High-yield palmitoleic acid engineering schizochytrium limacinum as well as construction method and application thereof
By introducing the heterologous Δ9 desaturase gene DSM9DE into Schizochytrium and optimizing the promoter P3626 and gene copy number, the problem of low palmitoleic acid synthesis efficiency in existing technologies was solved, resulting in a significant increase and stability of palmitoleic acid content in oils and expanding the application potential of functional lipids.
Patent Information
- Application Number
- CN202610475439.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-13
- Publication Date
- 2026-05-12
- Estimated Expiration
- 2046-04-13
AI Technical Summary
In the existing Schizochytrium system, lipid metabolism naturally favors DHA, resulting in low palmitoleic acid synthesis efficiency, poor substrate specificity of Δ9 desaturase, and insufficient promoter selection and gene dosage optimization, leading to limited and unstable improvement in palmitoleic acid enrichment.
By introducing the heterologous Δ9 desaturase gene DSM9DE into Schizochytrium, optimizing the promoter P3626 and optimizing the gene copy number, a high-yield palmitole acid engineered strain was constructed to enhance the transformation ability from C16:0 to C16:1.
It significantly increased the palmitoleic acid content in the oil of Schizochytrium to over 4%, an increase of 710.6%, while maintaining genetic stability, thus expanding the application value of functional monounsaturated fatty acids.
Smart Images

Figure CN122012259A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bioengineering and microbial fermentation technology, and in particular to a high-yield palmitoleic acid engineered Schizochytrium fungus, its construction method and application. Background Technology
[0002] Schizochytrium sp. is an important industrial oil-producing microorganism capable of efficiently accumulating intracellular lipids and synthesizing various fatty acid components, making it widely applicable in the industrial production of functional lipids. Palmitoleic acid (C16:1) is a monounsaturated fatty acid with important physiological activities and high application potential in metabolic regulation and anti-inflammatory fields; therefore, the demand for oil raw materials with high palmitoleic acid content is increasing.
[0003] In existing Schizochytrium sp. HX-308 systems, lipid metabolism flux naturally favors the synthesis of polyunsaturated fatty acids such as docosahexaenoic acid (DHA), resulting in extremely low palmitoleic acid (PPA) content in oils (generally below 1.5%), making it difficult to meet the production requirements for PPA as a target functional lipid. While numerous methods exist to increase oil yield or fatty acid composition in Schizochytrium, significant technical bottlenecks remain in achieving specific enrichment of PPA. In particular, PPA formation depends on the conversion of C16:0 to C16:1 by Δ9 desaturase. However, in the endogenous context of Schizochytrium, factors such as substrate preference, expression intensity, and gene dosage effects of exogenous Δ9 desaturase often become key limitations on the magnitude and stability of PPA enhancement. Therefore, how to construct high-palmitoleic acid engineered Schizochytrium through systematic optimization at the gene element level is a pressing technical problem to be solved in this field.
[0004] Specifically, the existing technology has the following drawbacks: 1. The lipid metabolism of Schizochytrium naturally favors the synthesis of polyunsaturated fatty acids such as DHA, and the carbon flow is difficult to be effectively redirected to C16:1, resulting in a limited increase in palmitoleic acid enrichment and insufficient stability.
[0005] 2. Existing Δ9 desaturases have diverse sources, but their substrate specificity varies significantly. Some enzymes have low conversion efficiency for C16:0 or are not well-matched in expression in Schizochytrium, making it difficult to obtain the optimal gene source that combines high activity and high adaptability.
[0006] 3. There is a lack of systematic optimization strategies in promoter selection and gene dosage (copy number). Common expression systems have insufficient intensity or copy number to form a significant dose effect, making it difficult to establish sustained high transformation capacity in cells and achieve significant enrichment of palmitoleic acid. Summary of the Invention
[0007] The purpose of this invention is to overcome the shortcomings of the prior art and provide a high-yield palmitole acid engineered schistocytotrium, its construction method and application.
[0008] The technical solution adopted by this invention to solve its technical problem is: A high-yield engineered schistocytrium is obtained by introducing and expressing a heterologous Δ9 desaturase gene into schistocytrium through genetic engineering. The heterologous Δ9 desaturase gene is then subjected to gene source screening, promoter optimization, and target gene copy number optimization to enhance the conversion ability from C16:0 to C16:1, thereby significantly increasing the palmitoleic acid (C16:1, POA) content in the oil of schistocytrium.
[0009] Furthermore, the heterologous Δ9 desaturase gene is the gene DSM9DE derived from Desmodesmus sp., and its nucleotide sequence is shown in SEQ ID No. 3; Alternatively, the schizochytrium may include Schizochytrium sp. HX-308.
[0010] Furthermore, the promoter optimization includes placing the heterologous Δ9 desaturase gene under the regulation of the Schizochytrium endogenous promoter to increase the expression intensity of the target gene in Schizochytrium. The endogenous promoter is the strong endogenous promoter P3626 of Schizochytrium, and its nucleotide sequence is shown in SEQ ID No. 6.
[0011] Furthermore, the optimization of the target gene copy number includes: integrating 2-3 copies of the heterologous Δ9 desaturase gene into the Schizochytrium genome to enhance the gene dosage effect and further increase the palmitoleic acid content.
[0012] Furthermore, the integration of 2-3 copies is achieved through resistance selection markers, including the G418 resistance gene and the bleomycin (Zeocin) resistance gene.
[0013] The method for constructing the high-yield palmitole acid engineered Schizochytrium as described above includes the following steps: Using the genome of *Schizochytrium* HX-308 as a template, the endogenous strong promoter P3626 was amplified and sequentially linked with the artificially synthesized heterologous Δ9 desaturase gene DSM9DE from *Scenedesmus* and a terminator element to construct a target gene expression cassette driven by the strong promoter. This expression cassette was cloned into transformation plasmids containing the G418 resistance gene and the bleomycin (Zeocin) resistance gene, respectively, to construct two recombinant expression vectors with different selection markers, which were used to transform *Schizochytrium* competent cells. Transformants were plated on plates containing G418 and bleomycin (Zeocin) antibiotics for selection. Resistant colonies were picked, and genomic PCR was used to identify whether the resistance marker genes and the target gene DSM9DE were successfully integrated. Subsequently, by gradually increasing the antibiotic screening pressure, the obtained transformants were continuously screened, and the integration copy number of the target gene DSM9DE in the genome was detected by qPCR. At the same time, its genetic stability was verified by continuous subculturing for 3-4 generations. Finally, a recombinant engineered strain with an integration copy number of 2-3 DSM9DE and stable genetic traits was obtained, which is the high-yield palmitole acid engineered schistostrophic strain P3D2BG.
[0014] The specific methods for preparing and electroconverting competent cells of Schizochytrium are as follows: Schizochytrium sp. HX-308 was inoculated into seed culture medium and cultured at 28 °C and 170 rpm for 24 h. The inoculum was then transferred to fresh seed culture medium at a 10% inoculum level and cultured for another 12–18 h until the cells reached the logarithmic growth phase. The bacterial suspension was centrifuged at 4 °C and 4000 rcf for 10 min to collect the cells. The cells were washed with an equal volume of pre-chilled sorbitol solution (18.22 g / ml), centrifuged at 4 °C and 4000 rcf for 10 min, and the supernatant was discarded. The cells were washed once more with sorbitol, and the supernatant was discarded. Finally, the bacterial suspension was resuspended in 2–4 ml of pre-chilled sorbitol solution to obtain a Schizochytrium competent cell suspension. This suspension was aliquoted into sterile 1.5 ml centrifuge tubes (100 μL per tube) and stored at -80 °C for later use.
[0015] For electroporation, 100 μL of competent Schizochytrium cells were placed on ice, and 10–20 μL of recombinant plasmid was added to the competent cells. After mixing, the mixture was transferred to a pre-cooled 0.2 cm electroporation cuvette and electroporated at 0.75 kV, 25 μF, and 200 Ω. Immediately after electroporation, 1 ml of antibiotic-free seed culture medium was added, and the cells were incubated at 28 °C and 150–220 rpm for 2 h. After incubation, the bacterial culture was plated on selection plates containing the corresponding antibiotic and incubated at 28 °C for 3–5 days. Resistant single colonies were picked for purification, and positive transformants were identified by PCR.
[0016] Furthermore, the composition of the screening plate is: 10 g / L peptone, 5 g / L yeast extract, 50 g / L glucose, 20 g / L sea salt, 20 g / L agar, and water as the solvent.
[0017] The application of the high-palmitoic acid-producing engineered Schizochytrium strains as described above in the fermentation production of palmitoic acid.
