Primer pair and method for identifying cultured and wild populations of tangut based on SNP (Single Nucleotide Polymorphism) marker and application of primer pair and method
By designing primer pairs and detection techniques based on SNP markers, the accuracy and efficiency issues of identification of farmed and wild populations of Tang fish were solved, achieving efficient and low-cost identification of population origin, and the primer pairs have wide applicability.
Patent Information
- Application Number
- CN202610036717.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-13
- Publication Date
- 2026-05-12
AI Technical Summary
Existing technologies are insufficient to accurately distinguish between farmed and wild populations of Tang fish. Traditional morphological methods are time-consuming, labor-intensive, and unreliable. RAPD and fAFLP technologies require prior screening and amplification of multiple primer pairs, which cannot meet current technological needs.
Primer pairs based on SNP markers were designed, and the polymorphism of the SNP molecular marker site located at position 996 from the 5' end of SEQ ID NO: 1 was A/G. The primer pairs and kits were developed to identify farmed and wild populations of Tang fish using Northern blotting, PCR, gene chip method and nucleic acid sequencing.
It achieves efficient and accurate identification of the germplasm source of Tang fish populations, with the advantages of low cost and batch processing. The primer pairs are also effective in the identification of other farmed or wild populations besides the primer design reference population, proving their universality.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of population genetics and molecular biology, specifically relating to primer pairs, methods, and applications for identifying farmed and wild populations of Tang fish based on SNP markers. Background Technology
[0002] Tang fish ( Tanichthys albonubes The white cloud golden threadfin (Triplophysa hainanensis), commonly known as the white cloud golden threadfin, belongs to the order Cypriniformes, family Cyprinidae, and genus Triplophysa. It is a rare aquatic animal endemic to China, and its wild population is listed as a Class II protected animal in the "National Key Protected Wild Animals List." Based on genetic structure differentiation and diversity, as well as the source, intensity, and directionality of gene flow, the white cloudfin is divided into wild and farmed populations. The germplasm origin of these populations can be identified using techniques such as SSR, SNP, and mitochondrial COI sequencing. Geographically, wild white cloudfin populations mainly include the Baiyunshan population, Dongxing population, Huidong population, and Hainan population, primarily distributed in Guangdong, Guangxi, and Hainan. Due to its ornamental and economic value, artificial breeding has led to the development of farmed strains such as the yellow-spotted white cloudfin, the large-sailed white cloudfin, and the beautiful white cloudfin.
[0003] Single nucleotide polymorphisms (SNPs) refer to DNA sequence polymorphisms caused by a single nucleotide variation in the genome. They are among the most widely distributed and genetically stable molecular markers. The mitochondrial genome of the Tang fish follows strict maternal inheritance and exhibits no recombination, contains multiple-copy SNP sites, and has a moderate evolutionary rate. Therefore, compared to morphological differentiation, SNP marker technology, as a third-generation molecular marker technology, offers advantages in primer design for distinguishing farmed and wild populations of Tang fish, including high accuracy and the ability to perform large-scale testing.
[0004] However, current literature on the identification of the germplasm origin of the Tang fish population can be broadly divided into two categories: 1) Morphologically, geometric morphology was used to analyze 8 wild populations and 2 cultured populations, and the results showed that eye diameter and head shape were the core variation points, with a discrimination accuracy of 97.6%. 2) In terms of molecular genetics, RAPD technology, fAFLP technology, and mitochondrial fragments (such as Cytb gene / D-loop) and nuclear genes and microsatellite markers are mainly used to compare the genetic diversity of farmed and wild populations. None of them mention or develop primer pairs, methods and applications based on SNP markers to accurately distinguish between farmed and wild populations of Chinese sturgeon.
[0005] In summary, research indicates that there are cryptogams in the genus *Tangus*. Traditional morphological methods rely on the professional knowledge and experience of the identification personnel, which is time-consuming, labor-intensive, and has low reliability. Furthermore, RAPD and fAFLP technologies require preliminary screening and amplification of multiple primer pairs, and have significant limitations, failing to meet current technological requirements.
