Primer probe combination for rapidly and simultaneously detecting bovine astrovirus and bovine norovirus and detection method thereof

By designing primer-probe combinations for bovine astrovirus and bovine norovirus, rapid and accurate dual isothermal fluorescence quantitative PCR detection at low temperatures was achieved, solving the problems of long detection time and complex equipment in existing technologies, and making it suitable for rapid on-site detection.

CN122012811APending Publication Date: 2026-05-12GUIZHOU INST OF ANIMAL HUSBANDRY & VETERINARY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610068485.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-19
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Existing methods for detecting bovine astrovirus and bovine norovirus are time-consuming and require complex equipment, which cannot meet the needs of rapid clinical testing.

Method used

A primer-probe combination, including AstV-F1, AstV-R3, BNoV-F3, BNoV-R1 and corresponding fluorescent probes, was designed for dual isothermal quantitative PCR detection at 39℃, simplifying equipment requirements and shortening the detection time to 20 minutes.

Benefits of technology

It achieves rapid and accurate virus detection with high sensitivity. The equipment is lightweight and suitable for on-site testing, and has high specificity and repeatability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012811A_ABST
    Figure CN122012811A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biology, particularly relates to a primer probe combination, a kit and a detection method for rapidly and simultaneously detecting bovine astrovirus and bovine norovirus, and aims to solve the problems of long detection time and complex detection equipment in the existing method for simultaneously detecting bovine astrovirus and bovine norovirus. According to BAstV and BNoV gene sequences disclosed by GenBank, the specific primer group for detecting the bovine norovirus and the bovine astrovirus is designed for BAstV ORF2 and BNoV RdRp gene conserved regions by adopting Oligo 6.0 software, and the primer pair, the probe and the method have the advantages of simplicity and convenience in operation, high specificity, high detection rate, high sensitivity, good repeatability and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a primer-probe combination for the simultaneous detection of bovine astrovirus and bovine norovirus, and its detection method. Background Technology

[0002] Viral diarrhea is a significant infectious disease affecting cattle, causing diarrhea, decreased milk production, weakened immunity, and even impacting the long-term growth performance of calves. Therefore, establishing rapid, sensitive, and field-appropriate methods for detection is crucial for the early detection and differentiation of symptoms in cattle.

[0003] Bovine astrovirus (BoAstV) is a single-stranded positive-sense RNA virus belonging to the family Astroviridae and the genus *Mammalian Astrovirus*. It has an extremely high positivity rate and can cause diarrhea and neurological symptoms in animals. Bovine norovirus (BNoV) is a non-enveloped single-stranded positive-sense RNA virus belonging to the family Caliciviridae and the genus *Norovirus*. Because it frequently co-infects with other diarrheal viruses, its role in calf diarrhea is often overlooked.

[0004] However, BoAstV and BNoV have become prevalent in Chinese farms in the past two years, but there is currently no rapid diagnostic method specifically for these two viruses in China. Therefore, this study designed probes and primers based on the conserved gene regions of BoAstV and BNoV, and successfully established a rapid isothermal fluorescence detection method, providing reliable technology and strong support for pathogen identification and molecular epidemiological research of bovine diarrhea.

[0005] Real-time quantitative PCR, as the internationally recognized gold standard for virus detection, possesses multiple advantages such as speed, simplicity, safety, high sensitivity, and quantification, and is therefore widely used in clinical testing. Although the literature "Establishment and Application of Dual PCR Detection Method for Bovine Astrovirus and Bovine Norovirus" (Wang Wenjia et al., 2020) reports a fluorescent PCR method that can simultaneously detect the above two viruses, the detection process still takes about 2 hours, comparable to the time required for conventional PCR, and the detection equipment is complex, requiring a thermal cycler, thus failing to meet the urgent clinical need for rapid detection. Summary of the Invention

[0006] The purpose of this invention is to address the problems of long detection time and complex detection equipment in existing methods for simultaneously detecting bovine astrovirus and bovine norovirus, and to provide a primer-probe combination and detection method for simultaneously detecting bovine astrovirus and bovine norovirus.

