Novel aptamers against EphA2 (type A hepatic ligand protein receptor 2)
By designing and optimizing specific region mutations and chemical modifications of nucleic acid aptamers, the shortcomings of existing anti-EphA2 targeting molecules in terms of binding and cell internalization have been overcome, enabling highly efficient targeted therapy and diagnosis of EphA2 cancers.
Patent Information
- Application Number
- CN202480065427.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-08-12
- Filing Date
- 2024-08-12
- Publication Date
- 2026-05-12
AI Technical Summary
Existing anti-EphA2 targeting molecules have shortcomings in terms of binding affinity, cell internalization, stability, and selectivity, making it difficult to effectively treat cancers such as EphA2-expressing Ewing sarcoma.
A series of novel nucleic acid aptamers were developed, which improved the binding affinity and cell internalization properties of the EphA2 receptor through mutations and chemical modifications in specific regions. The length and structural stability of the aptamers were optimized, including the definitions of regions 1, 2 and 3, which are suitable for the specific recognition of human EphA2 tumor receptors.
These new aptamers exhibit significantly enhanced binding and internalization properties, effectively inhibiting the migration and invasion of EphA2-expressing cancer cells and reducing adverse reactions, demonstrating potential applications in the diagnosis and treatment of EphA2-related diseases.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedicine. Specifically, it relates to novel aptamers for EphA2 (hepatitis A glycoprotein receptor 2), their chemically modified forms, and / or complexes containing any of them, as well as compositions containing any of these. The invention also relates to their use in methods for the detection or quantification of EphA2, or alternatively, in methods involving the detection or quantification of EphA2, such as for screening, diagnosis, prognosis, or monitoring of EphA2-related diseases. The invention further relates to the use of nucleic acid aptamers, complexes, or compositions in prophylactic and / or therapeutic methods for the treatment of EphA2-related diseases (such as EphA2-expressing cancers, including Ewing sarcoma), and related kits. Background Technology
[0002] Hepatic glycoprotein (Eph) receptors are the most extensive subfamily of receptor tyrosine kinases, involved in a variety of processes, including angiogenesis, tissue boundary formation, cell migration, and cell plasticity. These receptors are recognized mediators of intercellular interactions and movement and are expressed in human cancers. Among these receptors, EphA2 (hepatic glycoprotein receptor type A 2) has been involved in many processes crucial for malignant progression, such as migration, invasion, metastasis, proliferation, survival, and angiogenesis. Inhibition of EphA2 has been reported to reduce tumor growth, survival, and tumor-induced angiogenesis in multiple preclinical models of breast, ovarian, and pancreatic cancer (Tandon et al. 2011, Kasinski and Slack 2013; and Quinn et al. 2016).
[0003] It has been reported that various solid tumors express high levels of EphA2, such as ovarian cancer (Thaker, PH, et al. 2004, Lin, YG, et al. 2007), prostate cancer (Walker-Daniels, J., et al. 1999, Zhao, Y. et al. 2021), pancreatic cancer (Duxbury, MS, et al. 2004), glioblastoma (Wykosky, J., et al. 2005, Wang, LF, et al. 2008), lung cancer (Kinch, MS, et al. 2003), melanoma (Margaryan, Nv, et 2009, Udayakumar, D., et al. 2011), esophageal cancer (Miyazaki, T., et al. 2003), and colorectal cancer (Dunne, PD, et al. 2016, Kataoka, H., et al. 2004). Saito, T., et al. 2004), osteosarcoma (Giordano, G., et al. 2021, Posthumadeboer, J., et al. 2013), and breast cancer (Zhang, X. 2021, Brantley-Sieders, DM, et al. 2008, Zelinski, DP, et al. 2001). Furthermore, overexpression of the EphA2 receptor is associated with many of the invasive and metastatic potentials in these tumors (Zhao, Y., et al. 2021, Zelinski, DP, et al. 2001, Brantley-Sieders, DM, et al. 2005).
[0004] Ewing sarcoma (ES) is a rare type of cancer that occurs in or around the bone. It accounts for approximately 35% of all sarcoma cases and is a leading cause of cancer morbidity and mortality, especially in children. About 25% of these patients already have metastatic disease at diagnosis, and due to the lack of effective treatments, their survival rate at that time is only 20%. Conventional chemotherapy, such as vincristine, cyclophosphamide, and doxorubicin, is currently the only approved treatment for ES. These non-specific drugs have limited efficacy and harmful side effects due to their toxicity. Against this backdrop, there is a need to develop new targeted, selective, and effective solutions for treating this devastating cancer.
[0005] Several strategies for targeting and regulating EphA2 activation have been described. Monoclonal antibodies mimicking the function of hepatocyte ligand A1 (Carles-Kinch, K., et al. 2002, Yang, Y., et al. 2021) and targeting the large extracellular domain of EphA2, which is frequently upregulated in tumor cells (Biao-xue, R., et al. 2011), have been developed. Peptides and antibodies binding to hepatocyte ligand binding pockets have been used for the specific delivery of cytotoxins, but their application is limited due to moderate binding affinity (Jackson, D., et al. 2008, Koolpe, M., et al. 2002, Wang, S., et al. 2012).
[0006] Aptamers are short, single-stranded nucleic acid oligomers (ssDNA or RNA) that form complex three-dimensional shapes and bind to target molecules with high affinity and specificity. Aptamers offer key advantages over antibodies; for example, they can be chemically synthesized and chemically modified to fine-tune their properties for specific applications, such as increasing serum stability, improving pharmacokinetics, and delivering small molecules or imaging agents (Odeh, F., et al. 2019). Furthermore, chemically modified RNA aptamers may exhibit little to no immunogenicity, thereby improving the safety of clinical applications. Therefore, aptamers have emerged as promising candidates for diagnostic and targeted therapeutic applications, often in the form of aptamer-drug conjugates.