[0006] To date, no patents have been reported related to the identification of the germplasm origin of the Tang fish population. Summary of the Invention
[0007] The first aspect of this invention aims to provide SNP molecular markers for identifying farmed and wild populations of Tang fish.
[0008] The second objective of this invention is to provide the application of substances that detect the SNP molecular markers of the first aspect of this invention in the preparation of products for identifying farmed and wild populations of Tang fish.
[0009] The third aspect of this invention is to provide a product.
[0010] A fourth aspect of the present invention is to provide a reagent or kit.
[0011] The fifth aspect of this invention aims to provide a method for identifying and screening farmed and wild populations of *Tang fish*.
[0012] To achieve the above-mentioned objectives of this invention, the technical solution adopted by this invention is as follows: In a first aspect, the present invention provides an SNP molecular marker for identifying farmed and wild populations of *Tangus chinensis*, wherein the SNP molecular marker is located at position 996 from the 5' end of SEQ ID NO: 1 and has a polymorphism of A / G.
[0013] In some embodiments of the present invention, the sequence of the SNP molecular marker is shown in SEQ ID NO: 1: ATGGCAAGCCTACGAAAAACTCACCCACTAATAAAAATCGCTAATGATGCACTAGTTGATTTACCAACACCATCCAATATCTCAGCATGATGAAACTTTGGATCCCTTTTAGGATTATGTTTAATCACCCAAATCTTAACTGGGCTATTTTTAGCAATACACTATACCTCAGACATTTCAACTGCATTTTCATCAGTCGCCCACATTTGCCGAGACGTAAACTATGGCTGACTTATTCGTAATTTGCACGCTAACGGAGCATCATTCTTCTTTATCTGCATTTATATGCACATTGCCCGAGGCTTATATTACGGCTCATACCTTTATAAAGAAACCTGAAATATTGGAGTTGTTCTTCTTCTCTTAGTTATAATAACAGCCTTTGTGGGTTACGTTCTTCCATGAGGACAAATATCTTTTTGAGGCGCCACAGTAATTACTAACCTCTTATCAGCTGTTCCCTACATAGGTGATATACTAGTCCAATGAATTTGAGGTGGATTTTCAGTAGATAACGCAACACTAACACGATTCTTTGCATTCCACTTCTTATTTCCCTTTGTTATCGCCGCCGCAACCCTCCTTCACCTTTTATTTCTTCACGAGACAGGATCCAACAACCCGGCCGGATTGAACTCTGACGCAGATAAAATTTCTTTCCACCCCTATTTTTCTTACAAGGACCTTCTTGGATTTGTAATAATACTATTAGCCTTAACATCTCTAGCACTATTTTCTCCTAACCTATTAGGGGACTCAGAAAATTTTATTCCGGCAAACCCACTAGTTACTCCACCACATATTAAACCAGAATGATATTTCTTATTTGCTTACGCAATTTTACGATCAATTCCTAATAAATTAGGAGGAGTTCTTGCACTACTATTTTCTATTTTAGTCCTAATAGTTGTACCAATTTTACACACCTCAAAACAACGGGGATTAACATTTCGTCCTATTACCCAATTTCTATTTTGAACTTTAGTAGCAGATAT [A / G] GCCATCTTAACATGAATTGGAGGAATACCCGTAGAACACCCATATATTATTATTGGCCAAATCGCATCAGTATTATACTTTGCACTCTTTCTCATTCTTACCCCCCTAGCAGGATGATTAGAGAACAAAGCATTAAAATGAGCCT (“[ ]” indicates the location of the SNP molecular marker). The SNP site is located at position 996 from the 5' end, and its polymorphism is A / G.
[0014] A second aspect of the present invention provides the use of substances that detect the SNP molecular markers described in the first aspect of the present invention in the preparation of products for identifying farmed and wild populations of Tang fish.
[0015] In some embodiments of the present invention, the substance comprises a substance for use in one or more detection techniques or methods selected from the group consisting of: Northern blotting, PCR, gene chip method, and nucleic acid sequencing.
[0016] A third aspect of the invention provides a product comprising a substance for detecting the SNP markers described in the first aspect of the invention.
[0017] In some embodiments of the present invention, the substance comprises a substance for use in one or more detection techniques or methods selected from the group consisting of: Northern blotting, PCR, gene chip method, and nucleic acid sequencing.