[0018] The method for producing palmitic acid by fermentation using the high-yield engineered Schizochytrium as described above includes the following steps: After the engineered Schizochytrium is activated by inoculating a seed culture medium, a fermentation strain is obtained. The fermentation strain is then inoculated into a fermentation culture medium for fermentation. After fermentation, the cells are collected and the oil is extracted to obtain palmitoleic acid.
[0019] Furthermore, the specific steps are as follows: High-yield palmitole acid engineered Schizochytrium was inoculated into seed culture medium and cultured at 28 ℃ for 24 h to obtain primary seed. Primary seed was then inoculated into seed culture medium at an inoculation rate of 10% of the seed culture medium volume and cultured again at 28 ℃ for 24 h to obtain secondary seed. Secondary seed was then inoculated into seed culture medium at an inoculation rate of 10% of the seed culture medium volume and cultured again at 28 ℃ for 24 h. This activation process yielded the fermentation strain. Fermentation strain with an OD600 value of 8-10 was inoculated into fermentation medium at an inoculation rate of 0.8%–1.5% and fermented for 120 h at 25 ℃ and 170 rpm.
[0020] Furthermore, the seed culture medium comprises: 45 g / L glucose, 2 g / L yeast extract, 15 g / L sodium glutamate, 4 g / L MgCl2·7H2O, 15 g / L Na2SO4, 1 g / L KCl, 1 g / L NaCl, 5 g / L MgSO4·7H2O, and 3 g / L KH2PO4, with water as the solvent; The fermentation medium consisted of: 90 g / L glucose, 4 g / L yeast extract, 15 g / L sodium glutamate, 4 g / L MgCl2·7H2O, 15 g / L Na2SO4, 1 g / L KCl, 1 g / L NaCl, 5 g / L MgSO4·7H2O, 3 g / L KH2PO4, and 4 g / L (NH4)2SO4, with water as the solvent. Alternatively, the fermentation strain can be inoculated into the fermentation medium at an inoculation rate of 1% for fermentation culture.
[0021] The advantages and positive effects of this invention are as follows: 1. This invention employs a combined strategy of "heterologous Δ9 desaturase optimization + expression intensity optimization + gene dose effect enhancement". By screening, a highly active Δ9 desaturase gene (such as DSM9DE) that is more suitable for the background of Schizochytrium substrate is obtained. Combined with endogenous strong promoter drive and multi-copy integration, the C16:0 → C16:1 transformation pathway is significantly enhanced, which solves the problems of low palmitoleic acid synthesis efficiency and limited improvement in the prior art.
[0022] 2. This invention focuses on system optimization at the gene element level, and can significantly increase the content of palmitoleic acid (POA, C16:1) in the oil of Schizochytrium without relying on additional metabolic regulation methods. Compared with the scheme of expressing only a single copy or using a weak promoter, the improvement effect of this invention is more obvious and more reproducible.
[0023] 3. This invention enhances the expression of target genes through promoter optimization and copy number optimization, enabling the palmitoleic acid content of engineered strains to reach more than 4%, and further more than 6%, representing an increase of 710.6% compared to the starting strain. This significant improvement expands the application value of Schizochytrium oil in the field of functional monounsaturated fatty acids, forming a potential high-value-added product route in addition to DHA-related products.
[0024] 4. The engineered strain constructed in this invention obtains a stable genetic background through multi-copy integration of the genome, and the target traits show good stability in continuous passage or repeated culture, which is beneficial for subsequent scale-up production and batch consistency control.
[0025] 5. This invention significantly increases the palmitoleic acid (C16:1, POA) content in the oil of *Schizochytrium* by genetically engineering *Schizochytrium*, based on screening Δ9 desaturase genes from different sources, promoter optimization, and target gene copy number optimization. The technical route of this invention is clear and highly operable: through a progressive engineering strategy of "gene source screening—promoter optimization—copy number optimization," it can be widely applied to *Schizochytrium* and its closely related high-oil-producing microorganisms, demonstrating good versatility and industrialization potential.
[0026] 6. This invention addresses the characteristics of Schizochytrium fungi, which naturally favors the synthesis of polyunsaturated fatty acids and has a low content of palmitoleic acid. It employs gene element engineering to achieve targeted remodeling of fatty acid composition, enabling efficient enrichment of palmitoleic acid. This invention has the advantages of novel technical solution, significant improvement effect, and suitability for large-scale application.
[0027] 7. This invention introduces and expresses a heterologous Δ9 desaturase gene in *Schizochytrium*, uses gene source screening to determine the optimal Δ9 desaturase gene (preferably DSM9DE from *Scenedesmus*), and further optimizes the expression regulatory elements of the target gene (preferably using the *Schizochytrium* endogenous strong promoter P3626 to drive expression). Simultaneously, copy number optimization of the target gene is implemented to enhance the gene dosage effect, thereby significantly increasing the palmitoleic acid (C16:1, POA) content in *Schizochytrium* oil. Compared with the starting strain, the engineered strain of this invention can achieve a significant increase in palmitoleic acid content, preferably exceeding 4%, and further exceeding 6%. This method has a clear technical route and strong operability, providing engineered strains and application solutions for the industrial production of high-palmitoleic acid functional lipid raw materials. Attached Figure Description
[0028] Figure 1 This is a comparative graph showing the effect of expression of Δ9 desaturase genes from different sources in Schizochytrium on the content of palmitoleic acid (POA, C16:1) in oils in Example 1 of the present invention. Figure 2 This is a comparison diagram of the fatty acid composition (including at least C16:0, C16:1, DHA and other major fatty acids) of different Δ9 desaturase gene expression strains from different sources in Example 1 of the present invention. Figure 3 This is a comparison chart showing the effects of different promoters driving DSM9DE expression on the content of palmitoleic acid (POA) in oils in Example 2 of the present invention. Figure 4 This is a comparative graph showing the effect of "different target gene copy number / copy stacking strategy (FDP)" on the palmitoleic acid (POA) content in oils in Example 3 of the present invention; Figure 5 This is the gas chromatogram (GC) of the "starting strain (HX-308)" in the comparative example of this invention; Figure 6 This is a gas chromatogram (GC) of the "high-yield palmitoleic acid engineered strain (optimal construct)" in an embodiment of the present invention; Figure 7 This is a fragment PCR image of the original strain HX-308 and the high-palmitoic acid-producing engineered strain P3D2BG in the embodiments of the present invention.
[0029] The Schizochytrium sp. HX-308 strain in this invention is a strain in the prior art. This strain has been deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC No. M209059, as disclosed in Chinese patent publication CN101575584A. Detailed Implementation
[0030] The present invention will be further described below with reference to the embodiments. The following embodiments are descriptive and not limiting, and should not be used to limit the scope of protection of the present invention.
[0031] The various experimental operations involved in the specific embodiments are all conventional techniques in the field. For parts not specifically annotated in this document, those skilled in the art can refer to various commonly used reference books, scientific and technological documents or related instructions and manuals prior to the filing date of this invention to carry out the operations.
[0032] A method for constructing high-yield palmitoleic acid engineered Schizochytrium involves screening heterologous Δ9 desaturase genes from different sources to determine the optimal gene source, further optimizing the expression regulatory elements of the target gene, selecting a promoter to improve expression intensity, and optimizing the copy number of the target gene. By integrating multiple copies, the gene dosage effect is enhanced, thereby increasing the palmitoleic acid (POA, C16:1) content in the oil of Schizochytrium.
[0033] Furthermore, the heterologous Δ9 desaturase gene is derived from *Desmodesmus* sp., with gene number DSM9DE, and its nucleotide sequence is shown in SEQ ID No. 3; the gene is driven by the endogenous strong promoter P3626 of *Schizochytrium*, and its nucleotide sequence is shown in SEQ ID No. 6.
[0034] Furthermore, the promoter optimization involves placing the heterologous Δ9 desaturase gene under the regulation of a strong endogenous promoter from Schizochytrium, or comparing the expression of the heterologous Δ9 desaturase gene using promoters of different strengths from Schizochytrium, thereby determining the optimal promoter for increasing palmitoleic acid content.
[0035] Furthermore, the gene copy number is superimposed as follows: 2-3 copies of the heterologous Δ9 desaturase gene are integrated into the Schizochytrium genome to obtain an engineered strain with further increased palmitoleic acid content.
[0036] Furthermore, the multicopy integration is achieved through resistance selection markers; the resistance selection markers include, but are not limited to, the G418 resistance gene and / or the bleomycin Zeocin resistance gene, for screening to obtain transformants with a higher target gene copy number.