[0007] The technical solution of the present invention: The first objective of this invention is to provide a primer-probe combination for the simultaneous detection of bovine asteroid virus and bovine norovirus, wherein the primers in the primer-probe combination are AstV-F1, AstV-R3, BNoV-F3, and BNoV-R1, and their nucleotide sequences are as follows: AstV-F1(5'→3'):GAGGATGCAGATGATGAAGATGACGAGGTT; AstV-R3(5'→3'):GGGTGCAGCTCACAAAGGATCTCATAGGTT; BNoV-F3(5'→3'):TCCATGGTGACCGCAGAGGCCAAGGAA; BNoV-R1(5'→3'): TCCTGATTATCCTTGTCAGTCATCTTCATT; The probes in the primer-probe combination are AstV-P and BNoV-P, with the following nucleotide sequences: Modified AstV-P(5'→3'): ACAGATGCCGACCTTGAGCTCGGTCCCATGGA / iHEXdT / / idSp / A / iBHQ1dT / TATGATGATCCACC-C3 Spacer; Modified BNoV-P(5'→3'): TCGCACCGCTCCATGTTTGCTTGGATGAGATT / i6FAMdT / / idSp / A / iBHQ1dT / GATTTGTCGCTGTG-C3 Spacer.

[0008] BNoV-F3 and BNoV-R1 were designed using the RdRp gene of bovine norovirus as a template, while AstV-F1 and AstV-R3 were designed using the ORF2 gene of bovine asteroid virus as a template. Preferably, the primers and probes described above have a fluorescent group labeled at the 5′ end and a quenching group labeled at the 3′ end.

[0009] Preferably, the fluorescent group is either FAM or HEX, and the quenching group is BHQ1.

[0010] A second object of the present invention is to provide a kit for the simultaneous detection of bovine asteroid virus and bovine norovirus, comprising the aforementioned primers and probes.

[0011] The aforementioned kit also includes enzyme buffer.

[0012] A third objective of this invention is to provide a dual RT-PCR detection method for simultaneously detecting bovine norovirus and bovine astrovirus, wherein the method is a non-diagnostic detection method and includes the following steps: 1) Primer design and synthesis: Based on the BAstV and BNoV gene sequences published in GenBank, primers and probes were designed using Oligo 6.0 software targeting the conserved regions of the BAstV ORF2 and BNoV RdRp genes; the amplified fragment length was 150-300 bp, usually not exceeding 500 bp, with a GC content of 30%-60%; 2) Fluorescent probe design: A 46-52 nt sequence, identical or complementary to the target fragment amplified by the primers, is designed as a fluorescent probe between the upstream and downstream primers. The probe sequence should not overlap with the specific primer recognition site, and its length should be 46-52 nt. Palindromic sequences, internal secondary structures, and consecutive repetitive bases should be avoided. The probe has four modification sites: ① A dSpacer modification is performed by introducing any one of the bases in the middle to rear portion of the 5' end (30 to 35 nt from the 5' end) into tetrahydrofuran (THF) to serve as a recognition site for a specific exonuclease; the base can be any one of A, T, C, or G; ② A fluorescent group is labeled on the T base upstream of the THF site, and a quenching group is labeled on the T base downstream. The distance between the two modified T bases is 1nt to 3nt, or a probe is designed with an inverse complementary sequence; ③ THF is approximately 15 nt from the 3' end, and the 3' end is marked with a modifying group; the modifying group is an amino group, a phosphate group, or a C3-spacer; 3) Construction of recombinant plasmid standards: Singleton isothermal fluorescence PCR amplification was performed using BAstV and BNoV strains as templates, respectively. The PCR products were recovered using a gel extraction kit to obtain the target fragment, which was then ligated into the pMD18-T vector and transformed into DH5α competent cells. After positive sequencing identification, the cells were subsequently expanded and cultured, and plasmids were extracted using a standard plasmid extraction kit. These recombinant plasmids were named pMD-18T-BAstV and pMD-18T-BNoV. The singleton isothermal fluorescence PCR amplification reaction system consisted of: 29.4 μL of buffer A, 2.0 µL each of upstream and downstream primers (10 μM), 0.6 µL of probe, 5 µL of template, 2.5 µL of buffer B, and ddH2O to a final volume of 50 µL. The amplification program was: 39℃, 30 s, 40 cycles. 4) RNA extraction: Immerse the fecal swab directly into a centrifuge tube containing a nucleic acid release agent, and then vortex, let stand, and centrifuge briefly to obtain the RNA of the sample to be tested. 5) Dual-temperature quantitative PCR amplification reaction: Using the recombinant plasmid standard obtained in step 1) and the RNA of the sample to be tested obtained in step 2) as detection templates, prepare 50 µL of amplification reaction product according to the dual-temperature quantitative PCR amplification reaction. The dual-temperature quantitative PCR amplification reaction system is as follows: template 5 µL, A buffer 29.4 μL, AstV upstream and downstream primers 1.5 μL each, concentration 10 μM, AstV-P 0.6 μL, B buffer 2.5 µL, BNoV upstream and downstream primers 1 μL each, concentration 10 μM, BNoV-P 0.3 μL, and add ddH2O to make up to 50 µL. The amplification program is: 39℃, 30s, 40 cycles, while collecting fluorescence signals simultaneously. 6) Result detection: The amplification curve is plotted using the software built into the real-time PCR instrument, the corresponding Ct value is read, and the result is determined.