[0018] In some embodiments of the present invention, the product comprises at least one of a reagent, a reagent kit, a test strip, a chip, or a system.
[0019] In some embodiments of the present invention, the product comprises primer pairs for amplifying SNP molecular markers of the first aspect of the present invention.
[0020] In some embodiments of the present invention, the nucleotide sequence of the upstream primer of the primer pair is shown in SEQ ID NO: 3.
[0021] In some embodiments of the present invention, the nucleotide sequences of the downstream primers of the primer pair are shown in SEQ ID NO: 2 and 4.
[0022] Specifically, primer-related information is shown in Table 1.
[0023] Table 1
[0024] A fourth aspect of the present invention provides a reagent or kit comprising the primer pairs described in the third aspect of the present invention.
[0025] In some embodiments of the present invention, the kit further comprises DNA polymerase, dNTPs, PCR buffer, and Mg. 2+ At least one of the following, the PCR buffer includes 2X Hot Start PCR Master Mix and other related reagents.
[0026] A fifth aspect of the present invention provides a method for identifying and screening farmed and wild populations of *Tangus chinensis*, comprising the following steps: DNA was extracted from the fish and detected using the product described in the third aspect of this invention or the reagent or kit described in the fourth aspect of this invention to obtain amplified products and analyze the results.
[0027] In some embodiments of the present invention, the test sample with genotype G is a wild Tang fish; the test sample with genotype A is a farmed Tang fish.
[0028] Specifically, the above steps include: (1) Extracting DNA from the fin tissues of farmed and wild individuals of the Tang fish; (2) Using the DNA extracted from the Tang fish in step (1) as a template, PCR amplification was performed using primer pairs; (3) The PCR products amplified in step (2) were electrophoresed using agarose gel electrophoresis to distinguish between farmed and wild populations based on the electrophoretic bands.
[0029] in: The PCR reaction system in step (2) includes: 1µL of 100ng / µL DNA template, 25µL of 2X Hot Start PCR MasterMix, 2µL each of 10µmol / µL forward primer F and reverse primer R, and 20µL of ddH2O, for a total of 50µL.
[0030] The conditions required for the PCR reaction in step (2) are: 95℃ pre-deformation for 10 min, 94℃ denaturation for 30 sec, 56℃ annealing for 30 sec, 72℃ extension for 30 sec, cycled 35 times, then extended at 72℃ for 10 min, and finally held at 4℃.
[0031] The beneficial effects of this invention are: (1) This invention uses Sanger sequencing technology to perform mitochondrial genome sequencing on multiple individuals from different farmed and wild populations of Chinese fish, thereby screening out the best SNP markers and identifying the population origin using only two pairs of primers. This fills the technical gap in the rapid identification of Chinese fish population origin based on SNP markers and has the advantages of high accuracy, low cost and batch processing. (2) The primer pairs, kits, and methods provided by this invention have significant application value in the rapid identification of farmed and wild populations of *Tangus chinensis*. Experimental verification shows that the primer pairs or kits provided by this invention are also effective in identifying other farmed or wild populations besides the primer design reference population, greatly demonstrating the universality of this invention. Attached Figure Description
[0032] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein: Figure 1 This is the phylogenetic tree of farmed and wild populations of *Tangyu* based on SNP markers in Example 1. The farmed populations include the QY, SIG, and CA populations (Note: referring to the Qingyuan, Singapore, and Canadian populations, respectively), and the wild populations include the CL, TABY, TACY, SZ, and SM populations (Note: referring to the Liangkou, Baiyunshan, Conghua, Shenzhen, and Shimen populations, respectively). The aforementioned English abbreviations will be used in the following text.
[0033] Figure 2 In Figure A and B, respectively, the forward and reverse verification electrophoresis images of the Tang fish cultured population in Example 2 are shown. The forward verification refers to the amplification of the DNA of individuals in the cultured population using primers designed based on the SNP markers of the cultured population to verify the universality of the primers. The reverse verification refers to the amplification of the DNA of individuals in the wild population using primers designed based on the SNP markers of the cultured population to verify the specificity of the primers.
