KASP molecular marker linked with first female flower node character of bitter gourd and application of KASP molecular marker

By developing KASP molecular markers that are closely linked to the first female flower node trait in bitter gourd, the problem of screening and detecting bitter gourd germplasm resources with low first female flower node position in existing technologies has been solved, enabling rapid and accurate breeding screening and improving breeding efficiency.

CN122012801APending Publication Date: 2026-05-12INST OF VEGETABLES GUANGDONG PROV ACAD OF AGRI SCI
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202610482256.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-13
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

In existing technologies, there are few molecular markers for the first female flower node of bitter gourd, making it difficult to effectively screen and detect bitter gourd germplasm resources with low first female flower nodes, thus affecting breeding efficiency.

Method used

A KASP molecular marker closely linked to the first female flower node trait of bitter melon was developed, located at position 22054848 on chromosome 4 of the bitter melon genome. Amplification primers F1, F2, and R were designed for PCR amplification and genotyping analysis to screen bitter melon germplasm resources with low first female flower node position.

Benefits of technology

This technology enables high-throughput and rapid identification of the first female flower node type in bitter gourd, improving the accuracy and efficiency of breeding and allowing for the screening of bitter gourd varieties with low first female flower nodes during the seedling stage.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention discloses a KASP molecular marker linked with a first female flower node character of bitter gourd and application of the KASP molecular marker, the KASP molecular marker is located at the 22054848 site of a No.4 chromosome of a bitter gourd genome, and the basic group at the site is A or C. The KASP molecular marker and the amplification primer thereof disclosed by the invention can be used for effectively detecting the character of the first female flower node of the balsam pear, are beneficial to screening a balsam pear variety with a low first female flower node, and have important guiding significance for molecular marker-assisted breeding of the balsam pear.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of crop genetics and breeding technology. Specifically, this invention relates to a KASP molecular marker closely linked to the QTL site at the first female flower node of bitter gourd and its application. Background Technology

[0002] Bitter melon (Momordica charantia L.) is an important economic vegetable of the Cucurbitaceae family, cultivated in tropical and subtropical Asia, and is known for its unique bitter taste and significant medicinal value.

[0003] Flowering time is a crucial turning point in plant development, marking the transition from vegetative to reproductive growth and significantly influencing crop adaptability, regional distribution, and final yield. The position of the first female flower node is a key agronomical trait determining the precocity of Cucurbitaceae crops, directly affecting the timing of female flower differentiation, early yield, and harvest period.

[0004] The genetic regulatory mechanisms of flowering time and the position of the first female flower node have been extensively studied in Arabidopsis thaliana and various vegetable crops. Lower female flower node positions generally mean earlier flowering and fruit setting, which helps plants avoid later biotic and abiotic stresses, shortens the production cycle, and reduces cultivation costs.

[0005] Currently, there are very few molecular markers that are closely linked to the first female flower node of bitter melon. Summary of the Invention

[0006] Based on this, the purpose of the present invention is to provide a molecular KASP marker that is closely linked to the first female flower node trait of bitter gourd.

[0007] The specific technical solutions for achieving the above-mentioned objectives are as follows.

[0008] In a first aspect, the present invention provides the application of a KASP molecular marker linked to the first female flower node trait of bitter gourd in detecting the first female flower node trait of bitter gourd or screening bitter gourd germplasm resources with low first female flower node position, wherein the KASP molecular marker is located at position 22054848 on chromosome 4 of the bitter gourd genome, and the base at this position is A or C.

[0009] In a second aspect, the present invention provides amplification primers for a KASP molecular marker linked to the first female flower node trait of bitter gourd, comprising an upstream primer F1 with the sequence shown in SEQ ID NO:1, an upstream primer F2 with the sequence shown in SEQ ID NO:2, and a downstream primer R with the sequence shown in SEQ ID NO:3.

[0010] A third aspect of the present invention provides the application of the above-mentioned amplification primers for the KASP molecular marker linked to the first female flower node trait of bitter gourd in detecting the first female flower node trait of bitter gourd or screening bitter gourd germplasm resources with low first female flower node position.

[0011] In a fourth aspect, the present invention provides the application of the above-mentioned amplification primers for the KASP molecular marker linked to the first female flower node trait of bitter gourd in the preparation of a kit for detecting the first female flower node trait of bitter gourd or screening bitter gourd germplasm resources with low first female flower node position.

[0012] In a fifth aspect, the present invention provides a kit for detecting the first female flower node trait of bitter gourd or for screening bitter gourd germplasm resources with low first female flower node position, comprising amplification primers for the KASP molecular marker linked to the first female flower node trait of bitter gourd.