[0007] WO2020245076 A1 describes a 2'-fluoromodified pyrimidine RNA aptamer that specifically binds to EphA2 for the treatment or diagnosis of EphA2-expressing tumors. Specifically, it describes the RNA aptamer of SEQ ID NO:1 as being able to bind to and be internalized by the EphA2 receptor, thereby providing its own anticancer effects. A recent article also mentions an undisclosed 2'-fluoromodified pyrimidine anti-EphA2 RNA aptamer and its antitumor properties, particularly in Ewing sarcoma (Santana-Viera et al. Molecular Therapy: Nucleic Acids Vol. 32 June 2023).
[0008] There is a need to find new anti-EphA2 targeting molecules, such as aptamers, that possess low immunogenicity, improved stability, binding (e.g., affinity, specificity, and / or selectivity), targeting cell internalization, tissue penetration, anti-proliferation, and / or anti-metastasis properties.
[0009] In addition, obtaining anti-EphA2 aptamers of 50 or fewer nucleotides is also desirable, as shorter aptamer size is associated with lower synthetic errors and costs as well as improved stability (Adachi T, et al. 2019). Summary of the Invention
[0010] As described herein, the inventors have generated novel aptamers that have been shown to specifically recognize the human EphA2 tumor receptor with high binding and / or internalization properties.
[0011] The sequence with SEQ ID NO:2 (GGGAGGACGAUGCGGUCCUU) described in WO2020245076 A1 (WO'076) is GUCGUCUUGCGUCCCCAGACGACUC The 51nt anti-EphA2 aptamer of GCCCGA, referred to herein as AptP or SEQ ID NO: 109, has been used for comparative purposes. The predicted conformational structure of AptP is as follows: Figure 1 As shown in Figure A.
[0012] In fact, the inventors have identified a series of anti-EphA2 aptamers (see Tables 2.1 and 2.2), characterized in that regions 5' to 3' comprise the three regions identified as region 1 (R1), region 2 (R2), and region 3 (R3) in the first aspect of the invention, and found that these aptamers have improved binding and / or internalization properties compared to the anti-EphA2 aptamer of SEQ ID NO:2 described in WO'076. In a preferred embodiment, the aptamer has formula (I) as defined herein.
[0013] This was completely unexpected, because these aptamers, compared to AptP, share a common mutation in the core region defined in WO'076 as SEQ ID NO:1 (underlined in SEQ ID NO:2 above, referred to as SEQ ID NO:110 in this document). The authors of WO'076 describe this region as a functional loop essential for EphA2 binding activity, emphasizing that any substitution must be outside this region (see page 16, line 20 to page 17, line 8).
[0014] In fact, the aptamer of the first aspect of the invention has two distinct mutations in its region 2 (R2) compared to AptP, more specifically, G before n21 and U after n28. For example, the aptamer of formula I (see Figure 1E) differs from AptP at least in that the aptamer of formula (I) has "G" instead of "U" at position 20, and "U" instead of "G" at position 29. These are highlighted in bold in SEQ ID NO:2 of WO'076 above. It can be observed that the mutation at position 29 falls within the defined core region of AptP, while position 20 is adjacent to it.
[0015] From a selected group of anti-EphA2 aptamers, the inventors identified a small subset of aptamers exhibiting superior internalization properties in cell lines expressing the EphA2 receptor. In fact, in the Ewing sarcoma cell line A673, Apt4, Apt6, Apt46, Apt47, Apt49, Apt54, Apt61, Apt63, Apt64, Apt66, and Apt67 showed at least approximately a 5-fold improvement compared to AptP. Figure 2 (A to 2C). Among them, Apt46, Apt47, Apt49, and Apt64 were found to have even higher intracellular cellularity properties, reaching 10 times or more of AptP (Apt46 to 2C). Figure 2 B). Intracellularization assays of Apt47, Apt49, and Apt66 were also performed in other EphA2 receptor-expressing cell lines (e.g., breast cancer and rhabdomyosarcoma cell lines), with Apt49 and Apt66 showing superior intracellularization properties compared to AptP in these cell lines as well. Figure 3 E). The internalization of Apt66 was also tested in two other metastatic melanoma and pancreatic adenocarcinoma lines expressing the EphA2 receptor, and the results also showed that it had superior internalization properties compared to AptP. Figure 3 E).
[0016] Regarding its binding properties ( Figure 2 (A to 2C), the following aptamers showed at least approximately 2-fold improvement over Apt: Apt2, Apt4, Apt13, Apt14, Apt31, Apt34, Apt35, Apt39, Apt43, Apt44, Apt46, Apt49, Apt53, Apt54, Apt59, Apt60, Apt61, Apt63, Apt64, Apt65, Apt66, Apt67, Apt75, Apt78, Apt79, Apt86, and Apt87. The most promising candidates are Apt14, Apt31, Apt54, and Apt67, which showed 4-fold or greater improvement over AptP. The affinity properties of candidates Apt49, Apt54, and Apt60 are as follows: Figure 6 As shown in A to 6C.
[0017] AptP is characterized by a 3-stem structure, which is predicted to be a more stable folding structure. A diagram of the three-dimensional structure of AptP is shown below. Figure 1 A.2. Unexpectedly, it was found that the predicted loop 1 in AptP could be almost completely deleted without loss of binding and / or internalization activity. Figure 2 B to 2C), for example, when the fit of formula (I) is n9 to n 13 This is the case when two or more of them are not present, as is the case in Apt47, Apt51, Apt52, Apt53 and Apt66.
