Monoclonal antibody 7a12 for identifying genotype 2 classical swine fever and preparation and application method thereof

Abstract

This invention relates to the field of biotechnology, and aims to provide a monoclonal antibody 7A12 for identifying genotype 2 classical swine fever, along with its preparation and application methods. This monoclonal antibody contains an Ig domain V of the antibody heavy chain. H CDR1, V H CDR2 and V H CDR3, and the Ig domain V of the antibody light chain L CDR1, V L CDR2 and V L CDR3; wherein, the V H CDR1, V H CDR2 and V H The amino acid sequences of CDR3 are shown in SEQ ID NO:1-3, respectively; the V L CDR1, V L CDR2 and V L The amino acid sequences of CDR3 are shown in SEQ ID NO:4-6. The antibody provided by this invention has advantages such as high titer, strong specificity, and high affinity; it also has high sensitivity and specificity, and shows no cross-reactivity with type 1 classical swine fever vaccine strains. Serologically, it can differentiate and diagnose infection and vaccine immunization with genotype 2 classical swine fever wild-type strains. Furthermore, it can be used to develop a blocking ELISA kit for identifying genotype 2 classical swine fever, effectively diagnosing and purifying genotype 2 classical swine fever virus.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a monoclonal antibody 7A12 for identifying genotype 2 classical swine fever and its preparation and application methods. Background Technology

[0002] Classical swine fever (CSF) is a highly contagious and fatal infectious disease of pigs caused by the classical swine fever virus (CSFV). Clinically, it is characterized by rapid onset, persistent high fever, widespread petechial hemorrhages, and splenic infarction. Affected pigs may experience fever, anorexia, diarrhea, and death, and may also exhibit neurological symptoms. Sows may abort or give birth to stillborn piglets. Under natural conditions, pigs of all ages and breeds can be infected. It is widely distributed globally, causing enormous economic losses to the global pig farming industry.

[0003] CSFV belongs to the genus *Pestivirus* of the family Flaviviridae. Other viruses in the same genus as CSFV include bovine viral diarrhea virus type 1 (BVDV-1), bovine viral diarrhea virus type 2 (BVDV-2), and sheep borderline virus (BDV). CSFV is an enveloped, single-stranded, positive-sense RNA virus with a genome size of approximately 12.3 kb. It contains a large open reading frame (ORF) encoding a polyprotein of 3898 amino acids. This polyprotein is cleaved by viral and host cell proteases into 12 mature viral proteins: four structural proteins and eight non-structural proteins. The structural proteins include nucleocapsid protein C and three envelope glycoproteins, Erns, E1, and E2. The non-structural proteins include Npro, p7, NS2, NS3, NS4A, NS4B, NS5A, and NS5B. Each mature protein plays a different function in the life cycle and infection process of classical swine fever virus.

[0004] Classical swine fever (CSF) comprises 3 genotypes and 11 genotypes. Domestic researchers have successfully controlled CSF outbreaks through the widespread use of a live attenuated CSF vaccine (strain C). However, under pressure from the C strain vaccine, subgenotype 1.1 has gradually disappeared since the early 21st century. Currently, the prevalent CSFV strains in major pig-producing areas of China are mainly subgenotype 2.1, such as QZ14, HZ08, HuN23, and HLJ1. Although strain C is recognized as a safe and effective CSF vaccine, it is not effective for the differential diagnosis of genotype 2 CSF, thus hindering the eventual eradication of CSF. Therefore, establishing an effective rapid identification technique for antibodies against circulating genotype 2 CSFV strains and antibodies against C strain immunity is a crucial issue that urgently needs to be addressed, which will further promote the eradication of CSF virus.

[0005] Since the establishment and preparation of classical swine fever (CSF) antibodies (MAb) by immunizing mice with cell-cultured classical swine fever virus in 1986, MAb has been widely used in the diagnosis of classical swine fever. Based on this technology, many anti-CSFV monoclonal antibodies and their recognition epitopes have been discovered. However, no monoclonal antibodies that can distinguish between the prevalent CSFV genotype 2 strain and the vaccine C strain have been reported.

[0006] Therefore, this application proposes a novel monoclonal antibody to solve the above-mentioned technical problems. Summary of the Invention

[0007] The technical problem to be solved by the present invention is to overcome the shortcomings of the prior art and provide a monoclonal antibody 7A12 for identifying genotype 2 classical swine fever and a method for its preparation and application.

[0008] To solve the technical problem, the solution of the present invention is:

[0009] A monoclonal antibody 7A12 is provided for identifying genotype 2 classical swine fever, said monoclonal antibody comprising the Ig domain V of the antibody heavy chain. H CDR1, V H CDR2 and V H CDR3, and the Ig domain V of the antibody light chain L CDR1, V L CDR2 and V L CDR3; wherein, the V H CDR1, V H CDR2 and V H The amino acid sequences of CDR3 are shown in SEQ ID NO:1-3, respectively; the V L CDR1, V L CDR2 and V L The amino acid sequences of CDR3 are shown in SEQ ID NO:4 to 6.

