Human-derived antibody A023 for resisting Marburg virus and application of human-derived antibody A023
By developing a humanized antibody that specifically binds to Marburg virus GP4, the problem of existing antibodies triggering an immune response in the human body has been solved. This achieves efficient blocking of the interaction between the virus and host cells, provides a safe treatment strategy and combination therapy, and enhances the efficacy of antiviral therapy.
Patent Information
- Application Number
- CN202610165793.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-05
- Publication Date
- 2026-05-08
AI Technical Summary
Existing monoclonal antibodies against Marburg virus elicit an immune response in the human body, but their clinical application faces challenges such as strong immunogenicity and short half-life, and there is a lack of efficient and safe treatment strategies.
A humanized antibody that specifically binds to Marburg virus GP4 was developed. It was screened and prepared using eukaryotic cell display technology. It binds to the MARV GP4 target molecule, blocks the interaction between the virus and the host cell, and can be used in combination with antiviral drugs or immunomodulators.
It achieves highly effective blocking and treatment of Marburg virus, reduces pathological damage, provides new drug candidates, and can enhance antiviral efficacy and reduce the risk of immune response through combination therapy.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of novel antibody candidate drug technology in the treatment of antiviral infections. Specifically, this invention relates to the gene sequence screening, identification, preparation of a human antibody A023 against Marburg virus (MARV) envelope glycoprotein 4 (GP4) and its application in the detection and treatment of Marburg virus disease. Background Technology
[0002] Marburg virus (MARV, also known as green monkey virus) exhibits polymorphism, with its virion branching or coiling into U-shapes, figure-6 shapes, or rings. This virus is a deadly virus and the first filovirus discovered in humans, causing Marburg hemorrhagic fever. It is related to Ebola virus, belonging to the Filoviridae family, and also originated in Uganda and Kenya in Africa, causing a common disease in humans and other primates. [1,2] .
[0003] Marburg virus is transmitted from animals to humans, but the exact origin of the virus remains unclear. Infection with this highly pathogenic virus can lead to Marburg virus disease (MVD), clinically characterized by acute fever, bleeding tendency, and multiple organ failure, with a mortality rate exceeding 50%. Since its initial outbreak in Germany and Serbia in 1967, Marburg virus has caused numerous epidemics in Africa, and its high transmissibility and rapid progression pose a serious threat to global public health. Due to the severity of symptoms and high mortality rate, Marburg virus has become a global public health threat. [3] .
[0004] Marburg virus (Marburg virus) is a single-stranded, negative-sense RNA virus whose genome encodes various structural proteins. Among them, glycoprotein GP is a key surface protein for viral invasion of host cells, mediating viral binding to host receptors and promoting membrane fusion and internalization. Filoviridae virus particles typically exhibit a filamentous or rod-shaped morphology, encapsulated by a lipid envelope embedded with GP trimer spike proteins. These spikes play a central role in viral attachment and fusion. Studies have shown that Marburg virus GP proteins can initiate viral invasion by interacting with receptor molecules (such as TIM-1 or AXL) on the host cell surface. The GP4 subtype plays a crucial role in viral pathogenicity and immune evasion. Research indicates that Marburg virus structural proteins VP24, VP35, VP40, and glycoprotein 4 (gp4) are all important proteins for viral assembly and infection. GP4, a key structural protein for viral invasion of host cells, mediates viral binding to host cell receptors, promoting viral membrane fusion and invasion. Studies have shown that antibodies targeting GP4 can block the viral infection process and have potential therapeutic value.
[0005] Currently, there is no specific treatment for Marburg virus disease. Treatment generally involves symptomatic relief and supportive therapies, such as maintaining fluid, electrolyte, and acid-base balance, and preserving coagulation function. There is an urgent need to develop novel, highly targeted, and safe treatment strategies for emergency prevention and treatment. Monoclonal antibody drugs, with their advantages of high specificity, high affinity, low toxicity, and ability to mediate long-lasting immune responses, show great promise in the field of antiviral therapy. However, repeated injections of mouse-derived McAbs into humans can induce human anti-mouse antibody (HAMA) reactions in patients, leading to systemic allergic toxicity and blocking the efficacy of the antibodies.
[0006] Currently, the development of therapeutic antibodies against Marburg virus is still in its early stages. While some studies have reported that a few murine or chimeric antibodies have shown some protective effects in animal models, their clinical application still faces challenges such as strong immunogenicity and short half-life. [4,5] .
[0007] References:
[0008] [1] A Asad, A Aamir, NE Qureshi, et al. Past and current advances in Marburg virus disease: a review. Infez Med, 2020, 28(3):332-345. [2] P Reynolds, A Marzi. Ebola and Marburg virus vaccines. VirusGenes, 2017, 53(4):501-515. [3] G Cuomo-Dannenburg, K McCain, R McCabe, et al. Marburg virusdisease outbreaks, mathematical models, and disease parameters: a systematic review. Lancet Infect Dis, 2024, 24(5):e307-e317. [4] D Abelson, J Barajas, L Stuart, et al. Long-term ProphylaxisAgainst Aerosolized Marburg Virus in Nonhuman Primates With an AfucosylatedMonoclonal Antibody. J Infect Dis, 2023, 228(Suppl 7):S701-S711. [5] Marzi A, Haddock E, Kajihara M, et al. Monoclonal AntibodyCocktail Protects Hamsters From Lethal Marburg Virus Infection. J Infect Dis2018, 218(suppl_5): S662-S665. Summary of the Invention To address the shortcomings and deficiencies in existing antibody preparation technologies, this invention provides the gene sequence screening, identification, preparation, and application of a human antibody against Marburg virus in the diagnosis and treatment of Marburg virus disease.
[0009] The human antibody against Marburg virus provided by this invention can specifically bind to the MARV GP4 target molecule, the nucleotide sequence of which is shown in SEQ ID NO:5, or the amino acid sequence of which is shown in SEQ ID NO:6.
[0010] Furthermore, the antigen complementarity-determining regions HCDR1, HCDR2, and HCDR3 sequences of the heavy chain variable region of the antibody are GGTFSSYA, IIIPILGIA, and ARESYYYDSSGYYYYMDV, respectively. The antigen complementarity-determining regions LCDR1, LCDR2, and LCDR3 sequences of the light chain variable region are QDIRRW, AAS, and QQSNSFPLG, respectively.
[0011] Furthermore, the antibody specifically binds to the MARV GP4 target molecule, and the nucleotide sequence of the antibody heavy chain variable region (VH) is shown in SEQ ID NO:1, or the amino acid sequence of the heavy chain variable region (VH) is shown in SEQ ID NO:3; The nucleotide sequence of the light chain variable region (VL) is shown in SEQ ID NO:2, or the amino acid sequence of the light chain variable region (VL) is shown in SEQ ID NO:4.
[0012] Furthermore, the light chain (VL) constant region of the described full-length anti-MARV GP4 human antibody is κ, and the heavy chain (VH) constant region is IgG1.
[0013] This invention discloses the preparation of humanized antibodies against Marburg virus (MARV) envelope structural glycoprotein 4 (GP4) through screening a human antibody library, and their application in the development of drugs for the diagnosis and treatment of Marburg virus disease (MVD). This invention develops humanized antibodies targeting the MARV GP4 protein, particularly using eukaryotic cell display technology for the screening and preparation of fully human antibodies. This not only blocks the interaction between the virus and host cells and inhibits viral replication, but may also alleviate pathological damage by regulating the body's immune response, providing new drug candidates for the prevention and treatment of Marburg virus disease.