[0013] The concentration of the recombinant plasmid pMD-18T-BAstV was 197 ng / μL; the concentration of the recombinant plasmid pMD-18T-BNoV was 241.7 ng / μL.

[0014] The beneficial effects of this invention are: (1) This invention is based on the BAstV and BNoV gene sequences published in GenBank, and modifies BAstV... ORF2 and BNoV RdRp For the conserved gene regions, specific primer sets for detecting bovine norovirus and bovine astrovirus were designed using Oligo 6.0 software. The primer sets of this invention have high sensitivity, with a sensitivity of 100 fg / μL for BNoV and 10 fg / μL for AstV. The primer sets have good reproducibility; when the same sample was tested four times, the coefficient of variation of C values ​​at each concentration was less than 10%, and the dispersion was small.

[0015] (2) The primer-probe combination of the present invention enables rapid and accurate detection of bovine norovirus and bovine astrovirus. It can be carried out at a low reaction temperature (39°C) and the reaction time is only 20 minutes. The equipment is lightweight and does not depend on a professional laboratory environment, making it more suitable for rapid on-site detection.

[0016] In summary, the primer pairs, probes, and methods of this invention have advantages such as simple operation, high specificity, high detection rate, high sensitivity, and good repeatability. Attached Figure Description

[0017] Figure 1 Sensitivity of isothermal fluorescence reaction of BAstV primers F1 and R3; Figure 2 Sensitivity of BNoV primers F1 and R1 to isothermal fluorescence reaction; Figure 3 : Sensitivity of BNoV primer F3 and R1 isothermal fluorescence reaction; Figure 4 Dual-combination optimization scheme 1: Response sensitivity; Figure 5 : Dual-combination optimization scheme two response sensitivity; Figure 6 : Specific amplification patterns of dual fluorescence reaction using BNoV primer pair and BAstV primer pair. Detailed Implementation

[0018] Example 1 1. Materials and Methods 1.1 Clinical Samples and Positive Nucleic Acids 220 samples of cow manure were collected from farms in Guanling and Luodian, Guizhou Province. Positive nucleic acids for BRV (rotavirus), BVDV (bovine viral diarrhea), and BCoV (bovine coronavirus) were provided by the Livestock and Poultry Product Physicochemical Detection and Analysis Laboratory of the Guizhou Provincial Institute of Animal Husbandry and Veterinary Medicine.