[0034] Figure 3 These are electrophoresis images for forward and reverse verification of wild-type fish populations. Forward verification refers to amplifying the DNA of wild-type individuals using primers designed based on wild-type SNP markers to verify the universality of the primers. Reverse verification refers to amplifying the DNA of cultured individuals using primers designed based on wild-type SNP markers to verify the specificity of the primers. Detailed Implementation
[0035] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.
[0036] This invention utilizes Sanger sequencing technology to sequence the mitochondrial genomes of multiple individuals from different farmed and wild populations of *Culter alburnus*. The obtained sequences are aligned using MEGA 11 software, and Primer design is performed using Primer Premier 5 software to select the optimal SNP markers and their corresponding upstream and downstream 150bp candidate sequences. Finally, PCR and electrophoresis experiments are conducted. The technological advantage of this invention lies in its ability to achieve efficient and accurate identification of the germplasm origin of *Culter alburnus* populations at extremely low cost using only two pairs of primers.
[0037] Example 1: Optimal SNP marker selection for rapid identification of farmed and wild populations of Tang fish. 1. Collection of experimental samples In this embodiment, the caudal fins of the Chinese sturgeon were used as experimental samples. After collection, the samples were preserved using anhydrous ethanol. The Chinese sturgeon experimental samples mainly included: 1) cultured populations: QY, SIG, and CA populations; 2) wild populations: CL, TABY, TACY, SZ, and SM populations. Specific numbering and other information are shown in Table 2 and Appendix. Figure 1 As shown.
[0038] Table 2. Statistical table of individual samples from different farmed and wild populations of *Tang fish*.
[0039] 2. DNA extraction DNA was extracted from individuals of different farmed and wild populations of the above-mentioned Tang fish using the Ezup column-based animal genomic DNA extraction kit from Sangon Biotech (Shanghai) Co., Ltd. The specific operational steps are as follows: (1) Take about 25 mg of the tail fin of the Tang fish, wash off the alcohol with water and place it in a 1.5 ml centrifuge tube. Add 180 μL of Buffer ACL and then 20 μL of Proteinase K solution, and vortex to mix. Incubate at 56℃ for 1 h until the cells are completely lysed; (2) Add 200 μL of Buffer CL and mix thoroughly by inverting. (3) Add 200 μL of anhydrous ethanol and mix thoroughly by inverting. (4) Place the adsorption column into the collection tube, use a pipette to add all the solution and translucent fibrous suspension into the adsorption column, let stand for 2 min, then centrifuge at 10000 rpm at room temperature for 1 min, and discard the waste liquid in the collection tube. (5) Place the adsorption column back into the collection tube, add 500 μL of CW1 Solution to the adsorption column, centrifuge at 10000 rpm for 30 s, and discard the waste liquid in the collection tube. (6) Place the adsorption column back into the collection tube, add 500 μL of CW2 Solution to the adsorption column, centrifuge at 10000 rpm for 30 s, and discard the waste liquid in the collection tube. (7) Place the adsorption column back into the collection tube and centrifuge at 12000 rpm at room temperature for 2 min to remove the residual CW2Solution; (8) Remove the adsorption column, place it in a new 1.5ml centrifuge tube, add 50-200 μL of CE Buffer, let stand for 3 min, centrifuge at 12000 rpm at room temperature for 2 min, and collect the DNA solution.
[0040] The extracted DNA was quality controlled by agarose gel electrophoresis, NanoDrop, and Qubit quantification. The quality-controlled DNA was then used as a template for the next step of mitochondrial genome sequencing and primer verification experiments.
