, and finally, sequencing was used to verify the correctness of plasmid pTD-Ptrc-acs.
[0083] (3) Transform the pCas9 plasmid into competent OAH1 cells, spread it onto LB agar plates containing 50 mg / L kanamycin, and incubate overnight at 30°C. Pick single colonies and transfer them to LB test tubes containing 50 mg / L kanamycin resistance, and incubate overnight at 30°C. Then, inoculate 1% (v / v) into 100 mL of LB medium, add kanamycin resistance at a final concentration of 50 mg / L and 10 mM L-arabinose, and incubate at 180 rpm and 30°C until OD500. 600 =0.5, centrifuged at 4℃ and 4000 rpm. Washed twice with cold ultrapure water at 4℃, then washed once with cold 10% glycerol, and finally resuspended in 10% glycerol, aliquoted and stored to obtain electrocompetent cells for later use.
[0084] (4) Take 2 μL of the pTD-Ptrc-acs plasmid constructed in step (2) and mix it with 100 μL of electrocompetent cells prepared in step (3). Transfer the mixture into a 2 mm electroporation cuvette, incubate on ice for 45 s, and electroporate using an electroporator (MicroPluser™, BIO-RAD) at a voltage of 2500 V. Immediately after electroporation, add 700 μL of LB medium pre-cooled at 4℃, mix well, and immediately transfer to a new sterile 1.5 mL EP tube. Incubate at 30℃ and 150 rpm for 3 h with shaking. Spread the mixture on LB solid medium containing 50 mg / L kanamycin and 50 mg / L spectinomycin. Incubate upside down at 30℃ for 24 h. Use T-Ptrc-acs-F / T-Ptrc-acs-R as primers for colony PCR verification and sequence to verify the correctness of the strain construction. The strain OAH3 was successfully constructed.
[0085] (5) Elimination of pTarget and pCas9 plasmids: Pick a positive single colony from step (4) and inoculate it into a test tube containing 2 mM IPTG and 50 mg / L kanamycin. Incubate overnight at 30 °C. Drip the bacterial solution onto LB solid medium containing 50 mg / L kanamycin and incubate upside down at 30 °C for 20 h until a single colony appears. Pick a single colony onto LB solid medium containing 50 mg / L spectinomycin and incubate upside down at 30 °C for 20 h. If no single colony appears, it means that the pTarget plasmid has been eliminated in this strain. The strain with pTarget plasmid eliminated was picked and inoculated into antibiotic-free LB liquid medium test tubes and incubated at 42°C for 10 h. The bacterial culture was then streaked onto antibiotic-free LB solid medium and incubated upside down at 37°C for 12 h until single colonies appeared. Single colonies were picked and transferred to LB solid medium containing 50 mg / L kanamycin. If no single colonies appeared, it indicated that the pCas9 plasmid was successfully eliminated, and the plasmid-free strain OAH3 was finally obtained.
[0086] 3. Construction of strain OAH4
[0087] (1) Constructing the pTarget-ΔnmpC::fxpK-Ptrc-coaA plasmid:
[0088] Using plasmid pTarget as a template and primers pTarget-ΔnmpC::fxpK-Ptrc-coaA-F / pTarget-ΔnmpC::fxpK-Ptrc-coaA-R as primers, Dpn I was added to the PCR product, and the mixture was incubated at 37℃ for 1 h to demethylate the plasmid template. The resulting plasmid was transformed into E. coli DH5α competent cells, plated onto LB agar plates containing 50 mg / L spectinomycin, and incubated at 30℃ for 20 h until single colonies appeared. Colony PCR was used for preliminary verification, and sequencing was used to confirm the correctness of the constructed plasmid. The linearized plasmid pTarget-ΔnmpC::fxpK-Ptrc-coaA was prepared using the same method as OAH2.