[0037] Furthermore, the Schizochytrium is Schizochytrium sp. HX-308 and its derived engineered strains (such as P3D2BG).
[0038] Further, the engineered strain of Schizochytrium is inoculated into a seed culture medium for activation to obtain a fermentation strain; the fermentation strain is inoculated into a fermentation culture medium for fermentation culture; after fermentation, the cells are collected and the oil is extracted to detect the palmitoleic acid content in the oil.
[0039] Furthermore, the OD value of the fermentation strain is 8–10; the inoculum amount of the fermentation strain is 0.8%–1.5% of the fermentation medium volume.
[0040] Further, the specific steps are as follows: The constructed engineered fissuriyces (such as P3D2BG) is inoculated into a seed culture medium and cultured at 28 ℃ for 24 h to obtain primary seeds; 10% of the volume of the primary seeds is inoculated into the seed culture medium and cultured again at 28 ℃ for 24 h to obtain secondary seeds; 10% of the volume of the secondary seeds is inoculated into the seed culture medium and cultured again at 28 ℃ for 24 h. After the above activation process, the fermentation strain is obtained; 1% of the fermentation strain with an OD600 value of 8-10 is inoculated into the fermentation culture medium and fermented at 25 ℃ and 170 rpm for 120 h.
[0041] Further, the seed culture medium consists of: 45 g / L glucose, 2 g / L yeast extract, 15 g / L monosodium glutamate, 4 g / L MgCl2·7H2O, 15 g / L Na2SO4, 1 g / L KCl, 1 g / L NaCl, 5 g / L MgSO4·7H2O, and 3 g / L KH2PO4, with water as the solvent; the fermentation culture medium consists of: 90 g / L glucose, 4 g / L yeast extract, monosodium glutamate, 4 g / L MgCl2·7H2O, 15 g / L Na2SO4, 1 g / L KCl, 1 g / L NaCl, 5 g / L MgSO4·7H2O, 3 g / L KH2PO4, and 4 g / L (NH4)2SO4, with water as the solvent.
[0042] Furthermore, by employing a combined strategy of screening for heterologous Δ9 desaturase gene sources, promoter optimization, and gene copy number superposition, the palmitoleic acid content in the oil of Schizochytrium can be significantly increased; preferably, the palmitoleic acid content can reach more than 4%, and more preferably more than 6%, which is a significant increase compared to the starting strain.
[0043] The engineered strain is a high-yield palmitoleic acid engineered strain obtained through promoter optimization and gene copy number optimization, preferably the engineered strain P3D2BG obtained by the multi-copy integration strategy in Example 3 of the present invention.
[0044] Specifically, the relevant preparation and testing methods are as follows: The culture medium components used in each embodiment are as follows: The seed culture medium consisted of: 45 g / L glucose, 2 g / L yeast extract, 15 g / L sodium glutamate, 4 g / L MgCl2·7H2O, 15 g / L Na2SO4, 1 g / L KCl, 1 g / L NaCl, 5 g / L MgSO4·7H2O, and 3 g / L KH2PO4, with water as the solvent.
[0045] The fermentation medium consisted of: 90 g / L glucose, 4 g / L yeast extract, 15 g / L sodium glutamate, 4 g / L MgCl2·7H2O, 15 g / L Na2SO4, 1 g / L KCl, 1 g / L NaCl, 5 g / L MgSO4·7H2O, 3 g / L KH2PO4, and 4 g / L (NH4)2SO4, with water as the solvent.
[0046] The specific formulation of the screening plate is as follows: 10 g / L peptone, 5 g / L yeast extract, 50 g / L glucose, 20 g / L sea salt, 20 g / L agar, and water as the solvent.
[0047] Specific fermentation method: The general fermentation method is as follows: *Schizochytrium HX-308* is inoculated into a seed culture medium and cultured at 28 ℃ for 24 h to obtain primary seed; 10% of the primary seed volume is inoculated into the seed culture medium and cultured again at 28 ℃ for 24 h to obtain secondary seed; 10% of the secondary seed volume is inoculated into the seed culture medium and cultured again at 28 ℃ for 24 h. Through the above activation process, the fermentation strain is obtained. Take 0.5L of fermentation strain with an OD600 value of 8-10 and inoculate it into 50L of fermentation medium. Ferment and culture for 120 h at a temperature of 25 ℃ and a rotation speed of 170 rpm.
[0048] Gas chromatography analysis: After fermentation, the pH of the fermentation broth was adjusted to 10 with NaOH. 0.3% (w / w) of lysozyme was added, and the mixture was enzymatically hydrolyzed at 55 °C for 1 h. Hexane was then added for extraction, and the mixture was allowed to stand for phase separation. The upper yellow organic phase was collected, and extraction was repeated until the upper phase became colorless. The organic phases were combined, and the solvent was evaporated to obtain the total oil. 2 ml of 15% (w / w) NaOH solution and 5.5 ml of 70% (v / v) methanol aqueous solution were added to the total oil. The mixture was reacted in a water bath at 65 °C for 1.5 h. After cooling to room temperature, 2 ml of hexane (chromatographic grade) was added for extraction, and the upper organic phase was collected. The upper organic phase was filtered through a micromembrane pore to remove impurities and then analyzed by gas chromatography.
[0049] Example 1: Screening of Δ9 desaturase genes from different sources This invention aims to increase the palmitoleic acid (C16:1, POA) content in the oil of *Schizochytrium sp. HX-308*. Optimal gene sources were screened from heterologous Δ9 desaturase genes of different species to identify those most suitable for expression in *Schizochytrium* and exhibiting high transformation efficiency for the substrate C16:0. By comparing the expression effects of Δ9 desaturases from different sources in *Schizochytrium*, target genes capable of significantly increasing palmitoleic acid content were screened.
[0050] The specific filtering and construction methods are as follows: Δ9 desaturase genes from *Saccharomyces cerevisiae*, *Mortierella alpina*, and *Desmodesmus sp.* were selected, and codon optimization was performed on these genes based on the codon preference of *Schizochytrium*. The Δ9 desaturase gene from *Saccharomyces cerevisiae* was named Sc-Δ9, and its nucleotide sequence is shown in SEQ ID No. 1; the Δ9 desaturase gene from *Mortierella alpina* was named Ma-Δ9, and its nucleotide sequence is shown in SEQ ID No. 2; the Δ9 desaturase gene from *Desmodesmus sp.* was named DSM9DE, and its nucleotide sequence is shown in SEQ ID No. 3. Using the plasmid backbone pZPK-P2520 containing the *Schizochytrium* basal promoter P2520 as the base vector, and its nucleotide sequence is shown in SEQ ID No. 7, primers with homologous sequences to the ends of the plasmid insertion sites were designed at both ends of the target gene. The specific primer sequences are shown in Table 1. The optimized target genes were inserted downstream of the P2520 promoter (whose nucleotide sequence is shown in SEQ ID No. 4) to construct recombinant plasmids pP2520-ScD9, pP2520-MaD9, and pP2520-DSM9DE, which express Δ9 desaturases from different sources. The optimized Sc-Δ9, Ma-Δ9, and DSM9DE genes were amplified using Novizan P520 high-fidelity enzyme (2 × Phanta Flash Master Mix (Dye Plus)). A 50 μL PCR system was prepared: 25 μL P520 enzyme, 20 μL pure water, 2 μL each of forward and reverse primers, 1 μL template pZPK-P2520, pre-denaturation at 98℃ for 30 s, denaturation at 98℃ for 10 s, annealing at 57℃ for 5 s, extension at 72℃ for 10 s, for 34 cycles, with a final extension at 72℃ for 1 min. After PCR, the fragments were cleaned and recovered. Using the UELandy DNA gel extraction kit, 150 μL of DE-A was added to the PCR tube and mixed thoroughly to prevent degradation of linear DNA at high temperatures. The mixture was transferred to a 2 ml preparation tube (provided in the kit), centrifuged at 12000 rcf for 1 min, and the filtrate was discarded. 