[0019] 1.2 Main Reagents Nucleic acid release agent (RNA-II type) and DNA isothermal rapid amplification kit (fluorescent type) were purchased from Anpu Future Changzhou Biotechnology Co., Ltd.; EZNATM Gel Extraction Kit agarose gel extraction kit was purchased from Omega; ampicillin, pMD18-T Vector, DH-5α competent cells, ordinary plasmid mini-preparation kit, and deionized water were all purchased from Tiangen Biotech (Beijing) Co., Ltd.

[0020] 1.3 Main Equipment The NanoDrop Eight Microvolume UV-Vis Spectrophotometer (part number 912A1101) and QuantStudio™ 6 and Real-Time PCR Systems (part number 4485691) were both purchased from Thermo Fisher Scientific (China) Co., Ltd.

[0021] 1.4 Primer Design and Synthesis According to the BAstV and BNoV gene sequences published in GenBank, targeting BAstV... ORF2 and BNoV RdRp For each conserved gene region, 2-3 specific primers were designed using Oligo 6.0 software. The primer and probe sequences were synthesized by Guangzhou Aikerui Biotechnology Co., Ltd.

[0022] Table 1. BAstV primer and probe sequences (HEX channel)

[0023] Table 2 BNoV primer and probe sequences (FAM channel)

[0024] 1.5 RNA Extraction and Preparation Immerse the fecal swab directly into a centrifuge tube containing 1.5 mL of nucleic acid release agent, shake to mix, let stand for 5 min, centrifuge for 5 s, and the extracted product can be used directly for detection.

[0025] 1.6 Preparation of Recombinant Plasmid Standards Using the BAstV strain as a template, nucleic acids were prepared according to the kit method described in section 1.5 above. Using screened primers, PCR products with the expected band size and good specificity were selected and identified by 2% agarose gel electrophoresis. The target fragment was recovered using a gel extraction kit and ligated into the pMD18-T cloning vector. The resulting cells were transformed into competent DH-5α cells, and the recombinant plasmid was named pMD-18T-BAstV. The constructed recombinant plasmid was sent to Shanghai Bioengineering Co., Ltd. for sequencing. After amplification and culture of the sequencing-positive recombinant plasmid, pMD-18T-BAstV was extracted using a plasmid extraction kit, and its concentration was determined using an ultra-micro nucleic acid and protein analyzer. The pMD-18T-BNoV recombinant plasmid was prepared using the same method.

[0026] 1.7 Construction of a single-layer isothermal fluorescence reaction system Using the recombinant plasmid as a template, a 50 µL amplification system was prepared according to the instructions of the DNA isothermal rapid amplification fluorescent kit: 29.4 µL of buffer A, 2.0 µL each of forward and reverse primers (10 μM), 0.6 µL of probe, 5 µL of template, and 2.5 µL of buffer B. The final volume was brought to 50 µL with ddH2O, which served as a negative control. The amplification program was 39 °C, 30 s, 40 cycles.

[0027] 1.8 Optimization of Primer Screening for Single-Layer Isothermal Fluorescence Reactions The recombinant plasmid was diluted to three gradients: 100 fg / μL, 10 fg / μL, and 1 fg / μL. Using these gradients as templates, the upstream and downstream primers in Tables 1 and 2 were combined in pairs for forward and reverse screening. Meanwhile, ddH2O was used as a negative control for isothermal fluorescence amplification. The optimal primer combination was selected based on the peak time and fluorescence intensity of the amplification curve.

[0028] 1.9 Single-weighted isothermal fluorescence reaction sensitivity detection The constructed recombinant plasmid was serially diluted into three gradients, and each gradient was used as a template for amplification reactions. ddH2O was used as a negative control to test the sensitivity of the singlet reaction and screen for the optimal primer combination.