[0041] 3. Mitochondrial genome sequencing and optimal SNP marker screening The main steps of sequencing the mitochondrial genome of the Tang fish using Sanger sequencing technology are as follows: (1) PCR amplification: The PCR reaction system was set up with 1 μL of template DNA and fish. Cytb 0.5 μL each of universal gene primers (10 μmol / L), 12.5 μL of 2×Taq PCR MasterMix, and 10.5 μL of ddH2O were used. The reaction program was set as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 5 min, for 35 cycles; and 72℃ final extension for 10 min. The fragment size and specificity of the amplified products were verified by 1.5% agarose gel electrophoresis. (2) Product purification: PCR products were purified by magnetic bead method to remove impurities such as residual primers, dNTPs and Taq polymerase; the products were purified quantitatively by ultraviolet spectrophotometer to ensure that the concentration was ≥50ng / μL to meet the requirements of sequencing template. (3) Sanger sequencing: The above-mentioned quality-controlled PCR amplification products were subjected to capillary electrophoresis sequencing using an ABI 377 automated sequencer to obtain raw sequencing data; (4) Raw data quality control and sequence correction: The sequencing peak diagram was analyzed by CHROMAS software, and high-quality sequences with Q value ≥ 20 were screened and low-quality data with blurred peak shape and signal interference were removed; high-quality sequences were manually edited using BIOEDIT 6.0.7 software to correct base misjudgment, deletion and mismatch sites in overlapping regions.
[0042] The obtained sequences were compared using MEGA 11 software, and then the best SNP markers between farmed and wild populations were selected.
[0043] The optimal SNP marker is located at position 996 of the sequence shown in SEQ ID NO: 1 below.
[0044] ATGGCAAGCCTACGAAAAACTCACCCACTAATAAAAATCGCTAATGATGCACTAGTTGATTTACCAACACCATCCAATATCTCAGCATGATGAAACTTTGGATCCCTTTTAGGATTATGTTTAATCACCCAAATCTTAACTGGGCTATTTTTAGCAATACACTATACCTCAGACATTTCAACTGCATTTTCATCAGTCGCCCACATTTGCCGAGACGTAAACTATGGCTGACTTATTCGTAATTTGCACGCTAACGGAGCATCATTCTTCTTTATCTGCATTTATATGCACATTGCCCGAGGCTTATATTACGGCTCATACCTTTATAAAGAAACCTGAAATATTGGAGTTGTTCTTCTTCTCTTAGTTATAATAACAGCCTTTGTGGGTTACGTTCTTCCATGAGGACAAATATCTTTTTGAGGCGCCACAGTAATTACTAACCTCTTATCAGCTGTTCCCTACATAGGTGATATACTAGTCCAATGAATTTGAGGTGGATTTTCAGTAGATAACGCAACACTAACACGATTCTTTGCATTCCACTTCTTATTTCCCTTTGTTATCGCCGCCGCAACCCTCCTTCACCTTTTATTTCTTCACGAGACAGGATCCAACAACCCGGCCGGATTGAACTCTGACGCAGATAAAATTTCTTTCCACCCCTATTTTTCTTACAAGGACCTTCTTGGATTTGTAATAATACTATTAGCCTTAACATCTCTAGCACTATTTTCTCCTAACCTATTAGGGGACTCAGAAAATTTTATTCCGGCAAACCCACTAGTTACTCCACCACATATTAAACCAGAATGATATTTCTTATTTGCTTACGCAATTTTACGATCAATTCCTAATAAATTAGGAGGAGTTCTTGCACTACTATTTTCTATTTTAGTCCTAATAGTTGTACCAATTTTACACACCTCAAAACAACGGGGATTAACATTTCGTCCTATTACCCAATTTCTATTTTGAACTTTAGTAGCAGATAT [A / G] GCCATCTTAACATGAATTGGAGGAATACCCGTAGAACACCCATATATTATTGGCCAAATCGCATCAGTATTATACTTTGCACTCTTTCTCATTCTTACCCCCCTAGCAGGATGATTAGAGAACAAAGCATTAAAATGAGCCT (SEQ ID NO: 1).
[0045] Note: The bolded square brackets indicate that the two alleles are A and G.
[0046] Among them, the samples marked with SNP G were wild Tang fish; the samples marked with SNP A were farmed Tang fish.
[0047] Example 2: Primer pair and reagent kit design for rapid identification of farmed and wild populations of *Tang fish* Primers were designed using Primer Premier 5 software for the selected best SNP and its corresponding upstream and downstream 150bp candidate sequences. There were only two primer pairs, including a common forward primer F and a reverse primer R. The sequence of the common forward primer F is shown in SEQ ID NO: 3, and the sequence of the reverse primer R is shown in SEQ ID NOs: 2 and 4.