500 μL of buffer was added. W1, centrifuge at 12000 rcf for 1 min, discard the filtrate. Add 700 μL Buffer W2, centrifuge at 12000 rcf for 1 min, discard the filtrate. Perform one empty centrifuge, centrifuge at 12000 rcf for 1 min, discard the filtrate.Transfer the adsorption column from the preparation tube to a clean 1.5 ml centrifuge tube, add 50 μL of preheated 65 °C pure water, centrifuge at 12000 rcf for 1 min to obtain purified Sc-Δ9, Ma-Δ9, and DSM9DE genes. Simultaneously, linearize the plasmid backbone (designing and retaining only one HindIII restriction site on the plasmid backbone pZPK-P2520, preparing a 50 μL system: 2 μL HindIII enzyme, 5 μL cut-one-buffer, 1 μL template pZPK-P2520, 15 μL pure water, incubate at 37 °C for 3 h, then perform gel extraction using the UELandy DNA gel extraction kit. Under UV light, cut off the agarose gel containing the target DNA, blot the surface liquid with a paper towel, chop the gel, add it to a 2 ml centrifuge tube, add 400 μL DE-A to cover the gel, mix well, and incubate at 75 °C. Heat the centrifuge tube in a metal bath at ℃, inverting it every 2-3 minutes to mix until the gel block is completely melted. Add 200 μL of DE-B and mix thoroughly to ensure a homogeneous yellow solution. Transfer the mixture to a 2 ml preparation tube, centrifuge at 12000 rcf for 1 min, and discard the filtrate. Add 500 μL of Buffer W1, centrifuge at 12000 rcf for 1 min, and discard the filtrate. Add 700 μL of Buffer W2, centrifuge at 12000 rcf for 1 min, and discard the filtrate. Perform one empty centrifuge, centrifuge at 12000 rcf for 1 min, and discard the filtrate. Transfer the adsorption column from the preparation tube to a clean 1.5 ml centrifuge tube, add 50 μL of preheated 65 ℃ pure water, and centrifuge at 12000 rcf for 1 min to obtain the purified linearized plasmid backbone pZPK-P2520. Subsequently, homologous recombination was used (10 μL systems were prepared: 5 μL of Novizan ClonExpress Ultra One Step Cloning Kit V2 (C116 enzyme), 1 μL of vector (linearized plasmid backbone pZPK-P2520), and 4 μL of fragments (purified Sc-Δ9, Ma-Δ9, and DSM9DE genes), incubated at 37℃ for 15 min to obtain recombinant plasmids). The recombinant plasmids were transformed, screened for resistance, and verified by PCR and sequencing. After confirmation of correctness, they were used for subsequent Schizochytrium transformation experiments. 10–20 μL of the PCR- and sequencing-verified recombinant plasmids were added to Schizochytrium HX-308 competent cells, mixed well, and then added to a pre-cooled 0.2 cm electroporation cuvette. Electroporation was performed at 0.75 kV, 25 μF, and 200 Ω. Immediately after electroporation, 1 ml of antibiotic-free seed culture medium was added, and the culture was restored at 28℃ and 150–220 rpm for 2 h. After recovery, the bacterial culture was spread on a selection plate containing G418 antibiotic (500 mg / mL) and incubated at 28 °C for 3-5 days.Resistant single colonies were selected for purification and identified by PCR to obtain positive recombinant strains with Δ9 desaturase genes from different sources successfully integrated into their genomes.
[0051] The above-mentioned recombinant strains and the control strain without the introduction of the exogenous Δ9 desaturase gene, namely Schizochytrium HX-308, were cultured and fermented according to the aforementioned general fermentation method. After fermentation, the cells were collected and the total oil was extracted. The content of palmitoleic acid (C16:1) and major fatty acid components in the oil was analyzed by gas chromatography.
[0052] During the screening process, the effects of Δ9 desaturase genes from different sources on the palmitoleic acid content in the oil of Schizochytrium were tested. The screening results are shown in Table 2. Table 2 shows that the expression of Δ9 desaturase genes from different sources in Schizochytrium can increase the palmitoleic acid (C16:1) content in the oil to varying degrees, but the effects differ significantly. In the control group HX-308 without the introduction of exogenous Δ9 desaturase genes, the C16:1 content was 0.85% ± 0.12. When the Δ9 desaturase gene Sc-Δ9 from *Saccharomyces cerevisiae* was introduced, the C16:1 content in the oil of the engineered strain increased to 1.42% ± 0.20, an increase of 0.57 percentage points compared to the control group, representing an increase of approximately 67.1%. When the Δ9 desaturase gene Ma-Δ9 from *Mortierella alpina* was introduced, the C16:1 content further increased to 1.76% ± 0.25, an increase of 0.91 percentage points compared to the control group, representing an increase of approximately 107.1%, and an increase of 0.34 percentage points compared to the Sc-Δ9 group, representing an increase of approximately 23.9%. When the gene Ma-Δ9 from *Desmodesmus* was introduced... After the Δ9 desaturase gene DSM9DE was introduced into *Schizochytrium sp.*, the C16:1 content increased to 2.56% ± 0.31, the highest among all experimental groups. This represents an increase of 1.71 percentage points (approximately 201.2%) compared to the control group, 1.14 percentage points (approximately 80.3%) compared to the Sc-Δ9 group, and 0.80 percentage points (approximately 45.5%) compared to the Ma-Δ9 group. These results indicate that the Δ9 desaturase genes from three different sources can promote the conversion of C16:0 to C16:1 in *Schizochytrium sp.*, thereby increasing palmitoleic acid content. However, there are significant differences in expression adaptability and catalytic efficiency among the different gene sources in *Schizochytrium sp.*.
[0053] Table 1
[0054] Table 2
[0055] Figure 1This study demonstrates the effect of expressing Δ9 desaturase genes from different sources in *Schizochytrium* on the palmitoleic acid (POA, C16:1) content in oils. The results showed that, compared to the control group without exogenous Δ9 desaturase, all tested Δ9 desaturase genes increased palmitoleic acid content to varying degrees. Among them, the Δ9 desaturase gene DSM9DE from *Desmodesmus* sp. showed the best effect, increasing the C16:1 content from 0.85% in the control group to 2.56%, an increase of approximately 201%. Furthermore, Δ9 desaturases from *Saccharomyces cerevisiae* and *M. alpina* also increased the C16:1 content to 1.42% and 1.76%, respectively, indicating that exogenous Δ9 desaturase can enhance the conversion efficiency of C16:0 to C16:1 in *Schizochytrium*, thereby achieving effective enrichment of palmitoleic acid. In summary, DSM9DE, as the optimal gene source, can be considered as a preferred target gene for subsequent promoter optimization and gene copy number optimization.
[0056] Figure 2This study demonstrates the effects of expressing Δ9 desaturase genes from different sources in *Schizochytrium* on the content of major fatty acid components in its oils. The results showed that under the same culture and fermentation conditions, the introduction of exogenous Δ9 desaturase genes from different sources altered the fatty acid composition of *Schizochytrium* oils to varying degrees, primarily manifested as an increase in palmitoleic acid (C16:1) content, a decrease in palmitic acid (C16:0) content, and a slight decrease in DHA content. In the control group HX-308 without the introduction of exogenous Δ9 desaturase genes, the contents of other fatty acids, C16:0, C16:1, and DHA were 26.53%, 27.32%, 0.85%, and 45.30%, respectively. When the Δ9 desaturase gene Sc-Δ9 from *Saccharomyces cerevisiae* was introduced, the C16:1 content in the oil increased to 1.42%, 0.57 percentage points higher than the control group; simultaneously, the C16:0 content decreased to 26.55%, the DHA content decreased to 44.10%, and the content of other fatty acids increased to 27.93%. When the Δ9 desaturase gene Ma-Δ9 from *M. alpina* was introduced, the C16:1 content further increased to 2.15%, 1.30 percentage points higher than the control group; the C16:0 content decreased to 25.18%, the DHA content decreased to 43.80%, and the content of other fatty acids increased to 28.87%. When the Δ9 desaturase gene DSM9DE from *Desmodesmus* sp. was introduced, the C16:1 content increased to 2.56%, the highest among all tested strains, 1.71 percentage points higher than the control group. Simultaneously, the C16:0 content further decreased to 24.18%, the DHA content decreased to 42.50%, and the contents of other fatty acids increased to 30.76%. These results indicate that Δ9 desaturase genes from different sources can promote the conversion of C16:0 to C16:1 in *Schizochytrium* to some extent, thereby increasing palmitoleic acid accumulation. Among them, DSM9DE from *Desmodesmus* sp. showed the most significant promoting effect, not only achieving the highest C16:1 content but also causing the most significant decrease in the substrate C16:0 content, indicating higher expression adaptability and substrate conversion efficiency in *Schizochytrium*. Therefore, DSM9DE can be considered a preferred Δ9 desaturase gene source for subsequent promoter optimization and gene copy number optimization.
[0057] Example 2: Effects of promoter optimization on DSM9DE expression and palmitoleic acid content Based on the optimal source of Δ9 desaturase gene (DSM9DE) obtained in Example 1, in order to further improve the expression level of this gene in Schizochytrium, this example optimizes the promoter driving DSM9DE expression and compares the changes in palmitoleic acid (POA, C16:1) content under different promoter driving conditions in order to screen out expression regulatory elements that are more conducive to palmitoleic acid enrichment.