[0010] As a preferred embodiment of the present invention, the monoclonal antibody is a full-length antibody, a Fab antibody, or an F(ab')2 antibody.

[0011] As a preferred embodiment of the present invention, the amino acid sequence of the light chain variable region of the monoclonal antibody is shown in SEQ ID NO.7, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.8.

[0012] The present invention also provides a gene encoding the aforementioned monoclonal antibody, wherein the gene sequence encoding the light chain variable region is shown in SEQ ID NO.9, and the gene sequence encoding the heavy chain variable region is shown in SEQ ID NO.10.

[0013] This invention further provides a method for preparing the aforementioned monoclonal antibody, comprising the following steps:

[0014] (1) Based on the genotype 2 CSFV E2HZ protein gene sequence shown in SEQ ID NO: 11, a recombinant plasmid with the genotype 2 CSFV E2HZ protein gene sequence was constructed using the specific primers shown in SEQ ID NO. 12 and SEQ ID NO. 13;

[0015] (2) The recombinant CSFV-E2HZ protein was further expressed and purified using an insect cell expression system;

[0016] (3) Animal immunization with recombinant CSFV-E2HZ protein;

[0017] (4) Using hybridoma monoclonal antibody technology, positive hybridoma cells were screened and monoclonalized to identify monoclonal antibodies for identifying genotype 2 classical swine fever.

[0018] The present invention also provides a method for applying any of the aforementioned monoclonal antibodies, which is to prepare a kit for identifying genotype 2 classical swine fever using the monoclonal antibody.

[0019] The present invention also provides a kit for identifying genotype 2 classical swine fever, the kit comprising any of the aforementioned monoclonal antibodies.

[0020] As a preferred embodiment of the present invention, the kit is a blocking ELISA kit, and the detection method when using the kit is serological detection.

[0021] Compared with the prior art, the technical advantages of the present invention are:

[0022] 1. The monoclonal antibody provided by this invention is the IgG1 subtype, which has the advantages of high titer, strong specificity, and high affinity.

[0023] 2. The monoclonal antibody provided by this invention has high sensitivity and specificity, and has no cross-reaction with the type 1 classical swine fever vaccine strain. It can be used serologically to differentiate and diagnose infection with the type 2 wild-type classical swine fever virus strain and vaccine immunization.

[0024] 3. The monoclonal antibody provided by this invention can be further used to establish a blocking ELISA kit for identifying genotype 2 classical swine fever, which can effectively diagnose and purify genotype 2 classical swine fever virus. Attached Figure Description

[0025] Figure 1 This is an indirect immunofluorescence and SDS-PAGE analysis of the eukaryotically expressed and purified CSFV E2HZ protein genotype 2 from Example 1.

[0026] Figure 2 The reactivity of mouse serum immunized with CSFV E2HZ protein in Example 2 with Bac-CSFV E2HZ is shown.

[0027] Figure 3 The reactivity of the CSFV E2HZ 7A12 monoclonal antibody with different CSFV strains E2 in Example 2 is shown.

[0028] Figure 4 This is the subtype classification of the CSFV E2HZ 7A12 monoclonal antibody in Example 2.

[0029] Figure 5 This study describes the identification and conservation analysis of the antigenic epitopes recognized by the CSFV E2HZ 7A12 monoclonal antibody in Example 3.

[0030] Figure 6 To determine the optimal antigen coating concentration, monoclonal antibody dilution ratio, and serum dilution ratio for the genotype 2 classical swine fever identification and blocking ELISA system in Example 4.

[0031] Figure 7 This is a preliminary establishment of the ELISA system for identifying and blocking genotype 2 classical swine fever in Example 4.

[0032] Figure 8 This is for the specific detection of the ELISA system for identifying and blocking genotype 2 classical swine fever in Example 4. Detailed Implementation

[0033] This invention obtains high-purity and high-activity CSFV E2HZ protein through a eukaryotic expression system. After immunizing mice, a monoclonal antibody 7A12 that can identify genotype 2 classical swine fever virus infection is obtained, and a preliminary classical swine fever identification and blocking ELISA system is established.

[0034] The implementation of the present invention will be described in detail below with reference to specific embodiments.