[0089] (2) Construct a plasmid containing Donor pTD-ΔnmpC::fxpK-Ptrc-coaA:
[0090] Using the E. coli W3110 genome as a template, the upstream homologous arm F1 was amplified using primers L-ΔnmpC::fxpK-Ptrc-coaA-F / L-ΔnmpC::fxpK-Ptrc-coaA-R; the downstream homologous arm R1 was amplified using primers R-ΔnmpC::fxpK-Ptrc-coaA-F / R-ΔnmpC::fxpK-Ptrc-coaA-R; and the coaA homologous arm fragment M1 was obtained by PCR amplification using primers Ptrc-coaA-F / Ptrc-coaA-R. The fxpK gene fragment was obtained through commercial synthesis and used as a template, with primers fxpK-F / fxpK-R as primers, to amplify the fxpK homologous arm M2. Next, using the four homologous arms F1, M1, M2, and R1 as templates, and L-ΔnmpC::fxpK-Ptrc-coaA-F / R-ΔnmpC::fxpK-Ptrc-coaA-R as primers, PCR fusion was performed to obtain the final four homologous arms. The DNA fragments were recovered using a Clean Up kit to obtain the fused fragments. The fused fragments and the linearized plasmid pTarget-ΔnmpC::fxpK-Ptrc-coaA from step (1) were then used to construct the plasmid pTD-ΔnmpC::fxpK-Ptrc-coaA using a one-step cloning method. This plasmid was transformed into E. coli DH5α, plated onto LB agar plates containing 50 mg / L spectinomycin, and incubated upside down at 30°C for 20 h. Colony PCR was used to preliminarily screen for the correct strains, and finally, sequencing was used to verify the correctness of the plasmid pTD-ΔnmpC::fxpK-Ptrc-coaA.
[0091] (3) Using the OAH2 construction method, the pCas9 plasmid was introduced into the strain OAH3 and electrocompetent cells were prepared.
[0092] (4) Using the OAH2 construction method, the plasmid pTD-ΔnmpC::fxpK-Ptrc-coaA was transferred into the electrocompetent cells of step (3) to construct strain OAH4.
[0093] (5) Plasmid elimination: The plasmid in the strain of step (4) was eliminated by using the OAH2 construction method to obtain a plasmid-free strain, which is denoted as OAH4.
[0094] 4. Construction of strain OAH5
[0095] (1) Constructing the pTarget-ΔygaY::Ptrc-rhtA plasmid:
[0096] Using plasmid pTarget as a template and primers pTarget-ΔygaY::Ptrc-rhtA-F / pTarget-ΔygaY::Ptrc-rhtA-R, Dpn I was added to the PCR product, and the mixture was incubated at 37℃ for 1 h to demethylate the plasmid template. The resulting plasmid was transformed into E. coli DH5α competent cells, plated onto LB agar plates containing 50 mg / L spectinomycin, and incubated at 30℃ for 20 h until single colonies appeared. Colony PCR was used for preliminary verification, and sequencing was used to confirm the correctness of the constructed plasmid. The linearized plasmid pTarget-ΔygaY::Ptrc-rhtA was prepared using the same method as OAH2.
[0097] (2) Construct a plasmid containing Donor pTD-ΔygaY::Ptrc-rhtA:
[0098] Using the E. coli W3110 genome as a template, the upstream homologous arm F1 was amplified using primers L-ΔygaY::Ptrc-rhtA-F / L-ΔygaY::Ptrc-rhtA-R; the downstream homologous arm R1 was amplified using primers R-ΔygaY::Ptrc-rhtA-F / R-ΔygaY::Ptrc-rhtA-R; and the intermediate homologous arm M1 containing the rhtA gene was amplified using primers rhtA-F / rhtA-R. Then, using the three homologous arms F1, R1, and M1 as templates, and primers L-ΔygaY::Ptrc-rhtA-F / R-ΔygaY::Ptrc-rhtA-R, PCR fusion was performed to obtain the final three linked homologous arms. The DNA fragments were recovered using a Clean Up kit to obtain the fused fragments. The fused fragment and the linearized plasmid pTarget-ΔygaY::Ptrc-rhtA from step (1) were then used to construct plasmid pTD-ΔygaY::Ptrc-rhtA using a one-step cloning method. This plasmid was transformed into E. coli DH5α, plated onto LB agar plates containing 50 mg / L spectinomycin, and incubated upside down at 30°C for 20 h. Colony PCR was used to preliminarily screen for the correct strains, and finally, sequencing was used to verify the correctness of plasmid pTD-ΔygaY::Ptrc-rhtA.
[0099] (3) Using the OAH2 construction method, the pCas9 plasmid was introduced into the strain OAH4 and electrocompetent cells were prepared.