[0058] The specific implementation method is as follows: The recombinant expression plasmid pP2520-DSM9DE, containing the optimal Δ9 desaturase gene DSM9DE, was used as the basic vector, in which the DSM9DE gene was initially driven by the basic promoter P2520. To optimize the promoter, primers were designed to amplify promoters P2902 (nucleotide sequence shown in SEQ ID No. 5) and P3626 (nucleotide sequence shown in SEQ ID No. 6). Novizan P520 high-fidelity enzyme (2 × Phanta Flash Master Mix (Dye Plus)) was used to prepare a 50 μL PCR system: 25 μL P520 enzyme, 20 μL pure water, 2 μL each of forward and reverse primers, 1 μL template (pZPK-P2902 and pZPK-P3626 plasmids, nucleotide sequences shown in SEQ ID No. 8 and SEQ ID No. 9), pre-denaturation at 98 ℃ for 30 s, denaturation at 98 ℃ for 10 s, annealing at 57 ℃ for 5 s, extension at 72 ℃ for 6 s, for 34 cycles, and a final extension at 72 ℃ for 1 min. After PCR processing, clean and recover the fragments. Using the UELandy DNA gel extraction kit, add 150 μL of DE-A to the PCR tube and mix well to prevent degradation of linear DNA at high temperatures. Transfer the mixture to a 2 ml preparation tube (provided in the kit), centrifuge at 12000 rcf for 1 min, and discard the filtrate. Add 500 μL of Buffer W1, centrifuge at 12000 rcf for 1 min, and discard the filtrate. Add 700 μL of Buffer W2, centrifuge at 12000 rcf for 1 min, and discard the filtrate. Perform one empty centrifuge, centrifuge at 12000 rcf for 1 min, and discard the filtrate. Transfer the adsorption column from the preparation tube to a clean 1.5 ml centrifuge tube, add 50 μL of preheated 65 °C pure water, centrifuge at 12000 rcf for 1 min to obtain purified P2902 and P3626 fragments. Introduce homologous arm sequences corresponding to the sequences flanking P2520 in the vector at the 5' end of the amplification primers. The specific primer sequences are shown in Table 3. Simultaneously, using a plasmid containing the P2520-DSM9DE expression framework as a template, the plasmid backbone was linearized and amplified. Specifically, a 50 μL PCR system was prepared using Novizan P520 high-fidelity enzyme (2 × Phanta Flash Master Mix (Dye Plus)): 25 μL P520 enzyme, 20 μL pure water, 2 μL each of forward and reverse primers, 1 μL template pP2520-DSM9DE, pre-denaturation at 98 ℃ for 30 s, denaturation at 98 ℃ for 10 s, annealing at 57 ℃ for 5 s, extension at 72 ℃ for 55 s, for 34 cycles, with a final extension at 72 ℃ for 1 min.After PCR processing, clean and recover the fragments. Using the UELandy DNA Gel Extraction Kit, add 150 μL of DE-A to the PCR tube and mix well to prevent linear DNA degradation at high temperatures. Transfer the mixture to a 2 ml preparation tube (provided in the kit), centrifuge at 12000 rcf for 1 min, and discard the filtrate. Add 500 μL of Buffer W1, centrifuge at 12000 rcf for 1 min, and discard the filtrate. Add 700 μL of Buffer W2, centrifuge at 12000 rcf for 1 min, and discard the filtrate. Perform one empty centrifuge, centrifuge at 12000 rcf for 1 min, and discard the filtrate. Transfer the adsorption column from the preparation tube to a clean 1.5 ml centrifuge tube, add 50 μL of preheated 65 °C pure water, and centrifuge at 12000 rcf for 1 min to remove the original basal promoter P2520. Subsequently, a homologous recombination method was used, specifically by preparing 10 μL systems: 5 μL of Novizan ClonExpress Ultra One Step Cloning Kit V2 (C116 enzyme), 1 μL of vector (purified linear P2520-DSM9DE backbone with P2520 removed), and 4 μL of fragments (purified P2902 and P3626). These systems were incubated at 37°C for 15 min to construct recombinant vectors for DSM9DE expression driven by different promoters: P2520-DSM9DE expression vector, P2902-DSM9DE expression vector, and P3626-DSM9DE expression vector. 10–20 μL of the recombinant plasmids, verified by PCR and sequencing, were added to competent Schizochytrium HX-308 cells, mixed thoroughly, and then transferred to a pre-cooled 0.2 cm electroporation cuvette. Electroporation was performed at 0.75 kV, 25 μF, and 200 Ω. Immediately after electroporation, 1 ml of antibiotic-free seed culture medium was added, and the culture was incubated at 28 ℃ and 150-220 rpm for 2 h. After incubation, the bacterial culture was plated on screening plates containing G418 antibiotic (500 mg / ml) and incubated at 28 ℃ for 3-5 days. Resistant single colonies were picked, purified, and identified by PCR to obtain engineered strains with correctly replaced promoters and containing the DSM9DE expression cassette. The engineered strains verified above and the control strain (i.e., the pP2520-DSM9DE strain driven by P2520) were cultured and fermented according to the aforementioned general fermentation method. After fermentation, the bacterial cells were collected and the total oil was extracted. The content of palmitoleic acid (C16:1) in the oil was analyzed by gas chromatography. The promoter optimization results are shown in Table 4. As can be seen from Table 4, the content of palmitoleic acid (C16:1) in the oil of Schizochytrium differed significantly when DSM9DE expression was driven by different promoters.When DSM9DE expression was driven by the basal promoter P2520, the C16:1 content in the engineered strain was 2.56% ± 0.31. After being driven by promoter P2902, the C16:1 content increased to 3.34% ± 0.15, an increase of 0.78 percentage points compared to the P2520 group, representing an increase of approximately 30.5%. After being driven by promoter P3626, the C16:1 content further increased to 4.13% ± 0.28, an increase of 1.57 percentage points compared to the P2520 group, representing an increase of approximately 61.3%, and an increase of 0.79 percentage points compared to the P2902 group, representing an increase of approximately 23.7%. This indicates that among the three promoters compared in this invention, P3626 has the most significant promoting effect on DSM9DE expression and palmitoleic acid accumulation.
[0059] Table 3
[0060] Table 4
[0061] Figure 3The effects of different promoter-driven DSM9DE expression in *Schizochytrium* on the content of palmitoleic acid (POA, C16:1) in oils were analyzed. To evaluate the influence of promoter strength on DSM9DE expression and palmitoleic acid accumulation, this invention did not arbitrarily select promoters. Instead, three representative promoters from the *Schizochytrium* expression system were chosen to construct a comparative system: P2520 as the basal expression promoter, P2902 as a promoter with higher expression capacity than P2520, and P3626 as a representative of strong endogenous promoters in *Schizochytrium*. These three promoters formed a gradient from basal to strong expression, which could be used to systematically compare the effects of DSM9DE on palmitoleic acid accumulation under different expression intensities, thus providing clear screening criteria and representativeness. Experimental results showed that, under the same Δ9 desaturase gene source conditions, promoter selection significantly affected the enrichment level of palmitoleic acid. When the engineered strain expressing DSM9DE driven by the basal promoter P2520 served as the control group, the C16:1 content in its oil was 2.56% ± 0.31. When DSM9DE expression was driven by the promoter P2902, the C16:1 content in the engineered strain's oil increased to 3.34% ± 0.15, an increase of approximately 30.5% compared to the control group. When DSM9DE expression was driven by the endogenous strong promoter P3626 of Schizochytrium, the C16:1 content further increased to 4.13% ± 0.28, an increase of approximately 61.3% compared to the control group and approximately 23.7% compared to the P2902-driven group. These results indicate that with the enhancement of the expression intensity of the selected promoter, the ability of DSM9DE to convert substrate C16:0 to C16:1 gradually increases, thereby promoting the accumulation of palmitoleic acid in the oil of Schizochytrium. Among them, P2902 showed a better promoting effect compared to the basic promoter P2520, while P3626 showed the most significant enhancing effect, indicating that promoter optimization is an effective means to improve DSM9DE expression levels and achieve palmitoleic acid enrichment. The purpose of this invention is to screen for preferred promoters suitable for DSM9DE expression and capable of effectively increasing palmitoleic acid content. Therefore, selecting representative promoters of different strengths for comparison is sufficient to achieve this purpose, and it is not necessary to exhaust all possible promoters. According to the comparison results of the three promoters detected in the embodiments of this invention, P3626 drove DSM9DE expression with the highest palmitoleic acid content. Therefore, P3626 can be determined as a preferred promoter within the screening scope of this invention and used for subsequent target gene copy number optimization to further amplify the gene dosage effect and increase palmitoleic acid content based on higher expression levels.