[0035] Example 1: Preparation of CSFV E2HZ protein of genotype 2

[0036] Implementation method:

[0037] (1) Construction of eukaryotic expression vector for genotype 2 CSFV E2HZ protein: The gene sequence of genotype 2 CSFV E2HZ protein is shown in SEQ ID NO: 11. Using specific primers (F: CTGCTGGTGACCGGGGCACAAGGGATGCGGCTGTCCTGTAAGGAAGACTACAG, sequence SEQ ID NO: 12; R: TCTAGTACTTCTCGACAAGCTTTTAGTGATGGTGATGGTGATGGGTCACGTCCA GATCAAACCAGTAT, sequence SEQ ID NO: 13), PCR was performed using the genomic cDNA of genotype 2 CSFV HZ08 strain as a template. The target gene was inserted into pFastBac with a secretory signal peptide (SP) using homologous recombination. TM On the HTB vector, the recombinant plasmid pFastBac was constructed. TM HTB-SP-E2HZ. The pFastBac sequence was verified to be correct. TM The HTB-SP-E2HZ shuttle plasmid was transformed into DH10Bac competent cells, and the cells were recovered at 37°C for 5 h. The cells were then plated on triple antibody plates containing 100 μL X-gal and 5 μL IPTG (kanamycin, tetracycline, and gentamicin, KTG) and incubated overnight at 37°C. Blue-white screening was performed, and white colonies were selected. The cells were then incubated at 37°C with shaking for 14 h. The bacterial culture was then streaked again to isolate single white colonies and preserved.

[0038] (2) Transfection and propagation of recombinant CSFV-E2HZ baculovirus: Baculovirus particles of recombinant Bac-CSFVE2HZ were extracted using a kit. 2 μg of Bacmid-E2HZ was added to 250 μL of Sf-900 without antibiotics. TM In SFM medium III, mix thoroughly by pipetting and label as solution A; separately, add 8 μL of Cellfectin II Reagent transfection reagent to another 250 μL of antibiotic-free Sf-900™ III SFM medium, vortex to mix, and label as solution B; mix solutions A and B and incubate at room temperature for 15-20 min. Add the mixture dropwise to the washed Sf9 cells (after discarding the culture medium), and then add 1.5 mL of antibiotic-free Sf-900™ Reagent. TM III. Incubate in SFM medium at 27.5℃ for 5 hours. Aspirate the transfection mixture and add 5 mL of Sf-900 containing 1% Antibiotic-Antimycotic (100x).TM III. SFM medium. Observe cytopathic effects daily. After approximately 5 days, SF9 cells exhibited extensive CPE (cytopathic effect), with cells becoming larger, rounder, and detaching over large areas. Harvested cells were frozen and thawed, and the supernatant was collected by centrifugation to obtain the P1 generation virus stock solution. This solution was aliquoted into 1.5 mL EP tubes (500 μL per tube) and stored at -80°C. 500 μL of the P1 generation virus stock solution was added to SF9 cells at 90% density and incubated at 27°C. Observe daily for cytopathic effects. After 72-96 days, when extensive cytopathic effects appeared, harvest the cells, freeze and thaw them, and centrifuge to obtain the P2 generation virus stock solution. This solution was aliquoted into 1.5 mL EP tubes (500 μL per tube) and stored at -80°C. The P3 generation virus stock solution was amplified using the same method.

[0039] (3) IFA identification of recombinant CSFV-E2HZ protein: When the Sf9 cell density in the 96-well plate reaches 70-80%, 10 μL of P1 generation virus solution is inoculated into each well and cultured in an incubator at 27.5℃. After observing cytopathic effects, IFA is used to identify whether Sf9 cells express recombinant type 2 CSFV E2HZ protein. The IFA procedure is as follows: Discard the cell culture medium, wash the cells once with PBS and aspirate dry; add 100 μL of 80% acetone pre-cooled at -20℃ to each well and fix at -20℃ for more than 30 min; discard the cold acetone, wash twice with PBS and aspirate dry; use mouse anti-6×His monoclonal antibody (1:1000 dilution) and swine fever positive serum (1:1000 dilution) as primary antibodies and incubate at 37℃ for 1 h; discard the primary antibody, wash twice with PBS and aspirate dry; add 50 μL of FITC-labeled goat anti-mouse IgG diluted 1:2000 to each well and incubate at 37℃ in the dark for 1 h. Discard the secondary antibody, observe the fluorescence under an inverted fluorescence microscope, and take photos for storage.

[0040] (4) Expression of recombinant CSFV-E2HZ protein: Sf9 cells cultured in T75 cell culture flasks were transfected into a culture medium containing 100 mL of Sf-900 protein. TM Cells were cultured in suspension in shake flasks containing SFM medium at 27.5°C. Cell density was monitored every 24 hours, and cultured until the cell density reached 2.0 × 10⁻⁶ cells / mL. 6 When the recombinant baculovirus titer was 1, the P3 generation recombinant baculovirus was inoculated into Sf9 cells in suspension culture at a MOI of 1. The cells were then cultured at 27.5°C with shaking at 140 rpm for 96 h and harvested. The cells were centrifuged at 4000 rpm for 5 min to obtain the supernatant and cell pellet. The target protein was in the supernatant.