[0100] (4) Using the OAH2 construction method, the plasmid pTD-ΔygaY::Ptrc-rhtA was transferred into the electrocompetent cells of step (3) to construct strain OAH5.
[0101] (5) Plasmid elimination: The plasmid in the strain of step (4) was eliminated by using the OAH2 construction method to obtain a plasmid-free strain, which is denoted as OAH5.
[0102] 5. Construction of strain OAH6
[0103] (1) Constructing the pTarget-ΔygaY::Ptrc-eamB plasmid:
[0104] Using plasmid pTarget as a template and primers pTarget-ΔygaY::Ptrc-eamB-F / pTarget-ΔygaY::Ptrc-eamB-R as primers, Dpn I was added to the PCR product, and the mixture was incubated at 37℃ for 1 h to demethylate the plasmid template. The resulting plasmid was transformed into E. coli DH5α competent cells, plated onto LB agar plates containing 50 mg / L spectinomycin, and incubated at 30℃ for 20 h until single colonies appeared. Colony PCR was used for preliminary verification, and sequencing was used to confirm the correctness of the constructed plasmid. The linearized plasmid pTarget-ΔygaY::Ptrc-eamB was prepared using the same method as OAH2.
[0105] (2) Construct a plasmid containing Donor pTD-ΔygaY::Ptrc-eamB:
[0106] Using the E. coli W3110 genome as a template, the upstream homologous arm F1 was amplified using primers L-ΔygaY::Ptrc-eamB-F / L-ΔygaY::Ptrc-eamB-R; the downstream homologous arm R1 was amplified using primers R-ΔygaY::Ptrc-eamB-F / R-ΔygaY::Ptrc-eamB-R; and the intermediate homologous arm M1 containing the eamB gene was amplified using primers eamB-F / eamB-R. Then, using the three homologous arms F1, R1, and M1 as templates, and primers L-ΔygaY::Ptrc-eamB-F / R-ΔygaY::Ptrc-eamB-R, PCR fusion was performed to obtain the final three linked homologous arms. The DNA fragments were recovered using a Clean Up kit to obtain the fused fragments. The fused fragment and the linearized plasmid pTarget-ΔygaY::Ptrc-eamB from step (1) were then used to construct plasmid pTD-ΔygaY::Ptrc-eamB using a one-step cloning method. This plasmid was transformed into E. coli DH5α, plated onto LB agar plates containing 50 mg / L spectinomycin, and incubated upside down at 30°C for 20 h. Colony PCR was used to preliminarily screen for the correct strains, and finally, sequencing was used to verify the correctness of plasmid pTD-ΔygaY::Ptrc-eamB.
[0107] (3) Using the OAH2 construction method, the pCas9 plasmid was introduced into the strain OAH4 and electrocompetent cells were prepared.
[0108] (4) Using the OAH2 construction method, the plasmid pTD-ΔygaY::Ptrc-eamB was transferred into the electrocompetent cells of step (3) to construct strain OAH6.
[0109] (5) Plasmid elimination: The plasmid in the strain in step (4) was eliminated using the OAH2 construction method to obtain a plasmid-free strain, which is denoted as OAH6.
[0110] 6. Construction of strain OAH7
[0111] (1) Constructing the pTarget-ΔygaY::Ptrc-eamA plasmid:
[0112] Using plasmid pTarget as a template and primers pTarget-ΔygaY::Ptrc-eamA-F / pTarget-ΔygaY::Ptrc-eamA-R as primers, Dpn I was added to the PCR product, and the mixture was incubated at 37℃ for 1 h to demethylate the plasmid template. The resulting plasmid was transformed into E. coli DH5α competent cells, plated onto LB agar plates containing 50 mg / L spectinomycin, and incubated at 30℃ for 20 h until single colonies appeared. Colony PCR was used for preliminary verification, and sequencing was used to confirm the correctness of the constructed plasmid. The linearized plasmid pTarget-ΔygaY::Ptrc-eamA was prepared using the same method as OAH2.