[0062] Example 3: Effect of target gene copy number optimization on palmitoleic acid content The specific implementation method is as follows: First, based on the P3626-DSM9DE strain obtained in Example 2, which expresses DSM9DE driven by the endogenous strong promoter P3626 of Schizochytrium, primers were designed to amplify the DSM9DE expression framework and the resistance selection marker fragment. The DSM9DE expression framework includes the promoter P3626, the DSM9DE coding sequence, the terminator sequence, and the homologous recombination fragment for genome integration, and its nucleotide sequence is shown in SEQ ID No. 10. The resistance selection marker includes the G418 resistance selection marker and the Zeocin resistance selection marker, and their nucleotide sequences are shown in SEQ ID Nos. 11 and 12. The primers for each fragment of the expression framework were fitted with homologous sequences corresponding to the insertion sites on both sides of the vector at their 5' ends, as shown in Table 5. Simultaneously, the original vector backbone was linearized by designing and retaining only one HindIII restriction site after the DSM9DE gene fragment in the P3626-DSM9DE plasmid. A 50 μL system was prepared: 2 μL HindIII enzyme, 5 μL cut-one-buffer, 1 μL template P3626-DSM9DE, 15 μL pure water, and incubated at 37 ℃ for 3 h. Subsequently, gel extraction was performed using the UELandy DNA gel extraction kit. The agarose gel containing the target DNA was cut under UV light, the surface liquid was blotted dry with a paper towel, and the gel was chopped and added to a 2 ml centrifuge tube. 400 μL of DE-A was added to cover the gel, and the mixture was thoroughly mixed. The mixture was then heated in a 75 ℃ metal bath, with the centrifuge tube being removed and inverted every 2-3 minutes to mix until the gel block was completely melted. Add 200 μL DE-B and mix thoroughly to form a homogeneous yellow solution. Transfer the mixture to a 2 ml preparation tube, centrifuge at 12000 rcf for 1 min, and discard the filtrate. Add 500 μL Buffer W1, centrifuge at 12000 rcf for 1 min, and discard the filtrate. Add 700 μL Buffer W2, centrifuge at 12000 rcf for 1 min, and discard the filtrate. Perform one empty centrifuge, centrifuge at 12000 rcf for 1 min, and discard the filtrate. Transfer the adsorption column from the preparation tube to a clean 1.5 ml centrifuge tube, add 50 μL of preheated pure water to 65 °C, and centrifuge at 12000 rcf for 1 min to obtain the purified linearized plasmid backbone P3626-DSM9DE.Subsequently, a homologous recombination method was used, in which 10 μL systems were prepared: 5 μL of Novizan ClonExpress Ultra OneStep Cloning Kit V2 (C116 enzyme), 1 μL of vector (purified linear P3626-DSM9DE backbone with P2520 removed), and 4 μL of fragments (DSM9DE fragments of different copy numbers). The systems were incubated at 37°C for 15 min, and the DSM9DE expression framework and different antibiotic selection markers were assembled into the vector backbone to construct recombinant expression vectors for genome integration. The correctness of these vectors was verified by PCR and sequencing.
[0063] The DSM9DE recombinant expression vector containing the G418 resistance selection marker was linearized and transformed into Schizochytrium HX-308 competent cells. Specifically, 10-20 μL of the validated linearized recombinant vector was added to Schizochytrium competent cells, mixed well, and transferred to a pre-cooled 0.2 cm electroporation cuvette. Electroporation was performed at 0.75 kV, 25 μF, and 200 Ω. Immediately after electroporation, 1 ml of antibiotic-free seed medium was added, and the cells were incubated at 28 ℃ and 150-220 rpm for 2 h. The recovered bacterial culture was plated on selection plates containing G418 (500 mg / mL) and incubated at 28 ℃ for 3-5 days. Resistant single colonies were picked and purified, and genomic PCR was used to identify whether the DSM9DE expression framework and the G418 resistance marker had been integrated into the Schizochytrium genome. Further qPCR was used to detect the DSM9DE integration copy number in positive transformants, and single-copy integrated DSM9DE strains were screened. Based on this, using the aforementioned DSM9DE single-copy integrated strain as the recipient strain, the DSM9DE recombinant expression vector containing the Zeocin resistance selection marker was linearized again and introduced into Schizochytrium HX-308 competent cells under the same electroporation conditions described above. After recovery culture, the bacterial culture was plated on selection plates containing both G418 and Zeocin (G418 concentration of 500 mg / mL and Zeocin concentration of 300 mg / mL) for screening, obtaining transformants that further integrated the DSM9DE expression framework on top of the original integration. Since the number of integration events of the DSM9DE expression framework in the recipient strain genome may differ during the second round of transformation, the obtained transformants may exhibit different DSM9DE integrated copy numbers.
[0064] After purification, resistant single colonies obtained from double antibiotic screening were used to verify the integration of the exogenous expression framework using genomic PCR, and qPCR was used to quantify the DSM9DE copy number, thereby distinguishing and screening for engineered strains with 2 and 3 copies of DSM9DE. Further, transformants with higher integration levels could be enriched and screened by increasing the antibiotic concentration in the screening medium; however, the final determination of engineered strains with different copy numbers was based on qPCR results. After 3-4 generations of continuous subculturing, the selected strains with different copy numbers were again verified by PCR and qPCR to confirm the genetic stability of the exogenous gene integration. Finally, recombinant engineered strains with different DSM9DE integration copy numbers and genetic stability were obtained. The strains constructed and used for comparative analysis in this embodiment include: the starting strain HX-308 without the introduction of the exogenous gene DSM9DE, serving as the control group; an engineered strain with 1 copy of the DSM9DE expression framework driven by P3626, named P3626-DSM9DE; an engineered strain with 2 copies of the DSM9DE expression framework driven by P3626, named P3626-DSM9DE-2; and an engineered strain with 3 copies of the DSM9DE expression framework driven by P3626, named P3626-DSM9DE-3. Among them, the single-copy strain P3626-DSM9DE, the double-copy strain P3626-DSM9DE-2, and the triple-copy strain P3626-DSM9DE-3 all introduced the exogenous Δ9 desaturase gene DSM9DE from the same source, and were all driven by the same promoter P3626. The only difference between the three is the number of DSM9DE copies integrated into the Schizochytrium genome.
[0065] The control strain HX-308, the single-copy strain P3626-DSM9DE, the double-copy strain P3626-DSM9DE-2, and the triple-copy strain P3626-DSM9DE-3 were cultured and fermented according to the aforementioned general fermentation method. Specifically, each strain was inoculated into seed culture medium and cultured at 28 ℃ for 24 h to obtain primary seeds. 10% of the primary seeds were inoculated into fresh seed culture medium and cultured at 28 ℃ for another 24 h to obtain secondary seeds. 10% of the secondary seeds were then inoculated into seed culture medium and cultured at 28 ℃ for another 24 h to obtain the fermentation strain. A fermentation strain with an OD600 value of 8-10 was inoculated into the fermentation culture medium at 1% of the fermentation culture medium volume and fermented at 25 ℃ and 170 rpm for 120 h. After fermentation, the bacterial cells were collected and the total oil was extracted. Gas chromatography was used to analyze the content of palmitoleic acid (C16:1) and major fatty acid components in the oil, thereby evaluating the effect of increased DSM9DE copy number on palmitoleic acid accumulation. Table 6 shows the C16:1 data results after copy number optimization for each strain. As can be seen from Table 6, in the starting strain HX-308 without the introduction of the exogenous gene, the C16:1 content was only 0.85±0.12%. After introducing the DSM9DE expression framework, the C16:1 content of each engineered strain significantly increased, indicating that the expression of exogenous DSM9DE can effectively promote the accumulation of palmitoleic acid in Schizochytrium. Among them, the C16:1 content of the single-copy strain P3626-DSM9DE was 4.13±0.28%, approximately 4.86 times that of the starting strain, indicating that the introduction of only one copy of the target gene can significantly increase the level of palmitoleic acid synthesis. Furthermore, when the DSM9DE integration copy number increased to 2 copies, the C16:1 content of the engineered strain P3626-DSM9DE-2 increased to 6.89±0.42%, approximately 8.11 times that of the starting strain, and was 66.8% higher than the single-copy strain, reaching the highest level among all groups. This indicates that under the gene source and expression regulation conditions adopted in this invention, increasing the DSM9DE copy number from 1 copy to 2 copies can further enhance the conversion efficiency from C16:0 to C16:1, thereby significantly increasing the accumulation level of palmitoleic acid. When the DSM9DE copy number continued to increase to 3 copies, the C16:1 content of the engineered strain P3626-DSM9DE-3 was 5.57±0.31%, which, although still significantly higher than the starting strain (approximately 6.55 times), was 19.2% lower than the two-copy strain, and did not show a further increasing trend. These results indicate that the relationship between the increase in DSM9DE copy number and palmitoleic acid accumulation is not a simple linear one, and that 2 copies is a more suitable level of integration under the construction conditions of this invention.In summary, the introduction of DSM9DE can significantly increase the C16:1 content in the oil of Schizochytrium, and the double-copy strain P3626-DSM9DE-2 showed the best product accumulation effect, which was significantly better than the single-copy and triple-copy strains. Therefore, it was identified as the preferred engineered strain for subsequent fermentation production and application research, and named P3D2BG.