[0041] (5) Purification of recombinant CSFV-E2HZ protein: Add 1.5 mL of nickel column gel particles to the empty purification column, and equilibrate the nickel column with 3 column volumes of 50 mM PBS to remove ethanol; add the equilibrated nickel column gel particles to the supernatant containing the target protein, and bind overnight at 4°C on a test tube inverted mixer; add the nickel-bound protein sample to the empty purification column, open the speed control valve to allow the liquid to flow out, and collect the runoff; wash the impurities with 30 mL of 50 mM PBS containing 10 mM imidazole and 20 mM imidazole respectively, and collect the washing solution; elute the target protein with 5 mL of 50 mM PBS containing 500 mM imidazole, and collect the eluent.

[0042] (6) SDS-PAGE analysis: Prepare SDS-PAGE gels by adding 10 μL of 5× Loading Buffer to 40 μL of flow buffer, 10 mM imidazole washing buffer, 20 mM imidazole washing buffer, and 500 mM imidazole elution buffer respectively, and heating in a boiling water bath for 10 min; assemble the electrophoresis tank, fill it with electrophoresis buffer, load the sample, and perform electrophoresis according to the procedure of 80 V for 30 min and then 120 V for 90 min; after electrophoresis, place the gel in Coomassie brilliant blue staining solution and shake on a shaker at 37 ℃ for 2 h for staining, and then place it in destaining solution for destaining. Change the destaining solution every 1 h. After the bands are clearly visible, place the gel on a gel imaging system to take pictures and observe the results.

[0043] Experimental results:

[0044] PCR amplification yielded a 993bp fragment of the CSFV E2HZ gene of genotype 2, which was then inserted into pFastBac containing the secretory signal peptide (SP) via homologous recombination. TM On the HTB vector, the recombinant plasmid pFastBac was constructed. TM HTB-SP-E2HZ. This shuttle plasmid was introduced into DH10Bac competent cells, and after blue-white screening and PCR sequencing, recombinant E. coli DH10Bac-CSFV E2HZ was obtained. Baculoviruses were extracted and transfected into SF9 cells, successfully obtaining P1, P2, and P3 passages. Figure 1 As shown in Figure A, CSFV E2HZ was successfully expressed in SF9 cells by IFA analysis. Further, CSFV E2HZ protein was expressed and purified in large quantities in shake flasks, yielding a relatively pure CSFV E2HZ protein with a size of approximately 50 kDa and a protein concentration of 0.34 mg / mL. The SDS-PAGE Coomassie Brilliant Blue staining results of CSFV E2HZ protein are shown in Figure A. Figure 1 -B. The obtained genotype 2 CSFV E2HZ protein can be used for subsequent monoclonal antibody preparation.

[0045] Example 2: Screening of monoclonal antibodies for identifying genotype 2 CSFV

[0046] Experimental methods:

[0047] (1) Animal Immunization: Purified type 2 CSFV E2HZ protein was emulsified with an equal volume of 206VG adjuvant and administered subcutaneously at multiple points on the neck and back of mice at a dose of 50-100 μg / mouse. Second and third immunizations were performed in the same manner 14 and 28 days after the first immunization. Blood was collected from the orbital vein of mice 35 days post-immunization. The separated serum was diluted 1:500 as the primary antibody, and FITC-labeled goat anti-mouse IgG diluted 1:2000 was used as the fluorescent secondary antibody. IFA was used to detect specific antibodies against type 2 CSFV E2HZ protein in mouse serum. 42 days after immunization, one mouse was intraperitoneally injected with 50 μg of type 2 CSFV E2HZ protein for a shock immunization. Three days later, mouse spleen cells were prepared for fusion.

[0048] (2) Cell Fusion: Mice that underwent the above-mentioned immunization were euthanized by enucleation of the eyeballs, followed by cervical dislocation. Positive serum and spleens were then separated. The spleen was placed in one well of a six-well plate, washed, and all surrounding tissues, fascia, and fat were removed. The washed spleen was placed on a copper mesh. The spleen was crushed using a sterile test tube until it was completely crushed, and then filtered through the copper mesh. The filtered cells were transferred to centrifuge tubes and centrifuged at 1200 rpm for 10 min at 28°C. Four 75 cm... 2Resuspend the SP2 / 0 cells in the square flasks in 1640 medium, transfer them to centrifuge flasks, and centrifuge at 1200 rpm, 28°C for 10 min. Resuspend the cells obtained in the above two steps in medium, combine them into one flask, and centrifuge at 1200 rpm, 28°C for 10 min. Resuspend again in fresh medium, centrifuge once more, and discard the supernatant. Gently tap the centrifuge tubes on a paper towel to mix the two cell types until a thin paste is formed. Suspend centrifuge tubes in a sterile water bath at 37°C. Take 1 mL of 50% PEG1450 preheated at 37°C and add it dropwise near the bottom of the tube over 1 minute, shaking constantly to thoroughly mix the cells. Let stand for 30 seconds. Terminate confluence with serial dilution: add different volumes of RPMI 1640 preheated at 37°C (1 mL, 2 mL, 3 mL, 4 mL, 5 mL, and 6 mL respectively) in steps, adding each volume over 1 minute, shaking constantly, and letting stand for 30 seconds between each addition. Centrifuge at 1200 rpm for 5 minutes at room temperature, discard the supernatant, and resuspend the cell pellet in 150 mL of HAT selection medium (containing RPMI 1640, 20% fetal bovine serum, 1% Antibiotic-Antimycotic, and 1% HAT). Spread the pellet evenly onto 10 96-well cell culture plates. After 3-4 days, the medium was replaced in half with HT selection medium (containing RPMI 1640, 20% fetal bovine serum, 1% Antibiotic-Antimycotic and 1% HT), and cultured for another 3-4 days.