[0113] (2) Construct a plasmid containing Donor pTD-ΔygaY::Ptrc-eamA:
[0114] Using the E. coli W3110 genome as a template, the upstream homologous arm F1 was amplified using primers L-ΔygaY::Ptrc-eamA-F / L-ΔygaY::Ptrc-eamA-R; the downstream homologous arm R1 was amplified using primers R-ΔygaY::Ptrc-eamA-F / R-ΔygaY::Ptrc-eamA-R; and the intermediate homologous arm M1 containing the eamA gene was amplified using primers eamA-F / eamA-R. Then, using the three homologous arms F1, R1, and M1 as templates, and primers L-ΔygaY::Ptrc-eamA-F / R-ΔygaY::Ptrc-eamA-R, PCR fusion was performed to obtain the final three linked homologous arms. The DNA fragments were recovered using a Clean Up kit to obtain the fused fragments. The fused fragment and the linearized plasmid pTarget-ΔygaY::Ptrc-eamA from step (1) were then used to construct plasmid pTD-ΔygaY::Ptrc-eamA using a one-step cloning method. This plasmid was transformed into E. coli DH5α, plated onto LB agar plates containing 50 mg / L spectinomycin, and incubated upside down at 30°C for 20 h. Colony PCR was used to preliminarily screen for the correct strains, and finally, sequencing was used to verify the correctness of plasmid pTD-ΔygaY::Ptrc-eamA.
[0115] (3) Using the OAH2 construction method, the pCas9 plasmid was introduced into the strain OAH4 and electrocompetent cells were prepared.
[0116] (4) Using the OAH2 construction method, the plasmid pTD-ΔygaY::Ptrc-eamA was transferred into the electrotransfer competent cells in step (3) to construct strain OAH7.
[0117] (5) Plasmid elimination: The plasmid in the strain of step (4) was eliminated by using the OAH2 construction method to obtain a plasmid-free strain, which is denoted as OAH7.
[0118] 7. Construction of strains OAH1-X to OAH7-X
[0119] (1) Construction of plasmid Ptrc99a-cmmetX-cgmetX:
[0120] Using plasmid Ptrc99a as a template, and with primers Ptrc99a-line-F / Ptrc99a-line-R, the methylated plasmid was digested with DpnI in the PCR product, and then purified to prepare the linearized plasmid Ptrc99a. A plasmid containing the cmmetX-cgmetX gene was synthesized using a commercially available method. The cmmetX-cgmetX fragment (SEQ ID NO.10) was cloned by PCR using primers Ptrc99a-cmmetX-cgmetX-F / Ptrc99a-cmmetX-cgmetX-R, and then purified. Following the instructions of the one-step cloning kit, the linearized plasmid Ptrc99a and the cmmetX-cgmetX fragment were ligated. The ligation product was transformed into E. coli DH5α competent cells to construct the vector Ptrc99a-cmmetX-cgmetX. Colony PCR was used to preliminarily verify its correctness, and sequencing was then performed to confirm the successful construction of the plasmid.
[0121] (2) Prepare competent cells from strains OAH1-X to OAH7-X. The method for preparing competent cells is the same as that for OAH2.
[0122] (3) The plasmid Ptrc99a-cmmetX-cgmetX was transformed into competent cells of strains OAH1-X ~OAH7-X to construct strains OAH1~7 / Ptrc99a-cmmetX-cgmetX, which were respectively named strains OAH1-X ~OAH7-X.