[0029] 1.10 Optimization of primer content for dual isothermal fluorescence reaction Since the fluorescence intensity of the HEX fluorescent group itself is not high (this is determined by the inherent properties of the group), while the FAM group is brighter, the FAM group primer probe was adjusted to balance the dual fluorescence intensity and sensitivity. Therefore, the experiment adjusted the amount of BNoV primers with FAM group probes to adjust the dual fluorescence reaction system. Using the recombinant plasmid as a template, a 50 µL amplification system was prepared according to the instructions of the DNA isothermal rapid amplification fluorescent kit: 29.4 µL of A buffer, 1.5 µL each of BAstV primers AstV-F1 and AstV-R3 (10 μM), and 0.6 µL of probe AstV-P (10 μM); 1 µL and 1.2 µL of BNoV primers BNoV-F3 and BNoV-R1 (10 μM), and 0.3 µL and 0.4 µL of probes BNoV-P (10 μM), respectively; 5 µL of template; and 2.5 µL of B buffer. The final volume was brought to 50 µL with ddH2O, which served as a negative control. The amplification program was 39 °C, 30 s, 40 cycles.

[0030] 1.11 Sensitivity detection of dual fluorescence reaction After determining the nucleic acid concentration of the constructed recombinant plasmid, it was serially diluted to four gradients, and PCR reactions were performed using each gradient as a template, with ddH2O as a negative control. Each dilution was performed in duplicate to test the sensitivity of the established method.

[0031] 1.12 Dual-Isothermal Fluorescence Specificity The established method was used to detect common diarrhea viruses BRV (rotavirus), BVDV (bovine viral diarrhea), and BCoV (bovine coronavirus). The constructed pMD-18T-BAstV and pMD-18T-BNoV recombinant plasmids were diluted to 10 pg / μL as positive controls, and ddH2O was used as a negative control to test the specificity of the method.

[0032] 1.13 Dual-isothermal fluorescence repeatability The recombinant plasmid was diluted to concentrations of 1 pg / μL, 100 fg / μL, 10 fg / μL, and 1 fg / μL, and the amplification reaction was repeated multiple times to verify the reliability of the results.

[0033] 1.14 Clinical Sample Testing Two hundred and twenty stool samples with diarrhea were collected and tested using the dual isothermal RT-PCR method established in this study. The results were compared with those obtained by RT-PCR using the single SYBR Green dye method to analyze the infection status of BAstV and BNoV.

[0034] 2.1 Recombinant plasmid concentration The concentration of recombinant plasmid pMD-18T-BAstV was 197 ng / μL, and the concentration of recombinant plasmid pMD-18T-BNoV was 241.7 ng / μL.

[0035] 2.2 Primer screening results 2.2.1 Results of BAstV primer screening (1) Positive screening results: As shown in Table 3, the downstream primer AstV-R3 performed the best, followed by AstV-R2.

[0036] Table 3. Results of BAstV F1 compared with positive screening methods R1, R2, and R3.

[0037] (2) Screening results: As shown in Table 4, among the three template concentrations, AstV-F1+AstV-R3+AstV-P has the smallest CT value and the highest fluorescence value, so it is the optimal combination.

[0038] Table 4 Results of the reaction of BAstV F1 and F2 with R2 and R3, respectively.

[0039] 2.2.2 BNoV primer screening results (1) Positive screening results: As can be seen from Table 5, the downstream primer BNoV-R1 performed the best, followed by BNoV-R2.

[0040] Table 5 Results of the reaction of BNoV F1 with R1 and R2, respectively

[0041] (2) Screening results: As shown in Table 6, among the three template concentrations, BNoV-F3+BNoV-R1+BNoV-P had the lowest CT value and the highest fluorescence value, thus it was the optimal combination; BNoV-F1+BNoV-R1+BNoV-P was the second best. It is planned to use these two combinations to conduct sensitivity tests, and then screen for the optimal primers. Table 6 Results of the reaction of BNoV R1 with F1, F2, and F3, respectively.

[0042] 2.3 Single-weighted isothermal fluorescence reaction sensitivity detection 2.3.1 BAstV isothermal fluorescence reaction sensitivity detection As shown in Table 7, the sensitivity of AstV-F1+AstV-R3 is 1 fg / μL, and it is the optimal primer-probe combination.