[0049] (3) Screening of monoclonal hybridoma cell lines for differential diagnosis of classical swine fever: When the hybridoma cells after successful fusion have divided and aggregated to about 1 / 3 of the well bottom area (8-10 days), the hybridoma supernatant is collected for IFA screening. When the PK-15 cell density in the 96-well plate reaches 50-60%, 100 TCID⁻¹ is inoculated. 50 CSFV HZ08 strain and vaccine strain C were cultured in each well at 37°C for 48 h. The culture supernatant was discarded, and the cells were washed once with PBS and aspirated dry. 100 μL of pre-chilled 80% acetone (at -20°C) was added to each well, and the cells were fixed at -20°C for at least 30 min. The cold acetone was discarded, and the cells were washed twice with PBS and aspirated dry. 50 μL of hybridoma supernatant was used as the primary antibody for CSFV HZ08 strain and strain C, respectively, and incubated at 37°C for 1 h. The primary antibody was discarded, and the cells were washed twice with PBS and aspirated dry. 50 μL of FITC-labeled goat anti-mouse IgG diluted 1:2000 was added to each well, and the cells were incubated at 37°C in the dark for 1 h. The secondary antibody was discarded, and the reactivity of the antibodies secreted by the hybridoma cells in each well with CSFV HZ08 strain and strain C was observed under an inverted fluorescence microscope. Hybridoma cells with discriminative ability (specifically recognizing strain HZ08 but not strain C) were screened, expanded, and monocloned.

[0050] (4) Western blot detection of the reactivity of 7A12 monoclonal antibody with different CSFV strains E2: CSFV E2HZ and E2C protein samples were loaded for SDS-PAGE. PVDF membranes of similar size to the protein gel were cut out for electrophoresis. The PVDF membranes were activated by soaking in methanol for 30 seconds and then transferred to wet transfer buffer for several minutes. Filter paper and sponges were also placed in the wet transfer buffer at the same time. The membranes were layered in the following order: (-) thick sponge-thin filter paper-gel-PVDF membrane-thin filter paper-thick sponge (+), and air bubbles were removed. The membranes were transferred at a constant current of 200mA for 40 minutes. Blocking: The transferred PVDF membranes were placed in TBST containing 5% skim milk powder and blocked on a shaker at 37°C for 1 hour. Washing: The skim milk was discarded, and the PVDF membranes were washed three times with TBST for 5 minutes each time. Primary antibody incubation: 7A12 monoclonal antibody (1:1000 dilution), classical swine fever positive serum (1:1000 dilution, positive control), incubated overnight at 4°C on a shaker. Washing: Discard the primary antibody, wash the PVDF membrane three times with TBST for 5 min each time. Secondary antibody incubation: Add HRP-labeled goat anti-mouse IgG secondary antibody (1:5000 dilution), incubate at 37°C on a shaker for 1 h. Washing: Discard the secondary antibody, wash the PVDF membrane three times with TBST for 5 min each time. Colorimetric development: Add FDbio-Pico ECL for color development and photograph.

[0051] (5) IFA detection of the reactivity of 7A12 monoclonal antibody with different CSFV strains E2: PK-15 cells were seeded into 96-well cell culture plates one day in advance, and wells were set up for CSFV HZ08 strain, CSFV C strain, and normal cells, respectively. The amount of HZ08 and C strains was 100 TCID. 50 / well. After 48 hours, discard the cell culture supernatant, wash twice with PBS, add 100 μL of pre-cooled 80% acetone at -20℃ to each well, and fix at -20℃ for at least 30 minutes; wash twice with PBS, add the monoclonal antibody 7A12 to be tested (1:1000 dilution), and set up a positive control (swine fever positive serum 1:1000 dilution) and a negative control (1640 medium), and incubate at 37℃ for 1 hour; wash twice with PBS, use FITC-labeled goat anti-mouse IgG (1:2000 dilution) as the secondary antibody, and incubate at 37℃ for 1 hour; discard the secondary antibody, observe the fluorescence under an inverted fluorescence microscope and take pictures for storage.