[0048] Shared forward primer (F): 5'--GCAAATCCACTTATTACTCCACCAC--3' (SEQ ID NO: 3) Reverse primer 1 (R1): 5'--TCCTCCAATCCTTGTTATGATGTCT--3' (SEQ ID NO: 2) Reverse primer 2 (R2): 5'--TCCTCCAAGTTATGTTATGGTGTCC--3' (SEQ ID NO: 4) Among them, the primer pair for the cultured population was composed of a shared forward primer (F) and a shared reverse primer 1 (R1), while the primer pair for the wild population was composed of a shared forward primer (F) and a shared reverse primer 2 (R2). Both pairs could specifically amplify the corresponding individuals in the population. Cytb Target fragment of the gene.
[0049] Based on the primer pairs described above, this embodiment constructs a kit for rapid identification of farmed and wild populations of Tang fish, including primer pairs: a shared forward primer F and a reverse primer R (reverse primer 1 and reverse primer 2), and other related reagents such as 2X Hot Start PCR Master Mix.
[0050] Example 3: Validation of SNP molecular markers in cultured populations Based on the SNP molecular markers of Example 1 and the primer pairs developed in Example 2, this example mainly involves DNA extraction, PCR amplification, and electrophoresis experiments on multiple individuals from cultured populations such as the Fangcun, etiolated, large-sail, and rosy populations, thereby performing forward and reverse verification of primer pairs F and R1 for cultured populations. Forward verification refers to amplifying the DNA of individuals from cultured populations using primers designed based on SNP markers from cultured populations to verify the universality of the primer pairs; reverse verification refers to amplifying the DNA of individuals from wild populations using primers designed based on SNP markers from cultured populations to verify the specificity of the primer pairs.
[0051] The steps for the forward and reverse verification experiment of primer pairs for Tang fish culture populations are as follows: (1) DNA extraction: DNA was extracted from the tail fins of three individuals from the Fangcun, Huanghua, Dafan, and Guili populations of the farmed Tangyu fish population; DNA was also extracted from the tail fins of three individuals from the Baiyunshan, Shuixi, Huidong, and Liangkou populations of the wild Tangyu fish population. The DNA extraction method was the same as that in Example 1 above.
[0052] (2) PCR amplification: Add the cultured population primer pair and the wild population primer pair to the DNA template extracted above, respectively, and perform PCR amplification to obtain PCR products for forward and reverse verification. (3) Electrophoresis: Perform electrophoresis on the PCR products in step (2) above and analyze the electrophoresis band results.
[0053] The PCR amplification reaction system in step (2) includes: 1 µL of 100 ng / µL DNA template, 25 µL of 2X Hot Start PCR Master Mix, 2 µL each of 10 µmol / µL forward primer F and reverse primer R1, and 20 µL of ddH2O, for a total of 50 µL.
[0054] The conditions required for the PCR reaction in step (2) are: 95℃ pre-deformation for 10 min, 94℃ denaturation for 30 sec, 56℃ annealing for 30 sec, 72℃ extension for 30 sec, cycled 35 times, then extended at 72℃ for 10 min, and finally held at 4℃.
[0055] Analysis of the electrophoresis results revealed the following: In the forward validation experiment, primer pairs F and R1 for farmed *Tangau* populations consistently produced target bands in farmed populations such as the Fangcun, Huanghua, Dafeng, and Guili populations, with sufficient band brightness, indicating high purity and concentration of the amplified products and verifying the strong universality of the farmed population primer pairs. In the reverse validation experiment, primer pairs F and R1 for farmed *Tangau* populations failed to produce any bands in wild populations such as the Baiyunshan, Shuixi, Huidong, and Liangkou populations, indicating that primer pairs F and R1 for farmed *Tangau* populations could not amplify the DNA template from wild populations, thus verifying the strong specificity of the farmed population primer pairs. Specific electrophoresis results are as follows: Figure 2 As shown.