[0066] Table 5
[0067] Table 6
[0068] Figure 4The effects of DSM9DE expression at different copy numbers on palmitoleic acid accumulation in the oil of Schizochytrium were demonstrated. Experimental results showed that in the control group HX-308 without the introduction of the exogenous gene DSM9DE, the C16:1 content was 0.85% ± 0.12. When one copy of the DSM9DE expression framework was introduced, the C16:1 content in the single-copy engineered strain P3626-DSM9DE increased to 4.13% ± 0.28, an increase of 3.28 percentage points compared to the control group, representing an increase of approximately 385.9%. When the DSM9DE copy number increased to two copies, the C16:1 content in the double-copy engineered strain P3626-DSM9DE-2 further increased to 6.89% ± 0.42, an increase of 2.76 percentage points compared to the single-copy strain, representing an increase of approximately 66.8%, and an increase of 6.04 percentage points compared to the control group, representing an increase of approximately 710.6%. When the DSM9DE copy number increased to three copies, the C16:1 content in the triple-copy engineered strain P3626-DSM9DE-3 was 5.57% ± The C16:1 content was 0.31, which, although 4.72 percentage points higher than the control group (an increase of approximately 555.3%), was 1.32 percentage points lower than the double-copy strain (a decrease of approximately 19.2%). This indicates that among the engineered strains with different copy numbers constructed in this example, the double-copy strain P3626-DSM9DE-2 exhibited the highest level of palmitoleic acid accumulation. Its C16:1 content was not only significantly higher than the starting strain HX-308, but also showed better performance than both single-copy and triple-copy strains. Therefore, for the convenience of subsequent research and application, the double-copy engineered strain P3626-DSM9DE-2 was further named P3D2BG. These results demonstrate that, based on the optimal Δ9 desaturase gene source DSM9DE and the preferred promoter P3626, increasing the target gene copy number can effectively enhance the expression dose of DSM9DE and improve the conversion efficiency from C16:0 to C16:1, thereby promoting the accumulation of palmitoleic acid in the oil of Schizochytrium. It is noteworthy that among the strains constructed with different copy numbers in this embodiment, the two-copy strain had the highest palmitoleic acid content, while the three-copy strain did not show a further increase. This indicates that the relationship between the target gene copy number and metabolite accumulation is not a simple linear one, and an appropriate copy number is more conducive to achieving efficient enrichment of palmitoleic acid. Therefore, the two-copy engineered strain P3D2BG can be considered as a preferred engineered strain for subsequent fermentation production and application research.
[0069] Comparative Example 4: Comparison of palmitic acid content between the starting strain HX-308 and the highest-yielding engineered strain P3D2BG in the embodiments of the present invention. The relevant culture and detection methods are exactly the same as those in Example 3. The only difference is that Example 3 focuses on the effect of target gene copy number optimization on palmitic acid content, while this comparative example only compares the palmitic acid content of the original starting strain HX-308 and the highest-yielding engineered strain P3D2BG in this invention, in order to more intuitively demonstrate the optimization effect that this invention can achieve.
[0070] Figure 5 , Figure 6 Gas chromatograms (GC) of the starting strain *Schizochytrium* sp. HX-308 and the high-palmitoic acid-producing engineered strain P3D2BG constructed in this invention are shown, with the corresponding peaks for palmitoic acid (POA, C16:1) labeled. Experimental results show that, compared to the starting strain HX-308, the chromatographic peaks near the retention time corresponding to POA in the engineered strain P3D2BG are significantly enhanced, indicating a significant increase in the palmitoic acid content in its oil. Combined with the fatty acid composition analysis results in the examples, the C16:1 content in the oil of the starting strain HX-308 is 0.85% ± 0.12, while the C16:1 content in the oil of the high-yield engineered strain P3D2BG increases to 6.89% ± 0.42, an increase of 6.04 percentage points compared to the starting strain, representing an increase of approximately 710.6%. The comparison of the spectra further shows that, while maintaining the overall characteristics of the main fatty acid components, P3D2BG significantly increased the area of the target peak of POA. This indicates that by introducing the optimal Δ9 desaturase gene DSM9DE, using the preferred promoter P3626, and optimizing the copy number, the conversion ability of C16:0 to C16:1 in Schizochytrium was significantly enhanced, thereby achieving efficient enrichment of palmitoleic acid.
[0071] Figure 7The PCR images of fragments from the original strain HX-308 and the high-palmitoic acid-producing engineered strain P3D2BG are shown. Primers were designed on the P3D2BG plasmid map, and the specific primers are listed in Table 7. PCR was used to verify the successful integration of promoter P3626, two copies of the DSM9DE gene, G418, and bleomycin / zeocin resistance. The specific procedure was as follows: Prepare a 20 μL system: 10 μL P222 enzyme, 8 μL pure water, 0.8 μL each of the upper and lower primers, and 0.4 μL template (growing spots were picked up with a sterile toothpick from a selection plate containing G418 and bleomycin / zeocin resistance and directly inserted into the prepared PCR system). After preparing the system, it was placed in a PCR instrument, and the program was set as follows: pre-denaturation 98 ℃ for 10 min, denaturation 95 ℃ for 15 s, annealing 57 ℃ for 15 s, extension 72 ℃ for 1 min, 33 cycles, and final extension 72 ℃ for 5 min. After PCR, agarose gel electrophoresis was performed at 180V for 10 minutes. The images were then observed and photographed under a 300nm wavelength gel electrophoresis apparatus. It can be seen that the fragment could not be amplified in the original HX-308 strain, while the fragment of the correct size was successfully amplified in P3D2BG. This indicates that the relevant genes (promoter P3626, two copies of the DSM9DE gene, G418, and bleomycin resistance) were successfully integrated into the P3D2BG strain.
[0072] Table 7
[0073] This invention employs a progressive combination strategy of "gene source screening - promoter optimization - gene copy number optimization" to establish and continuously enhance the C16:0 to C16:1 conversion ability in Schizochytrium fungi, thereby achieving efficient enrichment of palmitoleic acid. This provides a reproducible and scalable technical path for constructing high-yield palmitoleic acid engineered Schizochytrium fungi.