[0123] Table 1. Primers used in the construction of strains OAH1-X to OAH7-X
[0124] Primer Name Primer Sequence (5’-3’) pTarget-Ptrc-ackA-pta-F AGTTTTAGCCACGTATCAATTATGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCT pTarget-Ptrc-ackA-pta-R CTAAAACATAATTGATACGTGGCTAAAACTAGTATTATACCTAGGACTGAGCTAGCTGT L-Ptrc-ackA-pta-F CCGAGTCGGTGCTTTTTTTGAATTCTCTAGAAGCAGAGAGTAAATACGGCGATCG L-Ptrc-ackA-pta-R AAATTCCACACATTATACGAGCCGGATGATTAATTGTCAAACGTCAGGGAGCCATAGAG R-Ptrc-ackA-pta-F ATAATGTGTGGAATTTCACACAGGAAACAGACCATGTCGAGTAAGTTAGTACTGGTTCTGA R-Ptrc-ackA-pta-R AGGGTAATAGATCTAAGCTTCTGCAGGCAGGGCGTAGAGGTAAGACTC T-Ptrc-ackA-pta-F TAATGGCGTGACAGAACGCTTG T-Ptrc-ackA-pta-R GTGGCAGGTGATGATGTTCAGT pTarget-Ptrc-acs-F AGTCATATTATTAACATCCTACAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCT pTarget-Ptrc-acs-R CTAAAACTGTAGGATGTTAATAATATGACTAGTATTATACCTAGGACTGAGCTAGCTGT L-Ptrc-acs-F CCGAGTCGGTGCTTTTTTTGAATTCTCTAGACTTCGCTTCCACAGTTACAGGTT L-Ptrc-acs-R AAATTCCACACATTATACGAGCCGGATGATTAATTGTCAAGCGTTAAATGTAGGGGTATTGGCA R-Ptrc-acs-F TATAATGTGTGGAATTTCACACAGGAAACAGACCATGAGCCAAATTCACAAACACACCA R-Ptrc-acs-R AGGGTAATAGATCTAAGCTTCTGCAGAGAAGCCGCCGAAAATCACC T-Ptrc-acs-F GGGGCAAAGGTTTCATTCTTCGC T-Ptrc-acs-R AGTCGTGAGTTGGAATCAATAATGCG pTarget-ΔnmpC::fxpK-Ptrc-coaA-F TAATACTAGTCAGAATTCGGTGGTGACACTGTTTTAGAGCTAGAAATAGC pTarget-ΔnmpC::fxpK-Ptrc-coaA-R GCTCTAAAACAGTGTCACCACCCAATTCTGACTAGTATTATACCTAGGAC L-ΔnmpC::fxpK-Ptrc-coaA-F CTTTTTTTGAATTCTCTAGAACGAAGTAACCACTCTTAACAGC L-ΔnmpC::fxpK-Ptrc-coaA-R AATTCCACATTATACGAGCCGGATGATTAATTGTCAAACTGATGCAGCTACAGCAGA fxpK-F ATAATGTGTGGAATTTCACACAGGAAACAGACCGGATCCATGACCTCGCCGGT fxpK-R TTATACTCATGAATTCTCACTCGTTATCACCAGCG legsA–F GTGAGAATTCATGAGTATAAAAGAGCAAACGTTAATGACGC footA-R TACAGTCTTATTTGCGTAGTCTGACCTCTTCTACCG R-ΔnmpC::fxpK-Ptrc-coaA-F GACTACGCAAATAAGACTGTATTTGCTGATCACTTCGTTG R-ΔnmpC::fxpK-Ptrc-coaA-R ATAGATCTAAGCTTCTGCAGCTGCATGCAGTGAATGCGTA T-ΔnmpC::fxpK-Ptrc-coaA-F ACQACTTAQUAT T-ΔnmpC::fxpK-Ptrc-coaA-R CTGCATGCAGTGAATGCGTAG pTarget-ΔygaY::Ptrc-rhtA-F AGTCAGCATTCTCTGGACCTCAAGTTTTAGAGCTAGAAATAGCAAGTTAAATAAGGCT pTarget-ΔygaY::Ptrc-rhtA-R CTAAAACTTGAGGTCCAGAGAATGCTGACTAGTATTACCTAGCTGAGCTAGCTGT L-ΔygaY::Ptrc-rhtA-F CCGAGTCGGTGCTTTTTTGAATTCTCTAGAAGATGTCGTCTGGTTGCAGGG L-ΔygaY::Ptrc-rhtA-R AAATTCCACACATTATACGAGCCGGATGATTAATTGTCAACCGGTGGCGATAGACATCAG rhtA-F CGTATAATGTGTGGAATTTCACACAGGAAACAGACCATGCCTGGTTCATTACGTAAAATGCC rhtA-R ACGATGAAAACCTCGCCTTAATTAATGTCTAATTCTTTTATTTTGCTCTCTTTGCG R-ΔygaY::Ptrc-rhtA-F GGCGAGGTTTTCATCGTCAGGAA R-ΔygaY::Ptrc-rhtA-R AGGGTAATAGATCTAAGCTTCTGCAGATCCAGTTCTCGCTCCAGCG T-ΔygaY::Ptrc-rhtA-F ACCATCAGTCGCTACAAAGAGGG T-ΔygaY::Ptrc-rhtA-R CTGCCGGAGAATGCCCCTATTAC pTarget-ΔygaY::Ptrc-eamB-F AGTCAGCATTCCTGGACCTCAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCT pTarget-ΔygaY::Ptrc-eamB-R CTAAAACTTGAGGTCCAGAGAATGCTGACTAGTATTATACCTAGGACTGAGCTAGCTGT L-ΔygaY::Ptrc-eamB-F CCGAGTCGGTGCTTTTTTGAATTCTCTAGAAGATGTCGTCTGGTTGCAGGG L-ΔygaY::Ptrc-eamB-R AAATTCCACACATTATACGAGCCGGATGATTAATTGTCAACCGGTGGCGATAGACATCAG