[0018] Aptamers with improved binding properties are important for detection (e.g., screening, diagnosis, prognosis, or monitoring) and for therapeutic or preventative treatment purposes. Furthermore, aptamers with favorable internalization properties are desirable when conjugated to functional parts that will exert their activity within the cell (e.g., antisense oligonucleotides, siRNA, microRNA, shRNA, or ribozymes).
[0019] These new aptamers will enable anti-tumor drugs to be delivered efficiently and selectively to tumor cells without affecting healthy cells. Therefore, the specific release of anti-tumor drugs into target tumor cells leads to a reduction in unwanted adverse reactions compared to non-targeted therapies.
[0020] As described above, EphA2 has previously been described as playing a role in cancer proliferation and metastasis. The ability of some of the most promising candidates in terms of binding and internalization properties—Apt46, Apt47, Apt49, Apt63, Apt66, and Apt75—to inhibit the migration of EphA2-expressing cancer cells (i.e., Ewing sarcoma A673 cells) was tested. Treatment of A673 cells with all tested aptamer candidates resulted in a significant reduction in the in vitro migration and invasion abilities of A673 cells compared to untreated cells (blank). Figure 3 (A to B). Another method for assessing cell migration ability was also used, testing Apt66 in other EphA2-expressing cell lines such as TC252 and SK-N-MC (Ewing sarcoma), RH4 (rhabdomyosarcoma), MDA-MB231 (breast cancer), and A375 (metastatic melanoma). Treatment with Apt66 resulted in reduced migration ability in all tested cell models compared to untreated cells. Figure 3 C and Figure 3 F). This demonstrates the anti-transfer properties of the anti-EphA2 aptamer itself (i.e., not conjugated to the functional part as described above).
[0021] The aptamers of the present invention may include chemical modifications as described herein at one or more sites. For illustrative purposes, Apt49 was chemically modified by introducing phosphate thioester (PTO) and 2'-O-methylation (2'OMe) modifications, and it was shown to retain its intracellular properties (see...). Figure 4(A to 4D).
[0022] Example 5 emphasizes the criticality of the modification of positions 20 and 29 of the aptamer of Formula I relative to AptP. In fact, as... Figure 5 As shown in B, mutations at these locations lead to a sharp reduction in aptamer incorporation.
[0023] Finally, Example 6 shows that 44 of the 56 positive sequences have a 3-stem structure as their predicted most stable fold.
[0024] Therefore, a first aspect of the present invention relates to a nucleic acid aptamer that specifically binds to EphA2, preferably human EphA2, said aptamer comprising three polynucleotide regions provided in the 5' to 3' sequence of the aptamer as defined below: region 1, region 2, and region 3, wherein:
[0025] i. Region 1 has equation (R1):
[0026] 5' n1n2G AG n6n7C n9 n 10 n 11 n 12 n 13 GG n 16 n 17 C 3'
[0027] in:
[0028] n1 and n2 are independently selected from G, dG, or -;
[0029] n6 is G, dG, or -;
[0030] n7 is A, dA, or -;
[0031] n9 is G, dG, or -;
[0032] n 10 It is A, dA, or -;
[0033] n 11 It is U, dU, or -;
[0034] n 12 It is G, dG, or -;
[0035] n 13 It is C, dC, or -;
[0036] n 16 It is U, dU, or -;
[0037] n 17 It is C, dC, or -;
[0038] Where G, A, U, and C are ribonucleotides; dG, dA, dU, and dC are 2'-deoxyribonucleotides, wherein unless otherwise specified, the corresponding nucleotides include unmodified nucleotides and their modified forms, and "-" indicates the absence of nucleotides;
[0039] The premise is:
[0040] n6 and n 17 Neither the complementary nucleotide nor, alternatively, is present.
[0041] n7 and n 16 Neither the complementary nucleotide nor, alternatively, is present.
[0042] In a preferred embodiment, when n1 is -, n 12 Yes; and
[0043] Preferably, when n7 is -, n 11 It is U or dU;
[0044] ii. Region 2 has equation (R2):
[0045] 5' UG n 21 n 22 n 23 n 24 n 25 UG n 28 UC n 31 UCCCCA n 38 n 39 n 40 n 41 n 42 3'
[0046] in:
[0047] n 21 It is U, dU, or -;
[0048] n 22 It is C, dC, or -;
[0049] n 23 It is G, dG, or -;
[0050] n 24 It is U, dU, or -;
[0051] n 25 It is C, dC, or -;
[0052] n 28 It is U, dU, or -;
[0053] n 31 It is G, dG, or -;
[0054] n 38 It is G, dG, or -;
[0055] n 39 It is A, dA, or -;
[0056] n 40 It is C, dC, or -;
[0057] n 41 It is G, dG, or -;
[0058] n 42 It is A, dA, or -;
[0059] The premise is:
[0060] n 21 and n 42 Neither the complementary nucleotide nor, alternatively, is present.
[0061] n 22 and n 41 Neither the complementary nucleotide nor, alternatively, is present.
[0062] n 23 and n 40 Neither the complementary nucleotide nor, alternatively, is present.
[0063] n 24 and n 39 Neither complementary nucleotides nor, alternatively, are present; and
[0064] n 25 and n 38 Neither the complementary nucleotide nor, alternatively, is present.
[0065] iii. Region 3 has equation (R3):
[0066] 5' CUCGC n 48 n 49 n 50 n 51 3'
[0067] in:
[0068] n 48 It is C, dC, or -;
[0069] n 49 It is C, dC, or -;
[0070] n 50 It is G, dG, or -;
[0071] n 51 It is A, dA, or -;
[0072] The premise is:
[0073] n1 of R1 and n of R3 49 Neither is a complementary nucleotide nor, alternatively, is present; and
[0074] n2 of R1 and n of R3 48 Neither the complementary nucleotide nor, alternatively, is present.