[0074] The sequence used in this invention is as follows: Sc-Δ9 gene (SEQ ID No. 1): Ma-Δ9 gene (SEQ ID No. 2): DSM9DE gene (SEQ ID No. 3): P2520 promoter (SEQ ID No. 4): P3626 promoter (SEQ ID No. 6): pZPK-P2520 plasmid sequence (SEQ ID No. 7): pZPK-P2902 plasmid sequence (SEQ ID No. 8): pZPK-P3626 plasmid sequence (SEQ ID No. 9): P3626-DSM9DE plasmid sequence (SEQ ID No. 10): G418 gene sequence (SEQ ID No.11): TCAGAAGAACTCGTCAAGAAGGCGATAGAAGGCGATGCGCTGCGAATCGGGAGCGGCGATACCGTAAAGCACGAGGAAGCGGTCAGCCCATTCGCCGCCAAGCTCTTCAGCAATATCACGGGTAGCCAACGCTATGTCCTGATAGCGGTCCGCCACACCCAGCCGGCCACAGTCGATGAATCCAGAAAAGCGGCCATTTTCCACCATGATATTCGGCAAGCAGGCATCGCCATGGGTCACGACGAGATCCTCGCCGTCGGGCATGCGCGCCTTGAGCCTGGCGAACAGTTCGGCTGGCGCGAGCCCCTGATGCTCTTCGTCCAGATCATCCTGATCGACAAGACCGGCTTCCATCCGAGTACGTGCTCGCTCGATGCGATGTTTCGCTTGGTGGTCGAATGGGCAGGTAGCCGGATCAAGCGTATGCAGCCGCCGCATTGCATCAGCCATGATGGATACTTTCTCGGCAGGAGCAAGGTGAGATGACAGGAGATCCTGCCCCGGCACTTCGCCCAATAGCAGCCAGTCCCTTCCCGCTTCAGTGACAACGTCGAGCACAGCTGCGCAAGGAACGCCCGTCGTGGCCAGCCACGATAGCCGCGCTGCCTCGTCCTGCAGTTCATTCAGGGCACCGGACAGGTCGGTCTTGACAAAAAGAACCGGGCGCCCCTGCGCTGACAGCCGGAACACGGCGGCATCAGAGCAGCCGATTGTCTGTTGTGCCCAGTCATAGCCGAATAGCCTCTCCACCCAAGCGGCCGGAGAACCTGCGTGCAATCCATCTTGTTCAATCAT Bleomycin Zeocin gene sequence (SEQ ID No.12): TTAGGGGCAGGGCATGCTCATGTAGAGCGCCTGCTCGCCGTCCGAGGCGGTGCCGTCGTACAGGGCGGTGTCCAGGCCGCAGAGGGTGAACCCCATCCGCCGGTACGCGTGGATCGCCGGTGCGTTGACGTTGGTGACCTCCA GCCAGAGGTGCCCGGCGCCCCGCTCGCGGGCGAACTCCGTCGCGAGCCCCATCAACGCGCGCCCGACCCCGTGCCCCCGGTGCTCCGGGGCGACCTCGATGTCCTCGACGGTCAGCCGGCGGTTCCAGCCGGAGTACGAGACG ACCACGAAGCCCGCCAGGTCGCCGTCGTCCCCGTACGCGACGAACGTCCGGGAGTCCGGGTCGCCGTCCTCCCCGTCGTCCGATTCGTCGTCCGATTCGTCGTCGGGGAACACCTTGGTCAGGGGCGGGTCCACCGGCACCTC CCGCAGGGTGAAGCCGTCCCCGGTGGCGGTGACGCGGAAGACGGTGTCGGTGGTGAAGGACCCATCCAGTGCCTCGATGGCCTCGGCGTCCCCCGGGACACTGGTGCGGTACCGGTAAGCCGTGTCGTCAAGAGTGGTACCCAT Although embodiments of the invention have been disclosed for illustrative purposes, those skilled in the art will understand that various substitutions, variations, and modifications are possible without departing from the spirit and scope of the invention and the appended claims. Therefore, the scope of the invention is not limited to the contents disclosed in the embodiments.
Claims
1. A high-yield engineered schistocytrium of palmitoleic acid, characterized in that: The engineered Schizochytrium was obtained by introducing and expressing a heterologous Δ9 desaturase gene in Schizochytrium through genetic engineering, and by screening the source of the heterologous Δ9 desaturase gene, optimizing the promoter, and optimizing the target gene copy number to enhance the conversion ability from C16:0 to C16:1, thereby significantly increasing the palmitoleic acid content in the oil of Schizochytrium. The heterologous Δ9 desaturase gene is derived from Scenedesmus (…). Desmodesmus sp. The gene DSM9DE, whose nucleotide sequence is shown in SEQ ID No. 3; The schizochytrium is Schizochytrium sp. HX-308.
2. The high-yield palmitole acid engineered schistocytrium according to claim 1, characterized in that: The promoter optimization includes placing the heterologous Δ9 desaturase gene under the regulation of the Schizochytrium endogenous promoter to improve the expression intensity of the target gene in Schizochytrium. The endogenous promoter is the strong endogenous promoter P3626 of Schizochytrium, and its nucleotide sequence is shown in SEQ ID No.
6.
3. The high-yield palmitole acid engineered schistocytrium according to any one of claims 1 to 2, characterized in that: The target gene copy number optimization includes: integrating 2-3 copies of the heterologous Δ9 desaturase gene into the Schizochytrium genome to enhance the gene dosage effect and further increase palmitoleic acid content.
4. The high-yield palmitole acid engineered schistocytrium according to claim 3, characterized in that: Integration of 2-3 copies is achieved through resistance selection markers, including the G418 resistance gene and the bleomycin (Zeocin) resistance gene.
5. The method for constructing a high-yield palmitole acid engineered schistocytotrium as described in any one of claims 1 to 4, characterized in that: Includes the following steps: Using the genome of *Schizochytrium* HX-308 as a template, the endogenous strong promoter P3626 was amplified and sequentially linked with the artificially synthesized heterologous Δ9 desaturase gene DSM9DE from *Scenedesmus* and a terminator element to construct a target gene expression cassette driven by the strong promoter. This expression cassette was cloned into transformation plasmids containing the G418 resistance gene and the bleomycin (Zeocin) resistance gene, respectively, to construct two recombinant expression vectors with different selection markers. These vectors were used to transform *Schizochytrium* competent cells, obtaining positive transformants with preliminary integration of exogenous DSM9DE. Subsequently, the transformants were continuously screened by gradually increasing the antibiotic selection pressure, and the integration copy number of the target gene DSM9DE in the genome was detected by qPCR. Simultaneously, its genetic stability was verified through 3–4 consecutive passages. Finally, a recombinant engineered strain with 2–3 DSM9DE integration copies and stable genetic traits was obtained, which is the high-palmitoic acid-producing engineered *Schizochytrium*.
6. The construction method according to claim 5, characterized in that: The specific construction method of the positive transformant with preliminary integration of exogenous DSM9DE includes: adding 10–20 μL of recombinant expression vector to 100 μL of Schizochytrium competent cells, mixing well, and then adding to a pre-cooled 0.2 cm electroporation cuvette, and performing electroporation under the conditions of 0.75 kV, 25 μF, and 200 Ω; immediately after electroporation, adding 1 ml of antibiotic-free seed culture medium, and reviving and culturing at 28 ℃ and 150–220 rpm for 2 h; spreading the reviving bacterial culture on a selection plate containing G418 and bleomycin Zeocin, culturing at 28 ℃ in the dark for 3–5 days, picking resistant colonies, and identifying whether the resistance marker gene and the target gene DSM9DE were successfully integrated by genomic PCR to obtain the positive transformant with preliminary integration of exogenous DSM9DE; The specific formulation of the screening plate is as follows: 10 g / L peptone, 5 g / L yeast extract, 50 g / L glucose, 20 g / L sea salt, 20 g / L agar, and water as the solvent.
7. The application of the high palmitole acid-producing engineered Schizochytrium as described in any one of claims 1 to 4 in the fermentation production of palmitole acid.
8. A method for producing palmitic acid by fermentation using the high-yield palmitic acid engineered Schizochytrium as described in any one of claims 1 to 4, characterized in that: Includes the following steps: After the engineered Schizochytrium is activated by inoculating a seed culture medium, a fermentation strain is obtained. The fermentation strain is then inoculated into a fermentation culture medium for fermentation. After fermentation, the cells are collected and the oil is extracted to obtain palmitoleic acid.
9. The method according to claim 8, characterized in that: The specific steps are as follows: High-yield palmitole acid engineered Schizochytrium was inoculated into seed culture medium and cultured at 28 ℃ for 24 h to obtain primary seed. Primary seed was then inoculated into seed culture medium at an inoculation rate of 10% of the seed culture medium volume and cultured again at 28 ℃ for 24 h to obtain secondary seed. Secondary seed was then inoculated into seed culture medium at an inoculation rate of 10% of the seed culture medium volume and cultured again at 28 ℃ for 24 h. This activation process yielded the fermentation strain. Fermentation strain with an OD600 value of 8-10 was inoculated into fermentation medium at an inoculation rate of 0.8%–1.5% and fermented at 25 ℃ and a rotation speed of 170 rpm for 120 h. Alternatively, the seed culture medium may consist of: 45 g / L glucose, 2 g / L yeast extract, 15 g / L sodium glutamate, 4 g / L MgCl2·7H2O, 15 g / L Na2SO4, 1 g / L KCl, 1 g / L NaCl, 5 g / L MgSO4·7H2O, and 3 g / L KH2PO4, with water as the solvent. Alternatively, the fermentation medium consists of: 90 g / L glucose, 4 g / L yeast extract, 15 g / L sodium glutamate, 4 g / L MgCl2·7H2O, 15 g / L Na2SO4, 1 g / L KCl, 1 g / L NaCl, 5 g / L MgSO4·7H2O, 3 g / L KH2PO4 and 4 g / L (NH4)2SO4, with water as the solvent; Alternatively, the fermentation strain can be inoculated into the fermentation medium at an inoculation rate of 1% for fermentation culture.