[0014] This invention also covers the application of the antibodies in combination drugs or therapies, such as in combination with antiviral drugs or immunomodulators to enhance antiviral efficacy. Furthermore, based on the variable region genes of human antibodies, derivative forms such as chimeric antibodies, bifunctional antibodies, or immunotoxins can be developed, providing new possibilities for the development of anti-filovirus drugs. Research on the mechanism of action of human antibody drugs targeting Marburg virus and further clinical translation hold promise for providing effective treatment strategies for this type of disease. Attached Figure Description
[0015] Figure 1 shows the Western blot analysis of the target protein expression using the His-tagged antibody in Example 1; where Lane 1 is the negative control and Lane 2 is the supernatant of transfected cell lysate.
[0016] Figure 2 shows the detection of purified protein by SDS-PAGE gel electrophoresis and Western blot (anti-His MAb antibody) in Example 1; where, Lane 1. SDS-PAGE analysis of recombinant human GP4 purified protein; Lane 2. Negative control; Lane 3. GP4 protein analysis by Western blot using anti-His monoclonal antibody.
[0017] Figure 3 shows the expression vector pVB240516-1735 (10297 bp) of the antibody eukaryotic cell display vector in Example 3.
[0018] Figure 4 shows the identification of the VH fragment amplified by reverse transcribed cDNA using agarose gel electrophoresis in Example 3; where M: DL2000, Figure A shows VH amplification of IgG, and Figure B shows VH amplification of IgM; Lines 1-7 represent different 5' primers VH1, VH2, VH3, VH4, VH4DP63, VH6, and VH157, respectively. Agarose concentration was 1%, 0.5×TAE.
[0019] Figure 5 shows the SDS-PAGE analysis of recombinant antibody expression in Example 5; Lane M in the center of the lane is the protein marker (5 μL loading, molecular weight shown on the far left); the lanes from left to right are: Lane 1: 1.0 μg non-reduced OJC004-SY08_H_PR_A057 (abbreviated as A057); Lanes 2-4: blank control; Lane 5: 1.0 μg non-reduced OJC004-SY08_H_PR_A022 (abbreviated as A022); Lane 6: 1.0 μg non-reduced OJC004-SY08_H_PR_A023 (abbreviated as A023); Lane 7: 1.0 μg non-reduced OJC004-SY08_H_PR_A025 (abbreviated as A025); Lane 8 ...9: 1.0 μg non-reduced OJC004-SY08_H_PR_A025 (abbreviated as A025); Lane 10: 1.0 μg non-reduced OJC004-SY08_H_PR_A025 (abbr Lane 11 is the reduction of OJC004-SY08_H_PR_A057 by 1.0 μg; Lane 12 is the reduction of OJC004-SY08_H_PR_A023 by 1.0 μg; Lane 13 is the reduction of OJC004-SY08_H_PR_A025 by 1.0 μg; Lane 14 is the reduction of human IgG positive control by 1.0 μg.
[0020] Figure 6 shows the ELISA identification of the binding of human antibody to MARV GP4 antigen in Example 6; where SamplesIPI is the human IgG positive control; BC is the blank control; Samples 1-5 are recombinant antibody proteins, among which the successfully expressed samples OJC004-SY08_H_PR_A023 (abbreviated as A023) and OJC004-SY08_H_PR_A022 (abbreviated as A022) both have strong binding activity.
[0021] Figure 7 shows the surface plasmon resonance (SPR) assay for the binding activity of recombinant human antibody A023 to MARV GP4 in Example 7. Detailed Implementation
[0022] Unless otherwise specified, the scientific and technical terms used in this article are intended for understanding by those skilled in the art.
[0023] Immunoglobulins are a class of structurally related glycoproteins composed of two pairs of polypeptide chains: a pair of low-molecular-weight light chains (L) and a pair of high-molecular-weight heavy chains (H), all four chains linked together by disulfide bonds. Each heavy chain typically consists of a heavy chain variable region (VH) and a heavy chain constant region (CH). Each light chain typically consists of a light chain variable region (VL) and a light chain constant region (CL). The light chain constant region typically consists of a single domain, CL. VH and VL can be further subdivided into highly variable regions (or highly variable regions in sequence and / or structurally defined loops), also known as complementarity-determining regions (CDRs), interspersed with more conserved regions called framework regions (FRs). Each VH and VL typically consists of three CDRs and four FRs, arranged from the amino terminus to the carboxyl terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4 (see Chothia and Lesk, Canonical Structures, 1987). Typically, the amino acid residues in this region are numbered using the Kabat rule (Sequences of Proteins of Immunological Interest, 5th Ed, Public Health Service, National Institutes of Health, Bethesda, MD, 1991), which is the numbering system used in this paper for both heavy-chain and light-chain variable domains.
[0024] Humanized / Humanized Antibodies: As used herein, these refer to antibodies derived from non-human animals, typically hamsters, which, after modification, retain or substantially retain the antigen-binding properties of the parent antibody, but with reduced immunogenicity in humans. Humanized antibodies, on the other hand, are derived directly from genes in human B cells, exhibiting low immunogenicity and overcoming the shortcomings of previous murine monoclonal antibodies, enabling sustainable in vivo drug delivery. Because the antibodies of this invention are defined by structural and functional characteristics, "humanized antibody" can be used interchangeably with "antibody."
[0025] Complementarity-determining region (CDR): This refers to the characteristic sequence of an antibody containing multiple amino acids. These amino acid sequences collectively define the variable fragment (Fv) region of the immunoglobulin binding site, which determines the binding affinity and specificity of the target antigen MARV GP4. If it is a heavy chain, it is described as HCDR, and if it is a light chain, it is described as LCDR.
[0026] Frame regions (FRs): These are amino acid sequences inserted between CDRs. These portions of the antibody are used to hold the CDRs in place (allowing the CDRs to bind to the antigen). Both the light chain variable region and the heavy chain variable region contain frame regions (FRs) and typically three CDRs.
[0027] Constant region (CR): refers to the portion of the antibody molecule that confers effector function. In this invention, the constant regions of the humanized antibodies are all derived from human immunoglobulins. The heavy chain constant region can be selected from five isotypes: α, δ, ε, γ, or μ. Furthermore, various subclasses of the heavy chain (e.g., the IgG subclass of the heavy chain) can induce different effector functions; therefore, by selecting the desired heavy chain constant region, antibodies with the desired effector function can be produced. Preferred heavy chain constant regions are γ1 (IgG1), γ2 (IgG2), γ3 (IgG3), and γ4 (IgG4), with γ2 (IgG2) being more preferred. The light chain constant region can be of type κ or λ, preferably type κ.
[0028] Antibody affinity refers to the overall strength of the interaction between two molecules, such as an antibody and an antigen. Affinity characterizes the strength of binding between molecular pairs (e.g., antibody-antigen). The affinity of molecule X for ligand Y can be represented by the dissociation constant (KD), which is the concentration of Y required to occupy half of the binding site of X molecules present in solution. A smaller Kd indicates a stronger or higher affinity interaction and requires a lower ligand concentration to occupy the site.
[0029] The variable or constant regions of the immunoglobulin heavy or light chain can be linked as described by using standard recombinant DNA techniques to create polynucleotides that can be expressed in a suitable host [thus producing said immunoglobulin chain (one or more)], or the variable and constant regions can be linked by using peptide chemical synthesis.
[0030] Specifically, the present invention clones a variable deserialization sequence of a human antibody, which is then reconstructed into a full-length human IgG1 antibody, retaining the ability to specifically bind to the parent antibody and recognize the antigen. Through optimization and screening, the obtained human antibody exhibits good binding affinity.