[0075] The preferred aptamer is further characterized in that:
[0076] a) Having a length of 50 or fewer nucleotides; and / or
[0077] b) R1 of n 11 and / or n 12 It does not exist.
[0078] In a second aspect, the present invention provides nucleic acid aptamers that specifically bind to EphA2, preferably human EphA2, wherein the nucleic acid aptamer is selected from the aptamers of the sequences identified in Tables 2.1 and / or 2.2, or variants having at least 85%, preferably at least 90%, more preferably at least 95% identity with any of them.
[0079] In a third aspect, the present invention relates to a method for producing nucleic acid aptamers of the first or second aspect. In some embodiments, the method includes synthesizing the aptamer using a phosphoramidite method via standard solid-phase synthesis. In other embodiments, the nucleic acid aptamer is synthesized by in vitro transcription using a standard or modified reverse transcriptase or as a direct result of an exponential enrichment ligand systematic evolution (SELEX) process.
[0080] In a fourth aspect, the present invention provides a complex comprising an aptamer and one or more portions as defined in the first or second aspect of the present invention.
[0081] In a fifth aspect, the present invention relates to a method for producing the compound of the fourth aspect of the present invention, wherein the method comprises:
[0082] (i) Providing a nucleic acid aptamer according to the first aspect of the present invention; and
[0083] (ii) Connecting the aptamer directly or indirectly to one or more of the parts described herein.
[0084] In a sixth aspect, the present invention provides compositions comprising an aptamer as defined in the first or second aspect of the invention or a complex as defined in the fourth aspect of the invention.
[0085] In a seventh aspect, the present invention provides aptamers as defined in the first or second aspect of the invention, complexes as defined in the fourth aspect of the invention, or compositions as defined in the sixth aspect of the invention, which are used as medicines alone or in combination therapy.
[0086] In an eighth aspect, the present invention provides the use of an aptamer as defined in the first or second aspect of the invention or a complex as defined in the fourth aspect of the invention as an EphA2 detection or quantification agent; or as an internalization mediator for cells that target EphA2 expression.
[0087] In a ninth aspect, the present invention provides aptamers as defined in the first or second aspect of the invention, complexes as defined in the fourth aspect of the invention, or compositions as defined in the sixth aspect of the invention, for use in in vivo methods for the detection of a disease; or for use in in vivo methods for the detection or quantification of a target protein; or alternatively, for use in methods including the detection or quantification of a target protein, such as methods for in vivo screening, diagnosis, prognosis, or monitoring of a disease, wherein an increase or decrease in the level of the target protein has been associated with the presence or prognosis of the disease. In some embodiments, the method is used for the in vivo detection of EphA2 or cells expressing EphA2, and the method is used for the detection of EphA2-related diseases. In a preferred embodiment, the cells expressing EphA2 are cancer cells expressing EphA2, and the disease is cancer expressing EphA2.
[0088] This aspect can alternatively be described as a method for in vivo detection (e.g., screening, diagnosis, or monitoring) or prognosis of a disease in a subject, such as an EphA2-related disease, wherein the disease is characterized by comprising cells expressing EphA2, the method comprising the steps of: (a) administering to the subject an effective amount of an aptamer as defined in the first or second aspect of the invention, a complex as defined in the fourth aspect of the invention, or a composition as defined in the sixth aspect of the invention; (b) determining the amount of EphA2 in vivo (e.g., by directly or indirectly detecting the amount of aptamer bound to EphA2); and (c) comparing it to a reference value; wherein if the amount of EphA2 in the sample increases or decreases relative to the reference value (e.g., deviates statistically), it indicates the presence (e.g., the subject has) an EphA2-related disease or the worst prognosis for an EphA2-related disease. In some implementations, the presence or prognosis of a disease is associated with an increase in EphA2 levels (e.g., cancer characterized by expressing EphA2 as defined herein), and an increase in the amount of EphA2 in a sample relative to a reference value indicates the presence (e.g., the subject has) an EphA2-related disease or the worst prognosis associated with an EphA2-related disease.
[0089] In a tenth aspect, the present invention provides the use of nucleic acid aptamers as defined in the first or second aspect of the invention, complexes as defined in the fourth aspect of the invention, or compositions as defined in the sixth aspect of the invention as detection or quantification agents, for use in in vitro or ex vivo detection methods for diseases, or for use in in vitro or ex vivo detection or quantification methods for target proteins; or alternatively, for use in in vitro or ex vivo detection or quantification methods including target proteins, for example, for in vitro or ex vivo screening, diagnosis, prognosis, or monitoring of diseases, wherein an increase or decrease in the level of said target protein has been associated with the presence or prognosis of the disease. In some embodiments, the method is used for in vitro or ex vivo detection of EphA2 or cells expressing EphA2, and the method is used for detection of EphA2-related diseases. In a preferred embodiment, said cells expressing EphA2 are cancer cells expressing EphA2, and the disease is cancer expressing EphA2.