eamB-F CGTATAATGTGTGGAATTTCACACAGGAAACAGACCGTGACACCGACCCTTTTAAGTGC eamB-R ACGATGAAAACCTCGCCTTAATAGAAATGCGTACCGCGCAATAG R-ΔygaY::Ptrc-eamB-F GGCGAGGTTTTCATCGTCAGGAA R-ΔygaY::Ptrc-eamB-R AGGGTAATAGATCTAAGCTTCTGCAGATCCAGTTCTCGCTCCAGCG T-ΔygaY::Ptrc-eamB-F ACCATCAGTCGCTACAAAGAGGG T-ΔygaY::Ptrc-eamB-R CTGCCGGAGAATGCCCCTATTAC pTarget-ΔygaY::Ptrc-eamA-F AGTCAGCATTCCTGGACCTCAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCT pTarget-ΔygaY::Ptrc-eamA-R CTAAAACTTGAGGTCCAGAGAATGCTGACTAGTATTATACCTAGGACTGAGCTAGCTGT L-ΔygaY::Ptrc-eamA-F CCGAGTCGGTGCTTTTTTGAATTCTCTAGAAGATGTCGTCTGGTTGCAGGG L-ΔygaY::Ptrc-eamA-R AAATTCCACACATTATACGAGCCGGATGATTAATTGTCAACCGGTGGCGATAGACATCAG eamA-F CGTATAATGTGTGGAATTTCACACAGGAAACAGACCATGTCGCGAAAAGATGGGGTG eamA-R ACGATGAAAACCTCGCCTTAACTTCCCACCTTTACCGCTTT R-ΔygaY::Ptrc-eamA-F GGCGAGGTTTTCATCGTCAGGAA R-ΔygaY::Ptrc-eamA-R AGGGTAATAGATCTAAGCTTCTGCAGATCCAGTTCTCGCTCCAGCG T-ΔygaY::Ptrc-eamA-F ACCATCAGTCGCTACAAAGAGGG T-ΔygaY::Ptrc-eamA-R CTGCCGGAGAATGCCCCTATTAC pTD-line-F CTGCAGAAGCTTAGATCTATTACCC pTD-line-R TCTAGAGAATTCAAAAAAAGCACCG pTD-VF GGCCTTTTGCTCACATGTTC pTD-VF TAGCACGATCAACGGCACTG Ptrc99a-cmmetX-cgmetX-F CGTATAATGTGTGGAATTTCACACAGGAAACAGACCATGAACCTCCAGTCTCCGCA Ptrc99a-cmmetX-cgmetX-R GGGTACCGAGCTCTTAGATGTAGAACTCGATGTAGGTCGAAG Ptrc99a-line-F GAGCTCGGTACCCGGGGAT Ptrc99a-line-R TTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTTAACGTAAATGCATGCCGCTT T-F TACAGACAAGCTGTGACCGT T-R CGCTTCTGCGTTCTGATTTA
[0125] Example 2: Shake-flask fermentation of strains OAH1-X~OAH7-X
[0126] The constructed strains OAH1-X to OAH7-X were validated in fermentation medium. Single colonies of each strain were picked and cultured overnight at 37°C and 180 rpm in LB broth to prepare seed culture. 1 mL of seed culture was inoculated into a 500 mL shake flask containing 20 mL of fermentation medium and shaken at 30°C and 180 rpm until OD reached. 600=0.5, add 0.2 mM IPTG to a final concentration, and incubate at 30℃ and 180 rpm with shaking for 48 h. After fermentation, take 1 mL of fermentation broth, centrifuge at 12,000 rpm for 3 min, discard all supernatant, add 1 mL of distilled water to resuspend the bacterial cells and calcium carbonate, centrifuge at 12,000 rpm for 3 min and discard supernatant, add another 1 mL of distilled water to resuspend the bacterial cells and calcium carbonate, centrifuge at 12,000 rpm for 3 min and discard supernatant. Finally, add 800 μL of distilled water to resuspend the bacterial cells and calcium carbonate, then add 200 μL of 20% acetic acid aqueous solution, and let stand at room temperature for 5 min to dissolve the calcium carbonate. Take 100 μL of the bacterial solution with dissolved calcium carbonate and add it to 1900 μL of distilled water, dilute 20 times, and finally measure the biomass OD using a spectrophotometer. 600 OAH was detected using a Hitachi L8080 amino acid analyzer; specific methods can be found in the L8080 operation manual.