[0031] "Human antibodies" or "antibodies," as used in this invention, comprise the complete molecule as well as fragments of them capable of binding to epitope determinants, such as Fab, F(ab′)2, and Fv. These antibody fragments retain the ability to selectively bind to human MARV GP4, and examples of these fragments include, but are not limited to, the following: (1) Fab, a fragment containing a monovalent antigen-binding fragment of an antibody molecule, which can be degraded by the enzyme papain to generate a complete light chain and a part of a heavy chain; (2) Fab′ can be obtained by treating the whole antibody with pepsin and then reducing it to generate a part of the complete light chain and heavy chain; each antibody molecule can yield two Fab′ fragments. (3) F(ab)′2, can be obtained by treating with the enzyme pepsin but without subsequent reduction to obtain an antibody fragment; (Fab)2 is a dimer of two Fab′ fragments linked together by two disulfide bonds; (4) Fv is defined as a genetically engineered fragment containing a light chain variable region and a heavy chain variable region represented as two strands.
[0032] The present invention will now be described in further detail with reference to the embodiments. It should be understood that these embodiments are merely illustrative and explanatory in nature and are not intended to limit the invention. Unless otherwise specified, the experimental methods used in the following embodiments are conventional molecular biology methods. Unless otherwise specified, the materials and reagents used in the following embodiments can be obtained from commercial reagent companies.
[0033] Example 1: Expression and preparation of MARV GP4 protein This embodiment describes the recombinant expression and preparation process of MARV (Marburg virus) envelope glycoprotein GP4, aiming to obtain high-purity, high-activity GP4 protein for subsequent antibody library screening and functional studies. An expression vector was constructed using in vitro gene synthesis methods, protein expression was achieved in HEK293T cells, and purification was performed using affinity chromatography.
[0034] 1.1 Construction of expression vector MARV GP4 expression vectors were prepared using in vitro gene synthesis methods. The synthesized gene encodes the MARV GP4 protein (UniProt accession number: P35253), with a DDK tag added to the N-terminus and a 6×His tag added to the C-terminus for easy detection and purification. After codon optimization (nucleotide sequence SEQ ID NO:5 or amino acid sequence SEQ ID NO:6), the synthesized gene sequence was cloned into the pcDNA3.1(+) eukaryotic expression vector to construct the recombinant plasmid pcDNA3.1-MARV-GP4-DDK-His. After the vector was verified by sequencing to be correct, it was used for transfection experiments.
[0035] 1.2 Cell transfection and protein expression 24 hours before transfection, HEK293T suspension cells (ATCC CRL-3216) were inoculated at a concentration of 0.5–0.7 × 10⁻⁶ cells / mL. 6 Cells were seeded at a density of 100 cells / mL in 200 mL of serum-free medium (FreeStyle™ 293 Expression Medium) and placed in a 2000 mL polycarbonate shake flask (with a vented membrane cap). The flasks were incubated at 37°C with shaking at 110 rpm. On the day of transfection, the cell density was adjusted to 1–1.2 × 10⁻⁶ cells / mL. 6 For each cell / mL cell, 1 μg of high-quality recombinant plasmid DNA and 4 μg of linear 40 kDa PEI (polyethyleneimine) per mL of culture volume were mixed in 1 / 10 volume of fresh serum-free culture medium and incubated at room temperature for 15 minutes to form a DNA-PEI complex. The complex was added to 100 mL of cell suspension (total transfection volume of 1 L) and cultured for another 48 hours. When harvesting cells, the cell pellet was collected by centrifugation at 3000 rpm for 6 minutes, and cell samples were taken for recombinant protein expression analysis.
[0036] 1.3 Protein purification The cell pellet was resuspended in lysis buffer (20 mM Tris-HCl, 150 mM NaCl, 1% NP-40, pH 8.0) and the cell density was adjusted to 102. 6 ~10 7Cells / mL, incubated on ice for 30 minutes with intermittent vortexing, lysis buffer centrifuged at 12,000×g for 10 minutes, supernatant collected; purification was performed using a Ni-NTA affinity chromatography column (Qiagen). The supernatant was loaded onto the column bed, and contaminating proteins were removed with wash buffer (20 mM Tris-HCl, 150 mM NaCl, 20 mM imidazole, pH 8.0). The target protein was eluted with elution buffer (0.1 M glycine, pH 2.75). Protein expression was analyzed by Tris-SDS-PAGE (8-20% gel), and Western blot analysis was performed using a His-tagged antibody. The eluent was immediately neutralized to pH 7.3 with 1 M Tris-HCl (pH 10.0), and glycerol was added to a final concentration of 10% to stabilize the protein.
[0037] 1.4 Expression analysis using Western blot Expression cells were collected and lysed using a double-detergent lysis reagent. The supernatant sample was collected and tested using an anti-His-tagged monoclonal antibody (1:5000 dilution) as the primary antibody and an HRP-labeled goat anti-mouse secondary antibody (1:10000 dilution, Takara Bio).
[0038] Results: Western blot analysis of protein expression showed a specific band of approximately 23 kDa in the supernatant of transfected cells. Figure 1 As shown, the molecular weight of the target GP4 protein is represented in lane 2, while the negative control group showed no band, indicating successful expression of MARV GP4 protein in HEK293T cells. The protein was purified by chromatography, with elution fractions 1-4 combined, and dialyzed overnight using 25 mM Tris-HCl and 100 mM NaCl (pH 8.0). The protein was then concentrated using an ultrafiltration tube (10 kDa molecular weight cutoff). The protein concentration was determined using the Microplate Bradford method, yielding 1.60 μg / μL, with a total yield of 1000 μg of purified protein.
[0039] The final protein sample was further validated by SDS-PAGE and Western blot. Lane 1 of Figure 2 shows two bands of approximately 23 kDa in the eluted fraction, presumably due to post-translational modifications of the eukaryotic protein. The negative control (lane 2 of Figure 2) showed no signal. Western blot (lane 3 of Figure 2) confirmed that the protein possessed His tag specificity, confirming that the expressed protein was the recombinant target protein. The purified protein was aliquoted and stored at -80°C for subsequent antibody library screening.
[0040] This embodiment successfully prepared the MARV GP4 recombinant protein. High-purity, high-yield protein was obtained through in vitro gene synthesis, HEK293T cell expression, and affinity chromatography purification. This protein can be used for subsequent antibody library screening, animal immunization for monoclonal antibody preparation, or as an antigen for diagnostic reagent development.
[0041] Example 2: Fluorescent labeling and identification of MARV GP4 protein This embodiment aims to fluorescently label purified MARV GP4 protein for subsequent flow cytometry screening of GP4-binding B cells. To prevent the fluorescent labeling from affecting antigen-binding activity, two strategies, Rapid iFluor series and FITC, were used to label the GP4 protein. For the Rapid iFluor series, the labeling process used ReadiLink™ Rapid iFluor series fluorescent dyes, covalently coupling the fluorescent group to the GP4 protein. The labeling efficiency and protein activity were verified to ensure that the labeled protein was suitable for high-throughput screening. For FITC fluorescent labeling, the labeling process was based on the covalent binding reaction of FITC (fluorescein isothiocyanate) with the free amino groups in the protein. The labeling efficiency was ensured by optimizing the reaction conditions, and the labeled protein was purified by column chromatography. Finally, the molar ratio of FITC to protein (F / P) was calculated to verify the labeling effect. This method is applicable to MARV GP4 protein (molecular weight approximately 23 kDa, with a His tag), ensuring that the labeled protein retains its antigen-binding activity.