[0090] This aspect can alternatively be described as a method for in vitro or ex vivo detection (e.g., screening, diagnosis, or monitoring) or prognosis of a disease of the subject, such as an EphA2-related disease, wherein the disease is characterized by comprising cells expressing EphA2, the method comprising the steps of: (a) contacting an aptamer as defined in the first aspect of the invention, a complex as defined in the fourth aspect of the invention, or a composition as defined in the sixth aspect of the invention with a separated test sample from the subject; (b) determining the amount of EphA2 in the test sample (e.g., by directly or indirectly detecting the amount of aptamer bound to EphA2); and (c) comparing it with a reference value; wherein if the amount of EphA2 in the sample increases or decreases relative to the reference value (e.g., deviates statistically), it indicates the presence (e.g., the subject has) an EphA2-related disease or the worst prognosis for an EphA2-related disease. In some implementations, the presence or prognosis of a disease is associated with an increase in EphA2 levels (e.g., cancer characterized by expressing EphA2 as defined herein), and an increase in the amount of EphA2 in a sample relative to a reference value indicates the presence (e.g., the subject has) an EphA2-related disease or the worst prognosis associated with an EphA2-related disease.
[0091] In an eleventh aspect, the present invention provides a kit for detecting or quantifying EphA2, comprising an aptamer as defined in the first or second aspect of the invention, a complex as defined in the fourth aspect of the invention, or a composition as defined in the sixth aspect of the invention, and optionally means for detecting the aptamer or complex.
[0092] In a twelfth aspect, the present invention provides a method for detecting or quantifying EphA2, wherein the method includes the step of detecting or quantifying EphA2 using an aptamer as defined in the first or second aspect of the invention, a complex as defined in the fourth aspect of the invention, a composition as defined in the sixth aspect of the invention, or a kit as defined in the eleventh aspect of the invention.
[0093] In a thirteenth aspect, the present invention provides the use of a kit comprising an aptamer, complex, or composition as defined in the eleventh aspect of the invention for the detection or quantification of EphA2.
[0094] In methods for the in vitro or ex vivo detection or quantification of EphA2, or
[0095] Methods for the in vitro or ex vivo detection or quantification of EphA2 for the screening, diagnosis, prognosis, or monitoring of EphA2-related diseases, such as cancers expressing EphA2.
[0096] In a fourteenth aspect, the present invention provides aptamers as defined in the first or second aspect of the invention, complexes as defined in the fourth aspect of the invention, or compositions as defined in the sixth aspect of the invention, for use in a method of preventive or therapeutic treatment of cancer or EphA2-related diseases, preferably cancers expressing EphA2.
[0097] This aspect can also be described as the use of aptamers, complexes, or pharmaceutical compositions as defined above in the preparation of medicaments for treating cancer or EphA2-related diseases, preferably cancers expressing EphA2. This aspect can also be described as a method for treating a subject with cancer or an EphA2-related disease, preferably cancers expressing EphA2, the method comprising administering a therapeutically effective amount of an aptamer, complex, or pharmaceutical composition as defined above to a subject in need. Attached Figure Description
[0098] Figure 1The structure predicted by computer simulation. A) The conformational structure of AptP, showing the predicted loops and stems, A.1.) generated using RNAfold WebServer, A.2.) generated using Mfold (Gruber AR, Lorenz R, Bernhart SH, Neuböck R, Hofacker IL. The Vienna RNA Websuite. Nucleic Acids Research, Volume 36, Issue suppl_2, 1 July 2008, Pages W70-W74; Lorenz, R. and Bernhart, SH and Höner zu Siederdissen, C. and Tafer, H. and Flamm, C. and Stadler, PF and Hofacker, IL "ViennaRNA Package 2.0", Algorithms for Molecular Biology, 6:1 page(s): 26, 2011), the predicted structure is a 3-stem conformation (stem 1 is dotted, stem 2 is gray, stem 3 is black), which also has two loops called L1 and L2, as shown in the figure. B) Examples of computer simulation structures within groups Apt1 to Apt29. C) Examples of computer simulation prediction structures within groups Apt30 to Apt64. D) Three computer simulation structures within groups Apt65 to Apt108. Figure 1 The fitter with the underlined form in B and C is used for Figure 3 The aptamer for migration assay is shown in Figure E. A diagram showing the aptamer of formula (I) and its corresponding nucleotides from position 1 to 51.
[0099] Figure 2 Binding and in vitro internalization results. A) Binding and in vitro internalization results of Apt1 to Apt29 in A673 cells. B) Binding and in vitro internalization results of Apt30 to Apt64 in A673 cells. C) Binding and in vitro internalization results of Apt65 to Apt108 in A673 cells.
[0100] Figure 3 Functional assays. A) Representative images of A673 cells treated with different aptamers, taken using a Nikon 600 inverted microscope. B) Assays performed using the best candidate selected based on binding and internalization studies. Figure 3A) Quantitative migration assay. C) “Wound healing” migration assay in A673, TC252, and SK-N-MC Ewing sarcoma cell lines. Representative microscopic images and quantifications of free regions of cells from independent experimental replicates are shown. D) EphA2 receptor expression in different cancer types. This figure was prepared by the inventors using data from the Cancer Genome Atlas Project (TCGA) database. E) Adaptin incorporation in different EphA2-expressing cell lines. F) “Wound healing” migration assay in EphA2-expressing cell lines MDA-MB-231 (breast cancer), RH4 (rhabdomyosarcoma), A375 (metastatic melanoma), and PANC-1 (pancreatic adenocarcinoma). Representative microscopic images and quantifications of free regions of cells from independent experimental replicates are shown.
[0101] Figure 4 Chemical modifications. A) Apt49 aptamer and its chemical modifications. B) Phosphothiophosphate backbone modification (PTO) and its effect on internalization. C) Modification of segmented 2'-O-methyl sugars (2'OMe) and its effect on aptamer internalization. D) Individual 2'OMe modifications and their internalization results.
[0102] Figure 5 Base substitutions and their relevance to aptamer function. Nucleotides at positions 20 and 29 of substitution I in Apt49 and their effects on A) the predicted secondary aptamer structure and B) aptamer incorporation.