[0052] (6) Monoclonal Antibody Subtype Determination: The monoclonal antibody 7A12 obtained above was identified according to the instructions of the Proteintech Antibody Subtype Identification Kit. The principle of antibody subtype identification is to use enzyme-linked immunosorbent assay (ELISA) to determine the binding of the test antibody to different subtype-specific antibodies (provided in the identification kit), identify the antibodies that specifically bind to the test antibody, and determine the subtype of the test antibody based on the specificity of the binding antibody. Identification Method: According to the kit instructions, the subtype of the monoclonal antibody was determined by detecting the absorbance using an ELISA reader.

[0053] Experimental results:

[0054] After multiple immunizations of mice with recombinant CSFV E2HZ type 2 protein, all three mice produced specific antibodies against CSFV E2HZ type 2 protein (see attached results). Figure 2 After fusing mouse spleen cells with high serum titers with myeloma cells, a high-affinity CSFV E2-specific monoclonal antibody, named 7A12, was successfully obtained through multiple rounds of IFA differential diagnosis and screening. Western blot results showed that this monoclonal antibody specifically recognizes genotype 2 CSFV E2 protein and does not react with genotype 1 C strain E2 protein (see attached results). Figure 3 -A). IFA results further indicate that this monoclonal antibody specifically recognizes genotype 2 CSFV strains and does not react with genotype 1 C strains (see appendix for results). Figure 3 -B) indicates that it can be used for the differential diagnosis of prevalent CSFV strains. After isotype identification of the 7A12 monoclonal antibody, it was found that monoclonal antibody 7A12 is an IgG1 subtype of the κ light chain; the results are shown in the appendix. Figure 4 .

[0055] Example 3: Identification and analysis of antigenic epitopes recognized by genotype 2 CSFV E2HZ 7A12 monoclonal antibody

[0056] Identification and Conservation Analysis of the Antigenic Epitope Recognized by the CSFV E2HZ 7A12 Monoclonal Antibody: To clarify the antigenic epitope recognized by the 7A12 monoclonal antibody, a truncated and single-point mutant type 2 CSFV E2HZ protein gene fragment was amplified by PCR, ligated into the pET30a vector, and transformed into DH5α competent cells. Positive monoclonal colonies with correct sequencing were expanded and cultured, and plasmids were extracted and transformed into Rossetta competent cells. Positive monoclonal colonies were screened by PCR, expanded to OD600 = 0.6, and 1 mM IPTG was added to induce expression of the truncated E2 protein at 16℃. The reactivity of the truncated E2 protein with the 7A12 monoclonal antibody was further identified by Western blot, confirming the antigenic epitope recognized by the 7A12 monoclonal antibody, and its conservation in different CSFV strains was further analyzed.

[0057] Experimental results:

[0058] The results are attached. Figure 5 As shown in Figure -A, monoclonal antibody 7A12 reacts with recombinant truncated proteins aa1-332 and aa1-72, but not with aa1-56 and aa199-332, indicating that the epitope recognized by monoclonal antibody 7A12 is located within the aa1-72 region of the type 2 CSFV E2 protein. Based on the sequence alignment results of E2 proteins from different CSFV strains (see attached...), Figure 5 -B), further single-point mutation of the E2HZ protein of type 2 CSFV determined that the key amino acid sites of the monoclonal antibody 7A12 distinguishing gene from type 2 CSFV and type 1 C strain are proline at position 20, glutamic acid at position 24, and aspartic acid at position 40. Among them, the distinguishing amino acid site E24 is conserved in the type 2 epidemic strain E2, while the distinguishing amino acid sites P20 and D40 are only conserved in the type 2.1 epidemic strain E2.

[0059] Example 4: Establishment of CSFV-based differential blocking ELISA

[0060] (1) Determination of optimal antigen coating concentration and detection monoclonal antibody dilution ratio: Purified CSFV E2HZ was used as the coating antigen, and the titer of monoclonal antibody 7A12 was determined by indirect ELISA. The reaction conditions were optimized using the square titration method: CSFV E2HZ protein coating concentrations were 1 μg / mL, 2 μg / mL, and 4 μg / mL, and the dilution ratios of monoclonal antibody 7A12 were 1:1000, 1:2000, 1:4000, 1:8000, and 1:16000. After adding the detection monoclonal antibody, the reaction was carried out at 37℃ for 1 h, washed three times with PBST, and patted dry. Then, HRP-labeled goat anti-mouse IgG secondary antibody diluted 1:10000 was added, and the reaction was carried out at 37℃ for 1 h, washed three times with PBST, and patted dry. The reaction was then developed with TMB for 10 min, and the development was terminated with 2M sulfuric acid. OD 450nm reading.