[0042] 2.1 Rapid iFluor fluorescent labeling series Take 100 μg of MARV GP4 protein (approximately 62.5 μL) and dilute with PBS buffer to a final concentration of 1 mg / mL (total volume 100 μL), ensuring the protein solution is free of precipitation or aggregation. Select the ReadiLink™ Rapid iFluor 647 and ReadiLink™ Rapid iFluor 594 kits (AAT Bioquest) and equilibrate iFluor 647 or iFluor 594 dye component A (50 μg protein per vial) to room temperature. Since 100 μg of protein is being labeled, two vials of component A are required. This is done by dividing the 100 μg protein into two 50 μg protein portions and reacting each component to stain 50 μg of protein with one vial of labeling dye. Then combine the two vials for the next step; allow the conjugated reaction mixture to stand at room temperature for 30–60 minutes. Add 5 μL (for 50 μg protein) or 10 μL (for 100 μg protein) to the total reaction mixture, which is 10% TQ™ staining quenching buffer (component C); mix thoroughly. Incubate at room temperature for 10 minutes. The labeled protein can be used directly (storage: protein at a concentration >0.5 mg / mL frozen at –20°C). Finally, determine the concentration and fluorescence properties of the labeled protein using NanoDrop. Compare the A values of the protein before and after labeling. 280 (Protein absorption) and A 650 The iFluor 647 absorbance value is used to calculate the coupling ratio (F / P ratio) between the fluorescent dye and the protein. The ideal F / P ratio is 2-4 to ensure moderate labeling efficiency and avoid over-labeling that could affect protein activity.
[0043] 2.2 FITC fluorescent labeling of GP4 protein Take 100 μg of MARV GP4 protein (approximately 62.5 μL) and dilute it with 0.1 M SB buffer (pH 8.5) to a final concentration of 1.0 mg / mL (total volume 100 μL). Place the diluted solution in a small volumetric flask protected from light and keep it on ice. Weigh 5.8 mg of FITC (dissolved in 5.8 mL of anhydrous DMSO) to prepare a 1.0 mg / mL stock solution. Slowly add 150 μL of the FITC stock solution to the protein solution (10 μL at a time, 30-second intervals, while vortexing) to avoid excessively high local concentrations. Incubate at 4°C with stirring for 8 hours to ensure that FITC fully binds to the free amino groups of the protein. Then add NH4Cl to a final concentration of 50 mM (approximately 5.75 mg), mix, and incubate at 4°C for 2 hours to stop any unreacted FITC. The labeled protein and free FITC were separated using a Sephadex G-50 column (pre-equilibrated with PBS). The reaction mixture was loaded to the top of the column, eluted with PBS, and the first elution peak (pale yellow, corresponding to the MARV GP4-FITC conjugate) was collected. The A value of the labeled protein was measured using a UV spectrophotometer. 280 (Protein absorption) and A 495 (FITC absorption). The binding activity of MARV GP4 to anti-His-Tag antibody before and after labeling was compared by ELISA, and the OD... 450 The value should decrease by less than 20%, confirming that the marker does not significantly affect the protein structure.
[0044] Results: Rapid iFluor fluorescence series showed that MARV GP4 protein could be labeled with iFluor 647 with a labeling efficiency F / P ratio of 3.2, meeting experimental requirements. Simultaneously, FITC fluorescent labeling of MARV GP4 protein showed an F / P ratio of approximately 0.8, indicating high protein activity. This protein labeling protocol ensures that GP4 protein, after fluorescent labeling, can be further used for antibody library screening, providing reliable materials for antibody discovery. This labeling protocol can be further optimized with labeling conditions (such as dye ratios) to further improve efficiency and can be extended to other fluorescent dyes (such as the Alexa Fluor series) for multicolor labeling, supporting multi-parameter flow cytometry analysis.
[0045] Example 3: Construction and Identification of Eukaryotic Cell Display Antibody Library This embodiment aims to construct a humanized antibody library using mammalian cell surface display technology. By cloning the VH and VL gene regions of human B cell antibodies from peripheral blood mononuclear cells (PBMCs) of autoimmune patients and healthy individuals, two strategies are employed to simultaneously construct a diverse display antibody library: co-light chain design (using universal light chains to simplify library complexity) and scFv-Fc form (fusing single-chain variable fragments with Fc regions to achieve membrane display). The constructed display antibody library is then used for antibody screening of specific antigens.
[0046] 3.1 Construction process of human gene antibody library Main steps: PBMCs were isolated from peripheral blood of 30 healthy individuals. Total RNA was extracted using the QIAGEN RNA extraction kit and quantified by NanoDrop (average concentration 1.8 μg / μL, A 260 / A 280 =1.9); Using RNA as a template, the VH and VL genes were amplified by RT-PCR: 14 pairs of heavy chain primers (covering the IGHV1-IGHV7 family) and 10 pairs of light chain primers (targeting the IGKV / IGLV family) were used, as detailed in Dr. Li Yu's dissertation (Fourth Military Medical University, Construction and Screening of SARS-CoV Immunophage Antibody Library, 2005); In addition, two primers were added for the 3' end of the heavy chain amplification: IgG-CH1-Rv 5'TCTTGTCCACCTTGGTGTTG3'; IgM-CH1-Rv 5' TGGAAGAGGCACGTTCTTTTCTTT3' and three primers were added for the 3' end of the light chain amplification: IgG-CL-Kappa 5' ACACTCTCCCCTGTTGAAGCTCTT3'; IgG-CL-lambda1 5'TGAACATTCTGTAGGGGCCACTG3'; IgG-CL-lambda2 5' TGAACATTCCGTAGG The PCR reaction system (GGC AAC TG3') is shown in Table 1. The reaction conditions were 98℃ for 10 s, 55℃ for 15 s, and 72℃ for 5 s, for 30 cycles. PCR primers were designed according to the V-base website and synthesized by Invitrogen. The PCR products were purified by 1% agarose gel electrophoresis before library construction.
[0047] Table 1 PCR reaction system
[0048] 3.2 Construction of cell display antibody library Main steps: First, for the co-light chain strategy display strategy, the amplified VH gene pool is combined with a universal light chain sequence (derived from the human κ chain constant region: V-GENE: IGKV1-39). 1) Overlapping PCR fusion was used to reduce the interference of light chain diversity on library complexity. Secondly, for the scFv-Fc antibody display form, the amplified VH and VL genes were linked via a flexible linker peptide (G4S)3 and then cloned into the eukaryotic expression vector pEc-Ba (containing the CMV promoter, human IgG1 Fc fragment, and platelet-derived growth factor receptor transmembrane region). The expression vector was then processed... EcoR V / XhoLinearized by double enzyme digestion, the antibody expression vector was constructed via Gibson recombination. To verify the display performance of the vector, the red mScarlet-H fluorescent gene (696 bp) was fused to the N-terminal of the Fc sequence. This allows for fluorescence observation of all sequences displayed on the cell surface, facilitating subsequent library observation and verification. The transmembrane sequence of the vector utilizes the transmembrane region of PDGFR (150 bp). Based on the first-generation pLenti-Display backbone vector, the vector pVB240516-1735 (10297 bp) for antibody expression screening was finally designed through local sequence fine-tuning and optimization.
[0049] 3.3 Amplification, ligation, and transformation of human antibody variable region genes Main steps: Total RNA was extracted and gene amplified from peripheral blood mononuclear cells (PBMCs) isolated from healthy individuals. The total mRNA was then subjected to RT-PCR, followed by amplification of the antibody VH encoding gene using designed Seamless Cloning PCR primers. The pVB240516-1735 (10297 bp) fragment was linearized using the restriction endonuclease EcoR V / Mlu I, and the large fragment was recovered (Note: dephosphorylation is not required; dephosphorylation is necessary for single-enzyme digestion). The amplified antibody gene was then combined with the linearized antibody expression vector and recombined using Gibson technology to construct a complete antibody expression vector. Following the recommended Seamless Cloning ligation system, the purified and recovered second-round PCR product was mixed with the linearized plasmid and recombined using Gibson technology, with ligation ratios of either 1:3 or 1:5 (vector molar: fragment molar = 1). Subsequently, 10 μL of the reaction product was electroporated with 100 μL of ordinary competent DH5α cells, and the cells were resuspended in 500 μL of LB medium (preheated to 37°C). After activation at 37°C and 220 rpm for 1 h, the cells were plated onto LB bacterial culture dishes containing ampicillin and incubated overnight at 37°C for 8 h. The heavy chain gene library capacity was calculated based on the number of bacterial clones, and the colonies were recovered. The culture dishes were rinsed with 10 ml of LB medium on ice, and the bacterial cells were collected by centrifugation at 4000 rpm and 4°C for 20 minutes to obtain the established display antibody library.