[0127] LB medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, dissolved in deionized water, pH at natural.
[0128] Fermentation medium: glucose 25 g / L, ammonium sulfate 16 g / L, yeast extract 2.5 g / L, KH₂PO₄ 1 g / L, MgSO₄ 0.5 g / L, CaCO₃ 15 g / L, salt solution 1 mL / L, with CaCO₃ separately aliquoted and sterilized (0.3 g per aliquot). Add CaCO₃ and IPTG (final concentration 0.025 mM) at inoculation.
[0129] Depend on Figure 1 , Figure 2 As shown in Table 2, compared with strain OAH1-X, strain OAH7-X increased the shake flask yield of OAH from 15.9 g / L to 17.8 g / L, representing a 12% increase in OAH yield. This indicates that increasing the supply of the precursor acetyl-CoA, enhancing the strain's substrate transport capacity, and enhancing the expression of homoserine acetyltransferase can effectively increase OAH accumulation.
[0130] Example 3: Fed-feed fermentation of strain OAH7-X in a 5 L fermenter
[0131] The constructed strain OAH7-X was streaked onto LB agar plates containing 50 mg / L kanamycin resistance and incubated overnight at 37°C. Single colonies were picked and transferred to LB tubes containing 50 mg / L kanamycin resistance, and incubated overnight at 37°C and 150 rpm to prepare the seed culture. The seed culture was inoculated into 100 mL of LB medium at a concentration of 5% (v / v) and incubated overnight at 37°C and 150 rpm to obtain the secondary seed culture. The secondary seed culture was inoculated into a 5 L fermenter containing 2 L of fermentation medium at a concentration of 15% (v / v), and IPTG was added to a final concentration of 0.2 mM. Fermentation was carried out at 30°C, 500 rpm, and an aeration rate of 0.5 V / V·min. When the pH value was higher than 6.80 (initial sugar in the fermenter was consumed), automatic feeding was activated, and feeding medium was added at a rate of 25 mL / h until the pH was lower than 6.80. Feeding was then stopped, maintaining a low residual sugar level in the fermenter, with a sugar concentration of 0-2 g / L, and incubation was continued for 96 h. After fermentation, OAH was detected using a Hitachi LA8080 amino acid analyzer. For specific methods, please refer to the LA8080 operation manual.
[0132] The culture medium formula for a 5 L fermenter is as follows: glucose 25 g / L, ammonium sulfate 16 g / L, yeast extract 2.5 g / L, KH2PO4 1 g / L, MgSO4 0.5 g / L, betaine 2.0 g / L, and trace metal salt solution 1 mL / L.
[0133] Feeding medium: glucose 500 g / L, (NH4)2SO4 16 g / L, yeast extract 4 g / L, KH2PO4 12.5 g / L, threonine 4 g / L, methionine 0.5 g / L, pH adjusted to 6.8 with 50% ammonia.
[0134] After genetic engineering, the engineered OAH7-X strain achieved an OAH yield of 17.8 g / L through shake-flask fermentation and 105.3 g / L through fed-batch fermentation in a 5 L fermenter. Therefore, the OAH engineered strain constructed in this invention can effectively accumulate OAH in the fermentation broth during fermentation, laying the foundation for constructing high-yield OAH engineered strains.
[0135] Table 2. Production of OAH by genetically engineered bacteria
[0136] Strain Flask OAH (g / L) Fed-batch fermentation OAH (g / L) OAH1-X 15.9 86.4 OAH7-X 17.8 105.3
[0137] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope of the present invention.