[0013] In a sixth aspect, the present invention provides a method for detecting the first female flower node trait of bitter gourd, comprising the following steps: using the DNA of the bitter gourd to be tested as a template, performing PCR amplification with the above-mentioned amplification primers, and then analyzing the genotyping data.

[0014] A seventh aspect of the present invention provides a method for screening bitter gourd germplasm resources with low first female flower node, comprising the following steps: using the DNA of the bitter gourd to be tested as a template, performing PCR amplification with the above-mentioned amplification primers, and screening bitter gourd germplasm resources with genotype AA or AC.

[0015] The inventors of this invention used F2 segregating populations created from bitter gourd resources with low and high first female flower nodes as research subjects. A SNP variant A / C was found at position 22054848 on chromosome 4 of bitter gourd. This SNP is a KASP molecular marker closely linked to the first female flower node trait, with A closely linked to the low first female flower node trait and C closely linked to the high first female flower node trait. Further, amplification primers were designed based on this KASP molecular marker. Experimental verification showed that the KASP molecular marker and its amplification primers can be used to effectively detect the first female flower node trait in bitter gourd. This facilitates high-throughput rapid identification of the first female flower node type in bitter gourd during the seedling stage and has important guiding significance for screening bitter gourd varieties with low first female flower nodes and for marker-assisted breeding of bitter gourd. Attached Figure Description

[0016] Figure 1 Phenotypic diagrams of the first female flower node positions of bitter gourd parents 'K55' and 'M144', scale bar = 5 cm, white arrows indicate the first female flower node positions.

[0017] Figure 2 The first female flower node is the average position of the bitter gourd parents 'K55' and 'M144' and F1. Different letters indicate that the difference is statistically significant at the 0.01 level.

[0018] Figure 3 Phenotypic distribution of the first female flower node trait in the F2 segregating population derived from the bitter gourd parent 'K55' × 'M144'.

[0019] Figure 4 QTL localization of the first female flower node of bitter melon.

[0020] Figure 5 The results of KASP typing for 317 F2 individual plants are presented. Detailed Implementation

[0021] To facilitate understanding of the present invention, a more complete description will be provided below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0022] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention. The term "and / or" as used in this invention includes any and all combinations of one or more of the associated listed items.

[0023] Unless otherwise specified, all examples were performed under standard experimental conditions, such as those described in Sambrook et al., Molecular Cloning: a Laboratory Manual (Sambrook J & Russell DW, 2013), or as recommended by the manufacturer.

[0024] In some embodiments of the present invention, the application of a KASP molecular marker linked to the first female flower node trait of bitter gourd is disclosed in detecting the first female flower node trait of bitter gourd or screening bitter gourd germplasm resources with low first female flower node is disclosed. The KASP molecular marker is located at position 22054848 on chromosome 4 of the bitter gourd genome, and the base at this position is A or C.

[0025] In other embodiments of the present invention, an amplification primer for a KASP molecular marker linked to the first female flower node trait of bitter gourd is disclosed, comprising an upstream primer F1 with the sequence shown in SEQ ID NO:1, an upstream primer F2 with the sequence shown in SEQ ID NO:2, and a downstream primer R with the sequence shown in SEQ ID NO:3.

[0026] In one embodiment, the 5' end of the upstream primer F1 is modified with a FAM group, and the 5' end of the upstream primer F2 is modified with a HEX group.

[0027] In other embodiments of the present invention, the application of the above-mentioned amplification primers for the KASP molecular marker linked to the first female flower node trait of bitter gourd is disclosed in detecting the first female flower node trait of bitter gourd or screening bitter gourd germplasm resources with low first female flower node position is disclosed.

[0028] In other embodiments of the present invention, the application of the above-mentioned amplification primers for the KASP molecular marker linked to the first female flower node trait of bitter gourd is disclosed in the preparation of a kit for detecting the first female flower node trait of bitter gourd or screening bitter gourd germplasm resources with low first female flower node position is disclosed.

[0029] In other embodiments of the present invention, a kit for detecting the first female flower node trait of bitter gourd or screening bitter gourd germplasm resources with low first female flower node position is disclosed, comprising amplification primers for the KASP molecular marker linked to the first female flower node trait of bitter gourd.

[0030] In other embodiments of the present invention, a method for detecting the first female flower node trait of bitter gourd is disclosed, comprising the following steps: using the DNA of the bitter gourd to be tested as a template, performing PCR amplification with the above-mentioned amplification primers, and then analyzing the genotyping data.

[0031] In one embodiment, the analysis of genotyping data includes the following steps: when the genotype is CC, the bitter gourd to be tested is a bitter gourd variety with a high first female flower node; when the genotype is AA or AC, the bitter gourd to be tested is a bitter gourd variety with a low first female flower node.