[0050] 3.4 Recombinant Detection Main steps: From overnight culture plates, randomly pick at least 10 single clones using a sterile pipette tip and transfer them to LB medium. After vortexing and mixing, perform PCR identification using the bacterial culture as a template. Calculate the heavy chain gene library capacity based on the number of clones grown and recover the colonies. Finally, select positive clones for sequencing to further analyze ligation efficiency. The variable region sequence of positive clones can be searched in the IMGT gene database for known germline genes of human antibodies with the highest homology, further determining the germline gene family distribution and characteristics of the amplified antibody.
[0051] Results: For the design and optimization of antibody vectors for cell display, through local fine-tuning and component optimization, we added the red mScarlet-H fluorescent gene (696 bp) to the N-terminal of the antibody as a positive control for cell display. Finally, we designed the expression vector pVB240516-1735 (10297 bp) suitable for antibody display. Figure 3 ).
[0052] Subsequently, by clustering and comparing the existing collected antibody sequences, and combining the classification of human antibody germline sequences in the IMGT database, primer sequences and their paired primers covering the human V gene fragment (VH1–VH7 families) were selected to amplify the variable region gene of the antibody heavy chain from the collected human PBMCs. Agarose gel electrophoresis results showed that regardless of whether IgG or IgM reverse-transcribed cDNA was used for amplification, the amplified VH fragment (~400 bp) of the expected size could be obtained. Figure 4 The amplification of human VL is similar and will not be repeated here.
[0053] After amplifying the antibody VH and co-light chain VL and recombining them with vectors, the resulting molecules were transformed into competent Escherichia coli DH5α. Three batches of 30 randomly selected single clones were subjected to PCR analysis. The results showed 27 positive gene clones. Sequencing alignment showed that all vectors contained antibody fragments, with a recombination rate exceeding 90%. Blast alignment and GenSmart™ antibody variable region sequence analysis were performed on the existing results. The alignment results showed that 8 out of the 9 randomly analyzed vectors contained the antibody VH coding sequence (Table 2), exhibiting high diversity (>80%) and covering multiple germline families. This indicates that the antibody library was successfully constructed and can be used for the next step of antigen-specific template antibody screening.
[0054] Table 2. Diversity analysis of scFv antibody library heavy chain sequencing
[0055] Example 4: Screening of anti-MARV GP4 human antibodies and cloning of light and heavy chain variable region genes This embodiment aims to screen and culture antigen MARV GP4-binding positive cells, and use RT-PCR to determine the antibody variable region gene contained in the positive cells. Then, the obtained target VH / VL gene is analyzed using the International Immunogenetics Database (IMGT).
[0056] Implementation steps: 4.1 Screening and culture of candidate antibody-positive cells Main steps: The antibody library (Example 2) that displays the antibody minibody, i.e., membrane-type scFv-Fc, was subjected to large-scale (500 mL) plasmid extraction using Lip2000. TM After transfecting HEK293 engineered cells, the cells were cultured, and the fluorescently labeled target antigen MARV GP4 / RBD prepared in Example 2 was incubated with the target cells for FAC fluorescence screening. The general steps included extracting the expression plasmid containing the antibody library membrane type scFv-Fc and transiently transfecting it into HEK-293T cells. One day before transfection, HEK-293T cells in conventional culture were cultured at a density of 4 × 10⁶ cells per well. 6 Cells were seeded at a density of [number] cells per well in 6-well cell culture plates. 4 μg of plasmid DNA from the constructed heavy chain gene library was added to 250 μL of RPMI-1640. Separately, 10 μL of LDgen Transfect Reagent was added to another 250 μL of RPMI-1640. The mixture was incubated at room temperature for 5 min, then slowly mixed and incubated at room temperature for 20 min. The mixture was then directly added to the cell culture wells for incubation. A positive control and a negative control were included. The positive control consisted of HEK-293T cells transfected with the positive control plasmid pIGKV-RBD_H, and the negative control consisted of HEK-293T cells without any plasmid. The culture medium was changed 6 h after transfection, and cell status was observed. Staining and flow cytometry analysis were performed 48 h later.
[0057] 4.2 Cell staining and flow cytometry detection Main steps: HEK-293T cells transiently transfected into 6-well plates were incubated for 48 hours after changing the complete culture medium. The culture medium was then discarded, and the cells were washed twice with 1×PBS. The cells were then digested with 150 μL of 0.5 μmol / L trypsin solution. After 1 min, the digestion solution was aspirated, and 1 mL of culture medium containing 2% FBS was added. The cells were then transferred to 1.5 mL EP tubes and centrifuged at 800 rpm for 5 min. The supernatant was aspirated, and the cells were resuspended in 500 μL of culture medium. 2 μL of control fluorescently labeled RBD antigen (prepared and stored in our laboratory) or MARV GP4 (see Example 2) was added. The cells were incubated on ice in the dark for 30 min, then centrifuged. After removing the supernatant, the cells were washed twice with serum-free culture medium and resuspended in 50 μL of serum-free culture medium. The cells were immediately analyzed by flow cytometry to observe the cell labeling status.
[0058] 4.3 Gene amplification and identification of sorted positive cells Main steps: Fluorescently labeled MARV GP4 / RBD antigen-positive cells were cultured in vitro for 48 h, and then total RNA was extracted using the one-step guanidine isothiocyanate method. A small amount of total RNA was quantified by UV spectrophotometry and detected by formaldehyde denaturing agarose gel electrophoresis; subsequently, Oligo(dT) was used for analysis. 15 (Promega) uses random primers for reverse transcription to synthesize the first strand of cDNA.
[0059] The cDNA reverse transcription conditions were as follows: 1 μg of total RNA (2 μL) and 0.5 μg of random primer Oligo(dT) were added sequentially to a 20 μL reaction system. 15 1 μL of MgCl2 (25 mM), 4 μL of 5×dNTPs, 2 μL of 10× buffer, 0.5 μL of RNase inhibitor (Invitrogen), 15 U of reverse transcriptase AMV (0.75 μL, Invitrogen), and water to a final volume of 20 μL. Mix well, incubate at 42°C for 1 h, boil for 3 min, and store the reaction product at -20°C for later use.
[0060] Using the reverse transcribed cDNA product as a template for further antibody gene amplification, the light and heavy chain variable region genes (VH, VL) of the antibody were amplified using designed universal variable region amplification primer sequences. The selected amplification primers included: Primer VH-5: 5'AGGCTGCCACCATGGAGTGG3'; Primer VH-3: 5'CCAGAGCCACCTCCGCCTG3'; Primer VL-5: 5'CAGGCGGAGGTGGCTCTGG3'; Primer VL-3: 5'GACTGACGGTCCCCCCAGG3' (VH-5 / VH-3 were used for heavy chain VH identification; VL-5 / VL-3 were used for heavy chain VL identification) for gene amplification. PCR amplification was performed under standard conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise specified, the PCR reaction consisted of the following experimental system: 2.5 μL template cDNA, 2 μL dNTPs (0.4 mM each, TaKaRa), 5 μL 10×Buffer, 1.25 U Ex Taq DNA polymerase (TaKaRa), i.e., 1.5 μL, 5 μL each of 5' and 3' primers (approximately 30 pmol), water to a final volume of 50 μL, mixed thoroughly, briefly centrifuged, and then 1-2 drops of liquid paraffin were added. The reaction was then placed on a PCR instrument. The reaction conditions were: 94℃ for 1 min, 54℃ for 1 min, 72℃ for 1 min, for 35 cycles, with a final extension at 72℃ for 10 min.