[0103] Figure 6 The folded structure predicted by Apt49. The region with the 3-stem structure is highlighted (caption: stem 1 is dotted, stem 2 is gray, and stem 3 is black).
[0104] Figure 7 Kinetic studies. Exemplary binding curves for the Apt49, Apt54, and Apt60 candidates measured by SPR. Calculated ka mean versus kd mean plotted. AptP measurements shown as a reference. Detailed Implementation
[0105] In a first aspect, the present invention provides a nucleic acid aptamer as defined above that specifically binds to EphA2, preferably human EphA2.
[0106] As used herein, the term "aptamer" generally refers to a single defined sequence of oligonucleotide or a mixture of said oligonucleotides, wherein the mixture retains the property of specifically binding to EphA2. As used herein, "aptamer" refers to a single-stranded nucleic acid. Preferably, the aptamers of this disclosure are structure-based protein-binding oligonucleotides.
[0107] As used herein, the term "oligonucleotide" is a collective term for polydeoxyribonucleotides (containing 2'-deoxy-D-ribose or a modified form thereof) (i.e., DNA), polyribonucleotides (containing D-ribose or a modified form thereof) (i.e., RNA), and any other type of polynucleotide (which is an N-glycoside or C-glycoside of a purine or pyrimidine base or a modified purine or pyrimidine base, or a baseless nucleotide). According to this disclosure, the term "oligonucleotide" includes not only those having conventional bases, sugar residues, and nucleotide bonds, but also those containing modifications to any one or all of these three parts (hereinafter also referred to as "modified nucleotides").
[0108] The term "base" may be used interchangeably with "nucleotide base," "nucleobase," or "residue." In some embodiments, the aptamer is an RNA aptamer, and the nucleotide is a ribonucleotide. As used herein, the term "RNA-aptamer" refers to an aptamer that contains a ribonucleoside unit, such as adenosine, guanosine, 5-methyluridine, uridine, 5-methylcytidine, cytidine, pseudouridine, inosine, N6-methyladenosine, flavin, and huaistinoside.
[0109] In some embodiments, the “nucleotide base” of the ribonucleotide is selected from guanine (G), adenine (A), uracil (U), or cytosine (C) and their modified forms as described below. The term “base” may also be used herein to refer to “nucleotide” in general.
[0110] As used herein, L-nucleic acid is a nucleic acid or nucleic acid molecule composed of L-nucleotides, preferably entirely of L-nucleotides. As used herein, D-nucleic acid is a nucleic acid or nucleic acid molecule composed of D-nucleotides, preferably entirely of D-nucleotides. Unless explicitly indicated to the contrary, the terms nucleic acid and nucleic acid molecule are used interchangeably herein. Furthermore, unless indicated to the contrary, any nucleotide sequence is listed herein in a 5' → 3' orientation.
[0111] Regardless of whether the nucleic acid molecule of the present invention is composed of D-nucleotides, L-nucleotides, or a combination of both (wherein such combination is, for example, a random combination or a defined sequence of a segment consisting of at least one L-nucleotide and at least one D-nucleotide), the nucleic acid may be composed of deoxyribonucleotides, ribonucleotides, or combinations thereof. Nucleic acid molecules composed of both ribonucleotides and 2'-deoxyribonucleotides are also within the scope of the present invention. To distinguish between ribonucleotides and 2'-deoxyribonucleotides in the sequence of the nucleic acid molecule of the present invention, the following reference codes are used herein.
[0112] The nucleic acid molecule according to the present invention can be composed of 2' deoxyribonucleotides, wherein
[0113] dG is 2'-deoxy-guanosine-5'-monophosphate.
[0114] dC is 2'-deoxy-cytidine-5'-monophosphate.
[0115] dA is 2'-deoxy-adenosine-5'-monophosphate.
[0116] dT is 2'-deoxy-thymidine-5'-monophosphate, and
[0117] dU is 2'-deoxyuridine-5'-monophosphate.
[0118] The nucleic acid molecule according to the present invention can be composed of ribonucleotides, wherein
[0119] G is guanosine-5'-monophosphate.
[0120] C is cytidine-5'-monophosphate.
[0121] A is adenosine-5'-monophosphate.
[0122] U is uridine-5'-monophosphate, and
[0123] rT is methyluridine-5'-monophosphate (ribothymidine monophosphate).
[0124] Unless otherwise stated, the ribonucleotides and deoxyribonucleotides described above may be conventional (unmodified) nucleotides or modified forms thereof as described herein.
[0125] Complementarity is achieved through different interactions between nucleobases: adenine-uracil / thymine, and guanine-cytosine. Adenine and guanine are purines, while cytosine, thymine, and uracil are pyrimidines. Purines are larger than pyrimidines. The two types of molecules are complementary to each other and can only pair with nucleobases of opposite types. In nucleic acids, nucleobases pair with each other via hydrogen bonds, which only works effectively between adenine and uracil / thymine, and between guanine and cytosine.