[0032] In other embodiments of the present invention, a method for screening bitter gourd germplasm resources with low first female flower node is disclosed, comprising the following steps: using the DNA of the bitter gourd to be tested as a template, performing PCR amplification with the above-mentioned amplification primers, and screening bitter gourd germplasm resources with genotype AA or AC.

[0033] In one embodiment, the PCR amplification reaction system comprises: 5.0±0.1 μL of 2 xKASP master mix, 0.15±0.01 µL of 8 μM~10 μM upstream primer F1, 0.15±0.01 µL of 8 μM~12 μM upstream primer F2, 0.4±0.05 µL of 10 μM downstream primer R, 10 ng~100 ng of DNA template, and ddH2O added to 10 μL.

[0034] In one embodiment, the PCR amplification reaction program is as follows: 94°C, 15 min; 94°C, 20 s, 65~57°C, 1 min, 10 cycles; 94°C, 20 s, 57°C, 1 min, 30 cycles.

[0035] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0036] Example 1: Development of KASP molecular markers tightly linked to QTLs for the first female flower node trait in bitter melon

[0037] Using M144 (average first female flower node position 6.3) and K55 (average first female flower node position 22.0) as parents (bred and preserved by the Vegetable Research Institute of Guangdong Academy of Agricultural Sciences, the first female flower node phenotype is as follows). Figure 1 As shown), the F1 generation was obtained by crossing the two parents (the average first female flower node phenotype of the parents and F1 is as shown). Figure 2 As shown), the F2 segregating population obtained by self-pollination of F1 showed a skewed distribution in the frequency distribution of the first female flower node, indicating that the lower first female flower node was partially dominant. Figure 3 ).

[0038] Thirty plants with extreme phenotypes from each F2 population were used for pooled sequencing. The difference in SNP-index between the two progeny pools, ΔSNP-index, was calculated. A window size of 1 Mb and a step size of 1 kb were selected, and the average ΔSNP-index within each window was calculated to reflect the ΔSNP-index distribution. The QTL for the first female flower node of bitter gourd was located within a 3.7 Mb (95% confidence level) interval on chromosome 4 (Bitter gourd (OHB3-1) v2 Genome). Figure 4 (a) KASP markers were designed at both ends and within this interval, and the F2 population was expanded for genotyping. Combined with phenotypic data, the region was located within an interval of approximately 73.05 kb. Figure 4 (b) in the middle.

[0039] Whole-genome resequencing was performed on the F2 parents to locate SNP variants within the specified region. A SNP variant A / C was found at position 22054848, which is a KASP molecular marker tightly linked to the QTL for the first female flower node trait in bitter gourd.

[0040] Based on the 300 bp sequences upstream and downstream of the aforementioned SNP sites, amplification primers for the KASP molecular marker were designed. These include forward primer F1 (SEQ ID NO:1), forward primer F2 (SEQ ID NO:2), and reverse primer R (SEQ ID NO:3). Both forward primers have allelic variations at their ends, with A / C. The 5' ends of the forward primers are connected to fluorescent tag sequences A and B. Specifically, the 5' end of F1 is connected to fluorescent tag sequence A with a FAM group (5'-GAAGGTGACCAAGTTCATGCT-3'), and the 5' end of F2 is connected to fluorescent tag sequence B with a HEX group (5'-GAAGGTCGGAGTCAACGGATT-3').

[0041] F1 (SEQ ID NO:1):

[0042] GAAGGTGACCAAGTTCATGCTGGATTGAGTGAGACCCTTGGT

[0043] F2 (SEQ ID NO:2):

[0044] GAAGGTCGGAGTCAACGGATTGGATTGAGTGAGACCCTTGGG

[0045] R (SEQ ID NO: 3): GCAAACAAGTTTTCGACGATTTCC

[0046] Example 2: Validation of the KASP molecular marker from Example 1

[0047] This embodiment validated the KASP molecular marker from Example 1 using an F2 population (317 strains). The steps included:

[0048] 1. Young leaves from the F2 population were collected, and genomic DNA of bitter gourd was obtained by CTAB extraction. PCR amplification was performed using the KASP molecular marker primers described in Example 1. The PCR reaction system was 10 μL, containing 5 μL of 2×KASP mastermix, 0.15 μL of forward primer F1 (10 μM), 0.15 μL of forward primer F2 (10 μM), 0.4 μL of reverse primer R1 (10 μM), 1 μL of DNA (10 ng~100 ng), and 3.3 μL of ddH2O. The PCR reaction program was: 94℃, 15 min; 94℃, 20 s, 65℃~57℃ (Touch down), 1 min, 10 cycles; 94℃, 20 s, 57℃, 1 min, 30 cycles.