[0061] After amplification, the PCR product was subjected to low-melting-point agarose gel electrophoresis (1.5%), and the target fragment was separated by gel excision. The fragment was then purified using a gel purification kit (Promega), and cloned into a T-vector. This fragment was then sent to a sequencing company for analysis of the antibody gene in positive cells, identifying the candidate antibody variable region gene (anti-scFv-MARV GP4 gene). Subsequently, the online international immunogenetic database IMGT was used for comparison analysis. Nucleotide sequences of the variable region (V-DOMAIN) of the antibody heavy chain (VH) and light chain (VL) were extracted from sequencing data (such as NGS or Sanger sequencing). The IMGT / V-QUEST tool was used to analyze whether the screened sequences exhibited characteristics of an antibody gene.
[0062] Implementation results: HEK293T cells were transiently transfected with a library expressing membrane-type scFv-Fc antibodies. High-expressing candidate cells were precisely sorted using antigen-binding fluorescent signals (e.g., MARV GP4). Flow cytometry sorting (FACS) was used to screen for fluorescently labeled MARVGP4 / RBD antigen-specific positive cells, yielding approximately 75 positive cell clones. Further culture and sequencing analysis of these clones yielded 21 molecules with unique sequences. Based on sequence diversity analysis, four molecules containing complete antibody light and heavy chain variable regions were selected for further analysis: Anti-MARV-GP4-A022, Anti-MARV-GP4-A023, Anti-MARV-GP4-A025, and Anti-MARV-GP4-A071, all with read lengths ≥400 bp, consistent with antibody gene characteristics. Sequencing results were compared and annotated using the IMGT / V-QUEST tool. The selected VH and VL genes both showed typical immunoglobulin structures, containing complete variable region framework regions (FR1-FR4) and three CDR regions (CDR1-CDR3). This confirmed that the VH / VL genes belong to functional variable region families (e.g., VH belongs to the IgH V-REGION subfamily, and VL belongs to the IGK / IGL V-REGION subfamily), with no significant mutations or deletions. Visual analysis using the IMGT Collier-de-Perles tool showed that the spatial conformation of the CDR regions of VH / VL matched the antigen-binding pocket.
[0063] Anti-MARV-GP4-A023 contains the heavy chain variable region gene with the sequence listed in SEQ ID NO: 1 and the light chain variable region gene with the sequence listed in SEQ ID NO: 3. Analysis shows that the human germline gene corresponding to antibody A023 originates from Homsap IGHV1-69. 10 F and Homsap IGKV1D-12 02 F, the heavy chain variable region gene has the sequence of SEQ ID NO:1, and the encoded polypeptide product has the sequence of SEQ ID NO:3; while the light chain variable region gene has the sequence of SEQ ID NO:2, and the polypeptide product encoded by this light chain variable region gene has the sequence of SEQ ID NO:4. Both chains of the antibody possess the characteristic sequences and CDR regions of the antibody. Specifically, the amino acid sequence of the heavy chain variable region contains the specific antigen complementarity-determining regions HCDR1, HCDR2, and HCDR3 with sequences of GGTFSSYA, IIIPILGIA, and ARESYYYDSSGYYYYMDV, respectively. The amino acid sequence of the light chain variable region contains the specific antigen complementarity-determining regions LCDR1, LCDR2, and LCDR3 with sequences of QDIRRW, AAS, and QQSNSFPLG, respectively.
[0064] The specific information of the VH variable region of the heavy chain of monoclonal antibody Anti-MARV-GP4-A023 is shown in Table 3 below.
[0065] Table 3
[0066] The variable region (VL) of the light chain of monoclonal antibody Anti-MARV-GP4-A023 is shown in Table 4.
[0067] Table 4
[0068] Four candidate MARV GP4-specific antibody genes were identified through fluorescently labeled cell sorting combined with sequencing analysis. These genes all possessed complete and structurally sound VH / VL variable regions, and their existence was verified as functional antibody genes by the IMGT database. These sorting and sequencing results provide a reliable foundation for subsequent human antibody modification, affinity optimization, and functional validation.
[0069] Example 5: Preparation of Recombinant Expression of Anti-MARV GP4 Human Antibody This embodiment aims to express and prepare full-length antibodies from the series of candidate antibody genes screened above (κ is selected for the light chain constant region, and IgG1 is selected for the heavy chain constant region). The expression vector containing the full-length antibody is transiently transfected into a eukaryotic expression system (such as HEK293 or CHO cells). After culturing for 7 days, the cell supernatant is collected by centrifugation or the cells are lysed. The recombinant IgG antibody is purified by protein A affinity chromatography, providing candidate protein molecules for subsequent antibody function research and application.
[0070] 5.1 Construction of recombinant antibody expression vector Main steps: Based on the series of candidate antibody variable region genes obtained in Example 4 above, including light and heavy chain variable region genes such as Anti-MARV-GP4-A022, Anti-MARV-GP4-A023, Anti-MARV-GP4-A025, and Anti-MARV-GP4-A071, Anti-MARV-GP4-A023 contains the heavy chain variable region gene with the sequence of SEQ ID NO: 1 and the light chain variable region gene with the nucleotide sequence of SEQ ID NO: 3.
[0071] The antibody gene to be expressed was synthesized in vitro and cloned into the restriction enzyme expression vector pCI-vector (preserved in our laboratory) containing the human hIgG4 / Kappa constant region according to the standard Laboratory Molecular Cloning: Handbook (New York: Cold Spring Harbor Laboratory Press, 1989). The ligation product was purified using a DNA purification kit and transformed into TOP10 E. coli, then plated on LB agar medium containing 100 μg / ml ampicillin. The obtained positive clones were cultured in LB liquid medium containing 100 μg / ml ampicillin, and plasmids were extracted and sequenced to obtain full-length eukaryotic expression vector clones containing the humanized antibody VH gene, such as B22102403H, and full-length eukaryotic expression vector clones containing the humanized antibody VL gene, such as B22102403L. All constructed vectors were sequenced by Sanger sequencing.
[0072] 5.2 Expression and purification of human antibodies Main steps: The above-mentioned recombinant vectors, such as pCI-A023H and pCI-A023L, were co-transfected into CHO cells (1.0 × 10⁻⁶ cells) using Invitrogen's Freestyle Max Reagent transfection reagent. 6 Cells / ml). Expression vectors containing the heavy chain gene (SEQ ID NO:1) and light chain variable region gene (SEQ ID NO:3) of A023 (i.e., pCI-A023H and pCI-A023L) were mixed at a 1:1 molar ratio and transfected into CHO cells in logarithmic growth phase using Freestyle Max Reagent transfection reagent. After transfection, cells were cultured at 37°C in an 8% CO2 shaker at 120 rpm for 7 days. Cell supernatant was collected by centrifugation, filtered through a 0.22 μm filter to remove impurities, and stored at 4°C for later use. The cell supernatant was loaded into a Protein A column (Cytiva), equilibrated with PBS, and eluted with 0.1 M glycine (pH 2.5). Immediately after elution, the antibody was neutralized with 1 M Tris-HCl (pH 8.0). The purified antibody was dialyzed against PBS overnight, and the concentration was determined by NanoDrop (A). 280 The purity was verified by absorbance (extinction coefficient = 1.4), SDS-PAGE, and protein concentration of the expressed and purified antibody was determined and used for further purification and ELISA activity identification.