[0126] The table below provides the alternative complementary nucleotides (column 2) for each nucleotide defined above (first column):
[0127]
[0128] In a preferred embodiment, the complementary nucleotides are as follows:
[0129]
[0130] The term "nucleotide" also includes "modified nucleotide." The term "modified" encompasses nucleotides having covalently modified bases and / or sugars. For example, modified nucleotides include nucleotides having a sugar covalently linked to a low molecular weight organic group other than a hydroxyl group at the 3' position and a phosphate group at the 5' position. Therefore, modified nucleotides may also include 2'-substituted sugars, such as 2'-O-methyl; 2'-O-alkyl; 2'-O-allyl; 2'-S-alkyl; 2'-S-allyl; 2'-fluoro-; 2'-halogenated or 2'-azido-ribose, carbocyclic sugar analogs, terminal isomers; epimeric sugars such as arabinose, xylose or lythose, pyranose, furanose, and sedoheptulose. Modified nucleotides are known in the art and, by way of example and not limitation, include: alkylated purines and / or pyrimidines; acylated purines and / or pyrimidines; or other heterocycles. These classes of pyrimidines and purines are known in the art, including: pseudoisocytosine; N4,N4-ethane-bridged cytosine; 8-hydroxy-N6-methyladenine; 4-acetylcytosine, 5-carboxyhydroxymethyluracil; 5-fluorouracil; 5-bromouracil; 5-carboxymethylaminomethyl-2-thiouracil; 5-carboxymethylaminomethyluracil; dihydrouracil; inosine; N6-isopentenyl-adenine; 1-methyladenine; 1-methylpseudouracil; 1-methylguanine; 2,2-dimethylguanine; 2-methyladenine; 2-methylguanine; 2-methylguanine; 3-methylcytosine; 5-methylcytosine; 6-methyladenine; 7-methylguanine; 5-methylaminomethyluracil; 5-methoxyaminomethyl-2-thiouracil; β -D-Mannosylqueosine; 5-Methoxycarbonylmethyluracil; 5-Methoxyuracil; N6-(2-Isopentenyl)adenine; Methyluracil-5-oxyacetate; Pseudorazine; 2-Thiocytosine; 5-Methyl-2-Thiouracil; 2-Thiouracil; 4-Thiouracil; 5-Methyluracil; N-Uracil-5-oxyacetate; Uracil-5-oxyacetic acid; β-D-mannosylqueosine; 2-Thiocytosine; 5-propyluracil; 5-propylcytosine; 5-ethyluracil; 5-ethylcytosine; 5-butyluracil; 5-pentyluracil; 5-pentylcytosine; and 2,6,-Diaminopurine; Methylpseudorazine; L-Methylguanine; 1-Methylcytosine.
[0131] In some embodiments, one or more nucleotides of the nucleic acid aptamer are chemically modified (Odeh F, et al. 2019. Aptamers Chemistry: Chemical Modifications and Conjugation Strategies. Molecules. 2019 Dec 18;25(1):3, Chen Z et al. 2023). In some embodiments, the chemical modification includes one or more of the following and combinations thereof:
[0132] i. Modifications to the sugar ring, such as 2'-substitution, 4'-oxygen being replaced by a sulfur atom, or locked nucleic acids (LNAs).
[0133] ii. Modifications to the phosphodiester bond, such as methylphosphonate or thiophosphate and triazole modification; and
[0134] iii. Modifications on nucleic acid bases, such as the C5 position of pyrimidine and the N7 position of purine.
[0135] In other embodiments, aptamer modifications include one or more of the following, and combinations thereof: (a) nucleotides modified by replacing the 2' position with a fluorinated (F), amino (NH2), or O-methyl (OCH3) group to enhance nuclease resistance. These modified nucleotides are introduced chemically or enzymatically. (b) Enzymatically introduced bridged thiophosphates. (c) Terminal caps involving chain polarity reversal introduced during chemical synthesis. (d) Linkers inserted at the 5' end of the aptamer chemically or enzymatically to provide a conjugation handle or alter pharmacokinetic properties. Keefe et al, Aptamers astherapeutics, Nat Rev Drug Discov. 2010 Jui;9(7):537-50.
[0136] In some implementations, modification at the 2' position of the ribose indirectly improves nuclease resistance to the phosphate ester bond between nucleotides, while also increasing double-strand stability (Tm) and providing protection against immune activation. 2'-O-methylRNA (2'OMe) is a naturally occurring RNA variant found in mammalian ribosomal RNA and transfer RNA.
[0137] In some embodiments, at least one, preferably all pyrimidine moieties, of the nucleotide sequence are 2'-substituted pyrimidines. For example, the one or more 2' substitutions are selected from 2'-F (2'-fluorine), 2'-MOE (2'-methoxyethyl), and 2'-OMe (2'-O-methyl).
[0138] In some embodiments, all pyrimidines are 2'-F substituted pyrimidines. In other embodiments, the aptamer contains a 2'F / 2'OMe modification. The number and order of the 2'F and 2'OMe modifications are not particularly limited. For example, they can be randomly combined, alternating, or in bulk, and can comprise two or more consecutive nucleotides having the same modification. In a preferred embodiment, the aptamer is a modified form of Apt49 (SEQ ID NO: 49), characterized by having a 2'F modification in all pyrimidines, wherein the 2'F modification is replaced by a 2'-OMe modification at one or more positions at positions 2, 9, 10, 13, 16, or 19 of Apt49.
[0139] Locked nucleic acids (LNAs) contain methylene bridges that connect the 2'-O and 4'-C of the ribose. These methylene bridges "lock" the sugar in the 3'-internal conformation, significantly increasing both Tm and nuclease resistance. In some embodiments, the aptamers of the present invention may comprise LNAs, for example, in hybrid RNA-LNA oligonucleotides.
[0140] As used herein, the term "specific binding" should be understood as the frequency, rate, duration, and / or affinity of an aptamer to react or associate with a specific cell or substance compared to its affinity for alternative cells or substances. For example, an RNA aptamer that specifically binds to a target protein exhibits a higher affinity, efficiency, and / or duration of binding to that protein or its epitope or immunogenic fragment than it does with unrelated proteins and / or their epitopes or immunogenic fragments. It is also understood from this definition that, for example, an RNA aptamer that specifically binds to a first target may or may not specifically bind to a second target. Therefore, "specific binding" does not necessarily require exclusive binding or undetectable binding to another molecule, which is included in the term "selective binding." Generally, but not necessarily, references to binding refer to specific binding.