[0043] Table 7. Sensitivity of BAstV isothermal fluorescence reaction

[0044] 2.3.2 BNoV isothermal fluorescence reaction sensitivity detection Table 8 shows that the primers BNoV-F1+BNoV-R1 and BNoV-F3+BNoV-R1 both have a sensitivity of 1 fg / μL, and BNoV-F3+BNoV-R1 is the optimal primer-probe combination.

[0045] Table 8 Sensitivity of BNoV isothermal fluorescence reaction

[0046] 2.4 Optimization results of primer dosage for dual isothermal fluorescence reaction 2.4.1 Optimization Scheme 1 with Dual Combination and Sensitivity Results (Results with 1 μL of BNoV upstream and downstream primers) The results of the dual-combination optimization scheme 1 show that when 1 μL of BNoV upstream and downstream primers are added and 0.3 μL of BNoV-P is used, the AstV sensitivity is 10 fg / μL and the BNoV sensitivity is 100 fg / μL.

[0047] Table 9 Results of Dual Combination Optimization Scheme 1

[0048] 2.4.2 Optimization Scheme 2 with Dual Combination and Sensitivity Results (Results with 1.2 μL of BNoV upstream and downstream primers) Table 10 Results of the second dual-combination optimization scheme

[0049] As shown in Table 10, the results of the dual-combination optimization scheme 2 indicate that the AstV sensitivity is 10 fg / μL and the BNoV sensitivity is 1 fg / μL.

[0050] The results of the two primer optimization schemes showed that increasing the amount of BNoV primers had little effect on the results of the dual fluorescence reaction. When the amount of BNoV upstream and downstream primers was 1.2 μL and the amount of BNoV-P was 0.4 μL, from the perspective of saving resources, the amount of BNoV upstream and downstream primers was 1 μL and the amount of BNoV-P was 0.3 μL, with a sensitivity of 100 fg / μL.

[0051] 2.5 Specificity of dual fluorescence reaction When tested simultaneously with common diarrhea viruses such as BRV (rotavirus), BVDV (bovine viral diarrhea), and BCoV (bovine coronavirus), only the recombinant plasmids pMD-18T-BAstV and pMD-18T-BNoV were detected, while others were not detected, indicating that the established method has good specificity.

[0052] 2.6 Reproducibility of dual fluorescence reaction The established isothermal fluorescence method was used to repeatedly detect recombinant plasmids of different concentrations four times to verify the reliability of the results. Table 11 shows that the coefficient of variation of CT values ​​at each concentration was less than 10%, and the dispersion was small, indicating that the established dual fluorescence detection method has good repeatability.

[0053] Table 11 Repeatability test results

[0054] 2.7 Clinical Sample Testing Table 12 shows that the SYBR Green dye RT-PCR method detected 48 positive samples for BASTV and 18 positive samples for BNoV, with 3 samples showing co-infection with both viruses. The dual isothermal PCR method detected 54 positive samples for BASTV and 21 positive samples for BNoV, with 4 samples showing co-infection with both viruses. Compared with the dye method, the dual isothermal method showed a higher detection rate and stronger specificity, and the detection time was only 20 minutes, indicating that the method established in this study can be used for rapid detection of clinical samples.