[0073] Implementation results: In this embodiment, the variable region genes of the light and heavy chains of the aforementioned series of selected antibodies were converted into full-length antibodies, and the variable regions VH / VL were cloned into vectors containing the hIgG4 / Kappa constant region to construct expression vectors for full-length antibody IgG. CHO cells were transfected using Freestyle Max, cultured (37°C, 8% CO2, 120 rpm shaker, 7 days), and purified using protein A affinity chromatography (Cytiva protein A column).
[0074] The results showed that after transfection of human CHO cells with the constructed human IgG1 kappa antibody vectors containing the light and heavy chain variable regions of monoclonal antibody Anti-MARV-GP4-A023 for 24 h, the cell viability was greater than 95%. After transient expression in a small suspension at 10 mL culture volume for 7 days, the supernatant was centrifuged, and coprotein A was captured and purified to obtain samples of 0.39 mg to 0.98 mg. Preliminary calculations indicate that the antibody expression level reached 39–98 mg / L. SDS-PAGE showed that under non-reduced conditions, the antibody molecules maintained their native conformation due to disulfide bonds, exhibiting a characteristic band of approximately ~150 kDa. After β-mercaptoethanol disrupted the disulfide bonds, the antibody dissociated into two independent bands: a heavy chain (~50 kDa) and a light chain (~25 kDa), with no obvious background contaminants, and a purity >95%. Figure 5 The results of non-reduced and reduced SDS-PAGE indicate that protein A affinity chromatography effectively enriched the antibody, and the purified product had high purity. This means that the screening of some recombinant antibodies was successfully achieved through efficient expression and purification. The purified antibody can be further used for downstream functional studies such as ELISA activity identification.
[0075] Example 6: ELISA activity identification of recombinant human antibody with target antigen MARV GP4 This embodiment aims to determine whether the prepared full-length antibody can bind to the target antigen MARV GP4 by performing ELISA activity identification on the above four clones containing the randomly recombined full-length antibody gene (the light chain constant region is κ and the heavy chain constant region is IgG1), and to determine the binding activity and specificity of the prepared antibody to the MARV GP4 antigen.
[0076] Main steps: First, dilute MARV GP4 antigen to 2 μg / mL with carbonate buffer (pH 9.6) and coat a 96-well plate (100 μL / well) overnight at 4°C. Then discard the coating solution, add 200 μL / well of 5% skim milk powder-PBS, and block at 37°C for 2 hours. The transiently expressed and purified recombinant antibodies, namely OJC004-SY08_H_PR_A057 (P306051, sample abbreviation A057), OJC004-SY08_H_PR_A025 (P306049, sample abbreviation A025), OJC004-SY08_H_PR_A023 (P306048, sample abbreviation A023), and OJC004-SY08_H_PR_A022 (P306047, sample abbreviation A022), were serially diluted 3-fold starting from 10 μg / mL and added to each well (100 μL / well), and incubated at 37°C for 1 hour. Secondary antibody detection: HRP-labeled goat anti-human IgG antibody (1:5000 dilution) was added and incubated at 37°C for 1 hour. NC-Fc was a negative control antibody containing the human IgG κ region (MCE, HY-P99001), and PBS was a blank control. Antibody color development and detection: TMB substrate solution (100 μL / well) was added, and the reaction was carried out in the dark for 10 minutes. The reaction was terminated with 2 M H2SO4, and the absorbance (OD) at 450 nm was measured using a microplate spectrophotometer (Epoch, BioTek Instruments, Inc.). 450 And record it.
[0077] Results: This experiment used four clones (A057, A025, A023, and A022) containing full-length antibody genes (κ in the light chain constant region and IgG1 in the heavy chain constant region) as research subjects. The binding activity (concentration-dependent binding characteristics) and specificity (no binding to non-target antigens) of these clones with the target antigen MARV GP4 were identified by ELISA.
[0078] ELISA results showed that the binding activity of the four prepared full-length antibodies to the antigen MARV GP4 was antibody concentration-dependent, and the half-maximal effective concentration (EC50) was within the range of 1 / 2. 50 (The smaller this value, the stronger the affinity between the antibody and the antigen.) This can be quantified. Among them, A023 has a relatively strong affinity for MARV GP4 (0.009562 μg / mL). Figure 6 ); OD of negative controls (NC-Fc, BC groups) 450The value remained at a very low level (close to the baseline) and below 0.1, indicating no significant binding signal. This proved that there was no non-specific binding interference in the experimental system, and the detected antibody-antigen binding was a specific interaction, indicating that the recombinant antibody can bind to the MARV GP4 antigen with high affinity and specificity.
[0079] The results showed that all four randomly recombinant full-length antibodies could bind to the MARV GP4 antigen. A023 and A022 exhibited strong antigen-binding activity, while A025 and A057 showed relatively weaker binding affinity but still remained active. No non-specific binding was observed in any of the antibodies. This experiment successfully identified humanized anti-MARV GP4 antibodies with good binding activity to the target antigen, providing candidate molecules for the development of therapeutic antibodies against MARV.
[0080] Example 7: Affinity determination of recombinant human antibody with target antigen MARV GP4 This embodiment aims to determine the affinity kinetic parameters of the anti-MARV GP4 human antibody A023 to the MARV GP4 antigen (which contains the nucleotide sequence of SEQ ID NO:5 or the amino acid sequence shown in SEQ ID NO:6) using surface plasmon resonance (SPR) technology, including the binding rate constant (ka), dissociation rate constant (kd), and affinity constant (K). D This study aims to evaluate the binding properties and potential therapeutic value of antibodies. The basic principle of this experiment is that the antibody to be detected is immobilized on the surface of a sensor chip, and the antigen flows through the mobile phase. The binding and dissociation processes cause changes in the refractive index of the chip surface, which are converted into a sensor response signal (RU value), thereby allowing the calculation of kinetic parameters. In this experiment, a Protein A chip was used to capture the antibody, and kinetic curves were obtained through multi-concentration antigen titration. The ka, kd, and KD values were then calculated through fitting.
[0081] Procedure: The affinity of MARV GP4 A023 to GP4 antigen was determined using a ProteOn XPR36 (Bio-Rad, XPR36) instrument. The Protein A chip was pre-equilibrated with HBS-EP buffer and injected onto the chip at a flow rate of 10 μL / min. The antibody was diluted to 50 nM (HBS-EP buffer) and injected into channels 2, 3, and 4 of the chip at a flow rate of 10 μL / min, capturing antibody levels of approximately 100 RU. The MARV GP4 antigen was diluted to 150 nM and then serially diluted 2-fold (concentration range: 150 nM to 0.58 nM, a total of 8 concentrations). The flow rate was set to 30 μL / min, antigen injection time to 180 seconds, dissociation time to 300 seconds, and temperature to 25°C. Each concentration was measured twice, and background subtraction was performed using a reference channel (channel 1). Samples containing MARV GP4 antigen were injected into different horizontal channels. The sample binding time was 60 s, and the dissociation time was 900 s. A kinetic-Langmuir model was used to model the data, and the values of ka, kd, and KD were calculated. Reliability standard: Chi² value ≤ 10%Rmax.
[0082] Results: The SPR sensor plot showed that the binding of the anti-MARV GP4 antibody to the MARV GP4 antigen was concentration-dependent (Figure 7), with a rapid increase in the binding phase and a slow increase in the dissociation phase, indicating high-affinity binding. The preliminary fitting results are as follows (based on curve trends): OJC004-A057: ka ≈ 1.50 × 10 5 M - ¹s - ¹, kd shows no signal (N / A), KD has no result.