[0056] Example 4: Validation of SNP molecular markers in wild populations Based on the SNP molecular markers of Example 1 and the primer pairs developed in Example 2, this example mainly involves DNA extraction, PCR amplification, and electrophoresis experiments on multiple individuals from wild populations such as the Baiyunshan, Shuixi, and Huidong populations, thereby performing forward and reverse verification of primer pairs F and R2 for wild populations. Forward verification refers to amplifying the DNA of wild population individuals using primers designed based on wild population SNP markers to verify the universality of the primer pairs; reverse verification refers to amplifying the DNA of cultured population individuals using primers designed based on wild population SNP markers to verify the specificity of the primer pairs.
[0057] The steps for the forward and reverse verification experiment of primer pairs for wild populations of *Tangus chinensis* are as follows: (1) DNA extraction: DNA was extracted from the tail fins of three individuals from the Baiyunshan, Shuixi, and Huidong populations of wild Tang fish. DNA extracts from the yellowing, sailing, and rosy populations in Example 3 were used as DNA templates for the cultured populations. The DNA extraction method was the same as that in Example 1.
[0058] (2) PCR amplification: Wild population primer pairs and cultured population primer pairs were added to the extracted DNA templates to perform PCR amplification, thereby obtaining PCR products for forward and reverse verification. (3) Electrophoresis: Perform electrophoresis on the PCR products in step (2) above and analyze the electrophoresis band results.
[0059] The PCR amplification reaction system in step (2) includes: 1 µL of 100 ng / µL DNA template, 25 µL of 2X Hot Start PCRMaster Mix, 2 µL each of 10 µmol / µL forward primer F and reverse primer R2, and 20 µL of ddH2O, for a total of 50 µL.
[0060] The conditions required for the PCR reaction in step (2) are: 95℃ pre-deformation for 10 min, 94℃ denaturation for 30 sec, 56℃ annealing for 30 sec, 72℃ extension for 30 sec, cycled 35 times, then extended at 72℃ for 10 min, and finally held at 4℃.
[0061] Analysis of the electrophoresis results revealed the following: In the forward validation experiment, primer pairs F and R2 from wild-type Tang fish populations consistently produced target bands in wild populations such as the Baiyunshan, Shuixi, and Huidong populations, with sufficient band brightness, indicating high purity and concentration of the amplified products and verifying the strong universality of the wild-type primer pairs. In the reverse validation experiment, primer pairs F and R2 from wild-type Tang fish populations failed to produce any bands in cultured populations such as the yellow-spotted, large-sailed, and succulent populations, indicating that primer pairs F and R2 from cultured Tang fish populations could not amplify the DNA template from cultured populations, thus verifying the strong specificity of the wild-type primer pairs. Specific electrophoresis results are as follows: Figure 3 As shown.
[0062] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments, and various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.
Claims
1. A SNP molecular marker for identifying farmed and wild populations of *Tang fish*, characterized by: The SNP molecular marker is located at position 996 from the 5' end of SEQ ID NO: 1, and its polymorphism is A / G.
2. The application of the SNP molecular marker described in claim 1 in the preparation of products for identifying farmed and wild populations of Tang fish.
3. The application according to claim 2, characterized in that: The substance comprises substances selected from one or more detection techniques or methods chosen from the group consisting of: Northern blotting, PCR, gene chip method, and nucleic acid sequencing.
4. A product comprising a substance for detecting the SNP molecular marker of claim 1.
5. The product according to claim 4, characterized in that: The product includes at least one of reagents, reagent kits, test strips, chips, and systems.
6. The product according to claim 5, characterized in that: The product contains primer pairs for amplifying the SNP molecular marker of claim 1.
7. The product according to claim 6, characterized in that: The nucleotide sequence of the upstream primer of the primer pair is shown in SEQ ID NO: 3; The nucleotide sequences of the downstream primers of the primer pair are shown in SEQ ID NO: 2 and 4.
8. A reagent or kit, characterized in that: It includes the primer pair described in claim 7.
9. A method for identifying and screening farmed and wild populations of *Tangus chinensis*, comprising the following steps: DNA was extracted from the fish and detected using the product described in any one of claims 4 to 7, or the reagent or kit described in claim 8, to obtain amplified products and analyze the results.
10. The method according to claim 9, characterized in that: The test sample with genotype G was a wild Tang fish; The sample to be tested with genotype A was a farmed Tang fish.