[0049] 2. The fluorescence signal was read using a TECAN Infinite M1000 microplate reader, and the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ) was used to analyze and convert the fluorescence signal, obtaining a clear and intuitive genotyping diagram. Samples aggregated on the X-axis represent the K55 genotype (orange), corresponding to genotype CC; samples aggregated on the Y-axis represent the M144 genotype (blue), corresponding to genotype AA; and samples aggregated in the middle represent the heterozygous genotype (green), corresponding to genotype AC.

[0050] The test results for the F2 group are shown below. Figure 5Three genotypes were found in the F2 population. Phenotypic and genotypic analysis of the tested materials revealed that the average first female flower node position for genotypes with bases AA, AC, and CC at position 22054848 in the F2 population was 10.1, 11.4, and 14.2 nodes, respectively, with a p-value of 5.17E-06 < 0.01, indicating a highly significant difference.

[0051] Therefore, the SNP mutation site discovered in this invention is closely linked to the low first female flower node trait when the base is A, and closely linked to the high first female flower node trait when the base is C. Furthermore, the KASP molecular marker can be used to screen for the first female flower node trait of bitter gourd, and the amplification primers of the KASP molecular marker designed for this site can be used to effectively detect the first female flower node of the target bitter gourd.

[0052] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0053] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. The application of a KASP molecular marker linked to the first female flower node trait of bitter gourd in detecting the first female flower node trait of bitter gourd or screening bitter gourd germplasm resources with low first female flower node position, wherein the KASP molecular marker is located at position 22054848 on chromosome 4 of the bitter gourd genome, and the base at this position is A or C.

2. A primer for amplifying a KASP molecular marker linked to the first female flower node trait of bitter melon, characterized in that, It includes upstream primer F1 with the sequence shown in SEQ ID NO:1, upstream primer F2 with the sequence shown in SEQ ID NO:2, and downstream primer R with the sequence shown in SEQ ID NO:

3.

3. The amplification primers for the KASP molecular marker linked to the first female flower node trait of bitter melon according to claim 2, characterized in that, The 5' end of the upstream primer F1 is modified with a FAM group, and the 5' end of the upstream primer F2 is modified with a HEX group.

4. The application of the KASP molecular marker amplification primers linked to the first female flower node trait of bitter gourd as described in claim 2 or 3 in detecting the first female flower node trait of bitter gourd or screening bitter gourd germplasm resources with low first female flower node position.

5. The application of the amplification primers of the KASP molecular marker linked to the first female flower node trait of bitter gourd as described in claim 2 or 3 in the preparation of a kit for detecting the first female flower node trait of bitter gourd or screening bitter gourd germplasm resources with low first female flower node position.

6. A kit for detecting the first female flower node position trait of bitter gourd or for screening bitter gourd germplasm resources with low first female flower node position, characterized in that, Amplification primers for the KASP molecular marker linked to the first female flower node trait of bitter gourd, as described in claim 2 or 3.

7. A method for detecting the first female flower node position trait in bitter gourd, characterized in that, The process includes the following steps: using the DNA of the bitter melon to be tested as a template, performing PCR amplification with the amplification primers described in claim 2 or 3, and then analyzing the genotyping data.

8. The method for detecting the first female flower node position trait of bitter gourd according to claim 7, characterized in that, The analysis of genotyping data includes the following steps: when the genotype is CC, the bitter gourd to be tested is a bitter gourd variety with a high first female flower node; when the genotype is AA or AC, the bitter gourd to be tested is a bitter gourd variety with a low first female flower node.

9. A method for screening bitter gourd germplasm resources with low first female flower node, characterized in that, The method includes the following steps: using the DNA of the bitter gourd to be tested as a template, performing PCR amplification with the amplification primers described in claim 2 or 3, and screening bitter gourd germplasm resources with genotypes AA or AC.

10. The method according to any one of claims 7 to 9, characterized in that, The PCR amplification reaction system included: 5.0±0.1 μL of 2xKASP master mix, 0.15±0.01 µL of 8 μM~10 μM upstream primer F1, 0.15±0.01 µL of 8 μM~12 μM upstream primer F2, 0.4±0.05 µL of 10 μM downstream primer R, 10 ng~100 ng of DNA template, and ddH2O added to 10 μL; The PCR amplification reaction program was as follows: 94℃, 15 min; 94℃, 20 s, 65~57℃, 1 min, 10 cycles; 94℃, 20 s, 57℃, 1 min, 30 cycles.