[0083] OJC004-A023: ka ≈ 2.41 × 10 5 M - ¹s - ¹, kd < 3.46 × 10 -5 s - ¹, KD≈1.44 ×10 -10 M (requires longer dissociation time for verification), all measured Chi² values were <10% Rmax, indicating that the test data are reliable.
[0084] In this embodiment, the kinetic parameters of the anti-MARV GP4 human antibody were successfully determined using SPR technology. The OJC004-A023 antibody exhibited the highest affinity (KD < 1 nM) and extremely slow dissociation, making it potentially suitable as a therapeutic candidate antibody. Additionally, OJC004-A057 possessed nanomolar affinity, meeting the criteria for a high-affinity antibody. Future work requires further refinement of the KD value of OJC004-A023 by extending the dissociation time (e.g., to 600 seconds) and validating its neutralizing activity at the cellular level, as detailed in Table 5. These results provide crucial kinetic data for antibody optimization and preclinical studies.
[0085] Table 5 SPR assay for the affinity of purified antibodies to antigens: statistical analysis
[0086] Note: N / A represents no dissociation within 300s (Kd<10 E-06), and Ka value is provided for reference only.
[0087] Instruction manual: amino acid and nucleotide sequence list <210> 1 <211> 375 <212> PRT <213> Homo <220> Nucleotide sequence of the A023 heavy chain variable region (VH) of the anti-MARV GP4 human antibody. <400> 1 caggtccagc ttgtgcaatc tggggctgag gtgaagaagc ctgggtcctcagtgaaggtc60tcctgcaagg cttctggagg caccttcagc agctatgcta tcagctgggt gcgacaggcc120cctggacaag ggcttgagtg gatgggggg atcatcccta tccttggtatagcaaactac180gcacagaagt tccagggcag agtcacgatt accgcggaca aatccacgagcacagcctac240atggagctga gcagcctgag atctgaggac acggccgtgt attactgtgcgagggagtcg 300tattattatg acagtagtgg gtattactac tacatggacg tctggggcagagggacaatg360gtcaccgtct catca375 <210> 2 <211> 321 <212> DNA <213> Homo <220> Nucleotide sequence of the light chain variable region (VL) of anti-MARV GP4 human antibody A023 <400> 2 aacatccaga tgacccagtc tccatcttcc gtgtctgcat ctgtaggagatagggtcacc60atcacttgtc gggcgagtca ggatattagg aggtggttag cctggtatcagcagaaatca120gggaaagccc ctaagctcct gatctatgct gcatccgatt tacaaagtggggtcccatca180aggttcagcg gcagtggatc tgggacagac ttcactctca ccatcagcagcctgcagcct240gaagattttg caacttatta ttgtcaacag agtaacagtt tccccctaggtttcggcgga300gggaccaagg tggagatcaa a321 <210> 3 <211> 125 <212> PRT <213> Homo <220> Amino acid sequence of the heavy chain variable region (VH) of anti-MARV GP4 human antibody A023 <400> 3 QVQLVQSGAE VKKPGSSVKV SCKASGGTFS SYAISWVRQA PGQGLEWMGG 50 IIPILGIANY AQKFQGRVTI TADKSTSTAY MELSSLRSED TAVYYCARES 100 YYYDSSGYYY YMDVWGRGTM VTVSS125 <210> 4 <211> 107 <212> PRT <213> Homo <220> Amino acid sequence of the light chain variable region (VL) of anti-MARV GP4 human antibody A023 <400> 4 NIQMTQSPSS VSASVGDRVT ITCRASQDIR RWLAWYQQKS GKAPKLLIYA 50 ASDLQSGVPS RFSGSGSGTD FTLTISSLQP EDFATYYCQQ SNSFPLGFGG100 GTKVEIK107 <210> 5 <211> 612 <212> PRT <213> Virus (Artificial) <220> Marburg virus (MARV) GP4 nucleotide sequence - His tag <400> 5 atgtacagaa tgcagctcct gtcctgcatc gcgctcagcc tggccttggtcacaaactca60gactacaagg atgacgacga taagcttccg atccttgaaa ttgcatccaataatcagcct120cagaatgtgg attcagtgtg cagcggcact ttgcagaaga cagaggacgtgcatctgatg180ggttttaccc tgagcggcca aaaagttgcc gactcccccc ttgaggcttccaaaagatgg240gcctttcgga caggcgtgcc cccgaagaac gtggagtata ccgaaggtgaagaggccaag300acctgctata acatctctgt taccgaccct tccgggaaaa gcctgctcctggacccacct360acaaacatcc gcgactaccc caaatgcaag accatccatc acattcaaggacaaaaccca420cacgcacagg gcatcgcatt gcacctgtgg ggtgcattct ttctgtacgacaggattgcg480agcaccacaa tgtacagagg aaaagtgttc actgagggga atatcgccgccatgatcgtg540aacaaaacgg tccacaagat gatctttagt cgccagggcc aggggtaccgacatcatcat600caccaccacc at612 <210>6 <211>204 <212>PRT <213>Virus (Artificial) <220>Marburg virus MARV GP4 amino acid sequence - His tag <400>6 MYRMQLLSCI ALSLALVTNS DYKDDDDKLP ILEIASNNQP QNVDSVCSGT 50 LQKTEDVHLM GFTLSGQKVA DSPLEASKRW AFRTGVPPKN VEYTEGEEAK 百 It should be noted that there seems to be an error in the original text where "百" appears in the translation of the 100th amino acid description. It should probably be a correct amino acid code or description. You may want to double-check the original text for accuracy.TCYNISVTDP SGKSLLLDP TNIRDYPKCK TIHHIQGQNP HAQGIALHLW150 GAFFLYDRIA STTMYRGKVF TEGNIAAMIVNKTVHKMIFS RQGQGYRHHH 200 HHHH204
Claims
1. A human antibody against Marburg virus, characterized in that, The antibody specifically binds to the MARV GP4 target molecule, the nucleotide sequence of which is shown in SEQ ID NO:5, or the amino acid sequence of which is shown in SEQ ID NO:
6.
2. The human antibody against Marburg virus according to claim 1, characterized in that, The antigen complementarity-determining regions HCDR1, HCDR2, and HCDR3 of the heavy chain variable region VH of the antibody are GGTFSSYA, IIIPILGIA, and ARESYYYDSSGYYYYMDV, respectively. The antigen complementarity-determining regions LCDR1, LCDR2, and LCDR3 sequences of the light chain variable region VL are QDIRRW, AAS, and QQSNSFPLG, respectively.
3. The human antibody against Marburg virus according to claim 1, characterized in that, The antibody specifically binds to the MARV GP4 target molecule, and the nucleotide sequence of the antibody heavy chain variable region (VH) is shown in SEQ ID NO:1, or the amino acid sequence of the heavy chain variable region (VH) is shown in SEQ ID NO:3; The nucleotide sequence of the light chain variable region (VL) is shown in SEQ ID NO:2, or the amino acid sequence of the light chain variable region (VL) is shown in SEQ ID NO:
4.
4. The human antibody against Marburg virus according to claim 2 or 3, characterized in that, The light chain (VL) constant region of the described full-length anti-MARVGP4 human antibody is κ, and the heavy chain (VH) constant region is IgG1.
5. The use of the human antibody against Marburg virus according to any one of claims 1-3 in the preparation of an anti-Marburg virus drug.
6. The application according to claim 5, characterized in that, The drugs include peptide drugs, antibody-drug conjugates, or gene therapy preparations.
7. The use of the human antibody against Marburg virus as described in any one of claims 1-3 for the preparation of a diagnostic kit for Marburg virus.