[0055] Table 12 Clinical test results

Claims

1. A primer-probe combination for rapid simultaneous detection of bovine astrovirus and bovine norovirus, characterized in that, The primers in the primer-probe combination are AstV-F1, AstV-R3, BNoV-F3, and BNoV-R1, with the following nucleotide sequences: AstV-F1(5'→3'):GAGGATGCAGATGATGAAGATGACGAGGTT; AstV-R3(5'→3'):GGGTGCAGCTCACAAAGGATCTCATAGGTT; BNoV-F3(5'→3'):TCCATGGTGACCGCAGAGGCCAAGGAA; BNoV-R1(5'→3'): TCCTGATTATCCTTGTCAGTCATCTTCATT; The probes in the primer-probe combination are AstV-P and BNoV-P, with the following nucleotide sequences: Modified AstV-P(5'→3'): ACAGATGCCGACCTTGAGCTCGGTCCCATGGA / iHEXdT / / idSp / A / iBHQ1dT / TATGATGATCCACC-C3 Spacer; Modified BNoV-P(5'→3'): TCGCACCGCTCCATGTTTGCTTGGATGAGATT / i6FAMdT / / idSp / A / iBHQ1dT / GATTTGTCGCTGTG-C3 Spacer.

2. The primer-probe combination for rapid simultaneous detection of bovine astrovirus and bovine norovirus as described in claim 1, characterized in that, BNoV-F3 and BNoV-R1 are bovine norovirus. RdRp The genes were designed using the ORF2 gene of bovine asteroid virus as a template. AstV-F1 and AstV-R3 were designed using the ORF2 gene of bovine asteroid virus as a template.

3. The primer-probe combination for rapid simultaneous detection of bovine astrovirus and bovine norovirus as described in claim 1, characterized in that, The probe has a fluorescent group labeled at its 5' end and a quenching group labeled at its 3' end.

4. The primer-probe combination for rapid simultaneous detection of bovine astrovirus and bovine norovirus as described in claim 3, characterized in that, The fluorescent group is either FAM or HEX, and the quenching group is BHQ1.

5. A rapid dual isothermal RT-PCR detection method for simultaneous detection of bovine norovirus and bovine astrovirus, wherein the method is a non-diagnostic detection method, comprising the following steps: 1) Primer design and synthesis; 2) Construction of recombinant plasmid standards: Singleton isothermal fluorescence PCR amplification was performed using BAstV and BNoV strains as templates, respectively. The PCR products were recovered using a gel extraction kit to obtain the target fragment, which was then ligated into the pMD18-T vector and transformed into DH5α competent cells. After positive sequencing identification, the cells were subsequently expanded and cultured, and plasmids were extracted using a standard plasmid extraction kit. These were named recombinant plasmids pMD-18T-BAstV and pMD-18T-BNoV. The singleton isothermal fluorescence PCR amplification reaction system consisted of: 29.4 μL of absorber, 2.0 µL each of upstream and downstream primers (10 μM), 0.6 µL of probe, 5 µL of template, 2.5 µL of B buffer, and ddH2O to a final volume of 50 µL. The amplification program was: 39℃, 30 s, 40 cycles. 3) RNA extraction: Immerse the fecal swab directly into a centrifuge tube containing a nucleic acid release agent, and then vortex, let stand, and centrifuge briefly to obtain the RNA of the sample to be tested. 4) Dual-temperature quantitative PCR amplification reaction: Using the recombinant plasmid standard obtained in step 1) and the RNA of the sample to be tested obtained in step 2) as detection templates, prepare 50 µL of amplification reaction product according to the dual-temperature quantitative PCR amplification reaction. The dual-temperature quantitative PCR amplification reaction system is as follows: template 5 µL, A buffer 29.4 μL, AstV upstream and downstream primers 1.5 μL each, concentration 10 μM, AstV-P 0.6 μL, B buffer 2.5 µL, BNoV upstream and downstream primers 1 μL each, concentration 10 μM, BNoV-P 0.3 μL, and add ddH2O to make up to 50 µL. The amplification program is: 39℃, 30s, 40 cycles, while collecting fluorescence signals simultaneously. 5) Result detection: The amplification curve is plotted using the software built into the real-time PCR instrument, the corresponding Ct value is read, and the result is determined.

6. The rapid dual RT-PCR detection method for simultaneous detection of bovine norovirus and bovine astrovirus as described in claim 5, characterized in that, The concentration of the recombinant plasmid pMD-18T-BAstV was 197 ng / μL; the concentration of the recombinant plasmid pMD-18T-BNoV was 241.7 ng / μL.