[0061] (2) Determination of the optimal serum dilution ratio: Based on the established CSFV E2HZ antigen coating concentration and the dilution ratio of the detection monoclonal antibody 7A12, the effect of serum dilution ratio on the blocking rate was investigated. Serum (sera to be tested) collected 28 days after challenge with genotype 2 CSFV strain QZ14 and one CSFV standard negative serum were diluted at 1:5, 1:10, 1:20, and 1:40, respectively, 50 μL / well, incubated at 37℃ for 1 h, washed three times with PBST, and blotted dry. 50 μL of 1:8000 diluted monoclonal antibody 7A12 was added to each well, incubated at 37℃ for 1 h, washed three times with PBST, and blotted dry. 50 μL of 1:10000 diluted HRP-labeled goat anti-mouse IgG secondary antibody was added to each well, incubated at 37℃ for 1 h, washed three times with PBST, and blotted dry. 100 μL of TMB was added to each well for color development for 10 min, and color development was stopped with 2M sulfuric acid. OD was then measured.450nm Reading value. The blocking rate is calculated using the following formula: Blocking rate (%) = (1 – OD of the serum sample) 450nm ) / negative serum OD450nm .

[0062] Table 1. Blocking rate of monoclonal antibody 7A12 against serum challenged with genotype 2 CSFV strain QZ14 at different dilutions.

[0063]

[0064] (3) Preliminary establishment of ELISA system for identifying and blocking genotype 2 classical swine fever: Based on the determined CSFV E2HZ antigen coating concentration, detection monoclonal antibody dilution ratio and serum dilution ratio, an ELISA system for identifying and blocking genotype 2 classical swine fever was established. Serum samples collected 28 days after challenge with genotype 2 CSFV strain QZ14 (test serum), serum collected 28 days after immunization with vaccine strain C (test serum), and one CSFV standard negative serum were diluted 1:5, 50 μL / well, incubated at 37°C for 1 h, washed 3 times with PBST, and blotted dry. 50 μL of monoclonal antibody 7A12 diluted 1:8000 was added to each well, incubated at 37°C for 1 h, washed 3 times with PBST, and blotted dry. 50 μL of HRP-labeled goat anti-mouse IgG secondary antibody diluted 1:10000 was added to each well, incubated at 37°C for 1 h, washed 3 times with PBST, and blotted dry. 100 μL of TMB was added to each well for color development for 10 min, and the color development was stopped with 2M sulfuric acid. OD was then measured. 450nm Read value.

[0065] (4) Specificity detection of the genotype 2 classical swine fever identification and blocking ELISA system: 12 swine serum samples (4 swine serum samples challenged with the type 2 CSFV epidemic strain 21 days ago, 3 swine serum samples immunized with vaccine strain C 28 days ago, 2 swine serum samples infected with BVDV type 1, 2 swine serum samples infected with BVDV type 2, and 1 CSFV negative swine serum) were tested using the blocking ELISA system established above.

[0066] Experimental results:

[0067] Based on the monoclonal antibody 7A12 for the differential diagnosis of genotype 2 CSFV, a preliminary blocking ELISA detection method for identifying genotype 2 CSFV was established. In this blocking ELISA system, monoclonal antibody 7A12 can distinguish infection with circulating genotype 2 CSFV strains and vaccine strain C (see appendix). Figure 6 Furthermore, the optimal protein coating concentration for CSFV E2HZ was determined to be 1 μg / mL, and the 7A12 dilution ratio was determined to be 1:8000 (see Appendix). Figure 7 The serum dilution ratio was 1:5 (see Table 1). Several serum samples were taken for specificity testing of the blocking ELISA system, and the results are attached. Figure 8As shown, the antibody blocking rate of 4 CSFV epidemic strain serum samples was greater than 47%, the antibody blocking rate of 3 vaccine C strain positive serum samples and the antibody blocking rate of 4 BVDV positive serum samples were less than 13%, indicating that the blocking ELISA system has good specificity and can be used for large-scale clinical serum sample screening, and has the potential to be developed into a differential diagnostic kit.

[0068] Example 5: Sequence Analysis of the Encoding Gene of CSFV E2HZ 7A12 Monoclonal Antibody

[0069] Experimental methods:

[0070] Total RNA was extracted from CSFV E2HZ 7A12 monoclonal hybridoma cells using a kit and reverse transcribed into cDNA. Two pairs of degenerate primers were designed based on the variable regions of the antibody heavy and light chains, and PCR amplification was performed separately. The target fragment was recovered, cloned into a T vector, and sent to the company for sequencing.

[0071] Experimental results:

[0072] V of the 7A12 monoclonal antibody was obtained by IMGT analysis. H CDR1, V H CDR2 and V H CDR3 and V L CDR1, V L CDR2 and V L CDR3, wherein the V H CDR1, V H CDR2 and V H The amino acid sequences of CDR3 are shown in SEQ ID NO:1-3, respectively. L CDR1, V L CDR2 and V L The amino acid sequences of CDR3 are shown in SEQ ID NO:4–6. The amino acid sequence of the light chain variable region is shown in SEQ ID NO:7, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO:8. The gene sequence encoding the light chain variable region is shown in SEQ ID NO:9, and the gene sequence encoding the heavy chain variable region is shown in SEQ ID NO:10.