[0138] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.
Claims
1. A method for constructing a genetically engineered bacterium that produces O-acetyl-L-homoserine, characterized in that, Using strain OAH1 as the substrate bacteria, the genome of strain OAH1 was modified in at least one of steps 1 to 4 through the following steps: Step 1: Enhance the expression of genes that regulate the acetyl-CoA module; Step 2: Overexpress the heterologous phosphatidylcholine kinase encoding gene fxpK and the pantothenic acid kinase encoding gene coaA; Step 3: Strengthen the OAH transfer module; Step 4: Overexpress the heterologous homoserine acetyltransferase encoding genes cmmetX and cgmetX.
2. The construction method according to claim 1, characterized in that, The strain OAH1 is strain E. coli W3110, ΔmetI ΔmetJ ΔthrB ΔmetB ΔldhA ΔadhE ΔpflB Ptrc-metL ΔarcA ΔiclRPtrc-sucA sucDTTG Ptrc-zwf Δadd Ptrc-ompR.
3. The construction method according to claim 1, characterized in that, Enhanced regulation of acetyl-CoA module gene expression includes: a. Enhance the expression of the phosphorylacetyltransferase-encoding gene pta; b. Enhance the expression of the acetate kinase-encoding gene ackA; and / or c. Enhance the expression of the acetyl-CoA synthase encoding gene acs.
4. The construction method according to claim 1, characterized in that, The phosphatidylcholine enzyme encoding gene fxpK and the pantothenic acid kinase encoding gene coaA are derived from Bifidobacterium adolescentis.
5. The method for constructing genetically engineered bacteria according to claim 1, characterized in that, Step 2 involves replacing the pseudogene nmpC in the genome of the basal bacteria or the engineered strain modified in Step 1 with the Ptrc-fxpK-coaA gene.
6. The construction method according to claim 1, characterized in that, Step 3 involves overexpressing the amino acid efflux pump encoding genes eamA, eamB, and / or rhtA.
7. The method for constructing genetically engineered bacteria according to claim 1, characterized in that, Overexpression of the heterologous homoserine acetyltransferase encoding genes cmmetX and cgmetX includes: I. Constructing overexpression plasmids for the homoserine acetyltransferase gene cmmetX from *Corynebacterium marineum* and the gene cgmetX from *Corynebacterium glutamicum*; and II. The overexpression plasmid is introduced into a basal bacterial strain or an engineered strain modified in at least one of steps 1 to 3 to obtain a genetically engineered strain that produces O-acetyl-L-homoserine.
8. The construction method according to claim 1, characterized in that, The nucleotide sequence of the ackA gene is shown in SEQ ID NO.1, the nucleotide sequence of the pta gene is shown in SEQ ID NO.2, the nucleotide sequence of the fxpK gene is shown in SEQ ID NO.3, the nucleotide sequence of the coaA gene is shown in SEQ ID NO.4, the nucleotide sequence of the rhtA gene is shown in SEQ ID NO.5, the nucleotide sequence of the eamB gene is shown in SEQ ID NO.6, the nucleotide sequence of the eamA gene is shown in SEQ ID NO.7, the nucleotide sequence of the cmmetX gene is shown in SEQ ID NO.8, the nucleotide sequence of the cgmetX gene is shown in SEQ ID NO.9, and the nucleotide sequence of the Ptrc promoter is shown in SEQ ID NO.
10.
9. The genetically engineered bacteria obtained by the construction method according to any one of claims 1-8.
10. The application of the genetically engineered bacteria according to claim 9 in the fermentation production of O-acetyl-L-homoserine.
Citation Information
Patent Citations
Microorganism producing O-acetyl-homoserine and the method of producing O-acetyl-homoserine using the microorganism
CN102002472A
Recombinant escherichia coli capable of producing O-acetyl-L-homoserine at high yield and application of recombinant escherichia coli
CN112063572A
O-acetyl-L-homoserine producing strain, construction method and application
CN113388564A
Recombinant escherichia coli with high yield of O-acetyl-L-homoserine and application of recombinant escherichia coli
CN117511837A
Recombinant escherichia coli for efficiently producing O-acetyl-L-homoserine as well as construction method and application of recombinant escherichia coli
CN118531032A