[0073] Example 6: Specific application example of CSFV E2HZ 7A12 monoclonal antibody

[0074] Prepare an ELISA kit for identifying genotype 2 classical swine fever virus using the following formulation:

[0075] Its components are as follows:

[0076] (a) Eukaryotic expression protein CSFV-E2HZ of genotype 2 CSFV E2 and its pre-coated ELISA plate (100 ng / well);

[0077] (b) Sample diluent;

[0078] (c) Negative control;

[0079] (d) Monoclonal antibody 7A12;

[0080] (e) HRP-labeled goat anti-mouse IgG;

[0081] (f) Washing buffer: 0.5% PBST (10mM PBS + 0.5% Tween 20);

[0082] (g) Developing solution: TMB substrate (solution A, solution B);

[0083] (h) Termination solution: 2M H2SO4

[0084] Instructions for using this blocking ELISA kit:

[0085] (1) All kit components must be brought to room temperature (18-25°C) before use. The reagents should be mixed by gentle vortexing.

[0086] (2) Dilute the serum with sample diluent at a ratio of 1:5, add 50 μL to each well, set up replicates and negative controls, incubate at 37°C for 1 h or at 4°C overnight, wash 3 times with 0.5% PBST for 5 min each time, and pat dry.

[0087] (3) Dilute monoclonal antibody 7A12 1:8000 with sample dilution buffer, add 50 μL to each well, incubate at 37℃ for 1 h, wash 3 times with 0.5% PBST for 5 min each time, and pat dry.

[0088] (4) HRP-labeled goat anti-mouse IgG was diluted 1:10000 with sample dilution buffer, 50 μL was added to each well, incubated at 37°C for 1 h, washed 3 times with 0.5% PBST for 5 min each time, and patted dry.

[0089] (5) Add 100 μL of freshly prepared TMB colorimetric solution (equal volumes of solution A and solution B mixed together) and let stand for 10 min in the dark at room temperature. Timing can begin after adding the solution to the first well.

[0090] (6) At the 10-minute mark, add 50 μL of stop solution (2M H2SO4) to each well to terminate the reaction. The order of adding the stop solution must be consistent with the order of adding the colorimetric solution.

[0091] (7) Measure the absorbance of the sample at 450 nm.

[0092] (8) Calculate the blocking rate of the sample using the following formula:

[0093] Blocking rate (%) = (1 – OD of the serum to be tested) 450nm ) / negative serum OD 450nm .

[0094] (9) Result determination:

[0095] If the blocking rate of the tested sample is greater than or equal to 36%, the sample can be determined to be positive, that is, the serum contains antibodies against the CSFV genotype 2 strain.

[0096] If the blocking rate of the tested sample is less than or equal to 29%, the sample can be determined to be negative, that is, the serum does not contain antibodies against the CSFV genotype 2 strain.

[0097] If the blocking rate of the tested sample is between 29% and 36%, it is considered suspicious.

[0098]

[0099]

[0100]

Claims

1. A monoclonal antibody 7A12 for identifying genotype 2 classical swine fever, characterized in that, The monoclonal antibody comprises Ig domains V H CDR1, V H CDR2 and V H CDR3 of an antibody heavy chain, and Ig domains V L CDR1, V L CDR2 and V L CDR3 of an antibody light chain; wherein the V H CDR1, V H CDR2 and V H CDR3 have the amino acid sequences shown in SEQ ID NOs: 1-3, respectively; and the V L CDR1, V L CDR2 and V L CDR3 have the amino acid sequences shown in SEQ ID NOs: 4-6, respectively.

2. The monoclonal antibody according to claim 1, characterized in that, The monoclonal antibody is a full-length antibody, a Fab antibody, or an F(ab')2 antibody.

3. The monoclonal antibody according to claim 1 or 2, characterized in that, In the monoclonal antibody, the amino acid sequence of the light chain variable region is shown in SEQ ID NO.7, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.

8.

4. The gene encoding the monoclonal antibody of claim 3, characterized in that, The gene sequence encoding the light chain variable region is shown in SEQ ID NO.9, and the gene sequence encoding the heavy chain variable region is shown in SEQ ID NO.

10.

5. The method of applying any one of the monoclonal antibodies according to claim 1 or 2, characterized in that, A kit for identifying genotype 2 classical swine fever was prepared using the monoclonal antibody described above.

6. A kit for identifying genotype 2 classical swine fever, characterized in that, The kit includes any one of the monoclonal antibodies described in claim 1 or 2.

7. The reagent kit according to claim 6, characterized in that, This kit is a blocking ELISA kit, and the detection method when using the kit is serological detection.

Images