[0141] As used herein, the term "affinity" can refer to the equilibrium constant (KD) of the dissociation of an antigen from an antigen-binding molecule, and is considered a measure of the binding strength between an antigenic determinant and an antigen-binding site on the antigen-binding molecule: the smaller the KD value, the stronger the binding strength between the antigenic determinant and the antigen-binding molecule (or, affinity can also be expressed as the association constant (KA), which is 1 / KD). Those skilled in the art will understand that the dissociation constant can be either the actual or apparent dissociation constant. KD can also be expressed as the ratio of the complex dissociation rate constant (denoted as koff) to its association rate (denoted as kon) (therefore, KD = koff / kon and KA = kon / koff). The unit of the dissociation rate koff is seconds. -1 (Where s is the SI symbol for the second). The unit of the association rate kon is M. -1 s -1 The association rate can reach 10.2 M -1 s -1 To about 10 7 M -1 s -1 The variation between these values approaches the diffusion-limited association rate constant of bimolecular interactions. The dissociation rate is related to the half-life of a given molecular interaction, with the relationship being t0. 1 / 2 =ln(2) / koff. The dissociation rate can be 10 -6 s -1 (Nearly irreversible complex, t) 1 / 2 (For several days) to 1 second -1 (t) 1 / 2 The affinity between two molecules varies between 0.69 s. The affinity of the molecular interaction between two molecules can be measured using various techniques known per se, such as the well-known surface plasmon resonance (SPR) biosensor technique (see, for example, Ober et al., Intern. Immunology, 13, 1551-1559, 2001), where one molecule is immobilized on a biosensor chip, and the other molecule flows through the immobilized molecule under flow conditions, generating kon, koff measurements, thus yielding the KD (or KA) value. This can be performed, for example, using the well-known BIACORE instrument.
[0142] As used in this article, the term "affinity" refers to a measure of the strength of binding between an antigen-binding molecule and its associated antigen. Affinity is related to both the affinity between the antigenic determinant and its antigen-binding site on the antigen-binding molecule and the number of associated binding sites present on the antigen-binding molecule.
[0143] The aptamers of this invention are characterized by their ability to bind to EphA2. The ability of an aptamer to bind to EphA2 can be determined by any suitable method that allows determination of the binding between two molecules (e.g., between an affinity agent (e.g., an antibody or aptamer) and its target antigen). These methods include, for example, surface plasmon resonance (SPR) or competitive binding assays, such as radioimmunoassay (RIA), enzyme immunoassay (EIA), and sandwich competitive assays, and various variations thereof known in the art; as well as other techniques mentioned herein. Those skilled in the art will understand that variations of these antibody-based methods can be used to determine the ability of the aptamers of this invention to specifically bind to EphA2, wherein the affinity agent is an aptamer rather than an antibody as defined herein.
[0144] In one implementation, the ability of an aptamer to bind to EphA2 is determined by contacting cells expressing EphA2 with a previously labeled aptamer (e.g., using a fluorophore). If a signal (e.g., a fluorescent signal) is present within the cell, it indicates that the aptamer has bound to EphA2 and is subsequently internalized. In an alternative implementation, cells expressing EphA2 are contacted with the aptamer, and after a period of time, the amount of intracellular aptamer (e.g., RNA-aptamer) is determined by RT-PCR using primers that amplify the aptamer sequence. Those skilled in the art will know how to design specific primers and probes from the aptamer sequence.
[0145] EphA2 (hepatic glycoside receptor type A 2) is a protein encoded by the EPHA2 gene in humans. This gene belongs to the hepatic glycoside receptor subfamily of the protein tyrosine kinase family. EPH and EPH-associated receptors have been identified as mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically possess a single kinase domain and an extracellular region containing a Cys-rich domain and two fibronectin type III repeats. Hepatic glycoside receptors are divided into two groups based on the similarity of their extracellular domain sequences and their affinity for binding hepatic glycoside-A and hepatic glycoside-B ligands. This gene encodes a protein that binds to the hepatic glycoside-A ligand. Uniprot accession number for the human receptor: P29317.
[0146] In one embodiment of the first aspect, the aptamer includes or consists of a sequence of formula (I):
[0147]
[0148] Nucleotides n1, n2, n6, n7, n9 to n 13 n 16 n 17 n 21 up to n 25 n 28 n 31 n 38 up to n 42 and n 48 up to n 51 As defined above, n is preferred. 25 It is C and n 28 It's U.
[0149] In some embodiments of the first aspect of the invention, optionally in combination with any of the above, the nucleic acid aptamer is a nucleic acid aptamer wherein...
[0150] i. When n9 to n 13 If two or more of them are missing, then n6 and n 17 They are complementary nucleotides and n7 and n 16 They are complementary nucleotides; and / or
[0151] ii. When n9 to n 13 If only one of them is missing, then n 11 or n 12 It does not exist.
[0152] In some embodiments of the first aspect of the invention, optionally in combination with any of the above, the nucleic acid aptamer is a nucleic acid aptamer wherein all nucleotides n9 to n 13 Neither of them exists; n6 and n 17 Complementary, and n7 and n 16 Complementary.
[0153] In some embodiments of the first aspect of the invention, n is optionally combined with any of the above, 23 and n 40 It does not exist; and
[0154] n 21 With n 42 Complementary; and / or
[0155] n 25 With n 38 Complementary.
[0156] In some embodiments of the first aspect of the invention, optionally in combination with any of the above, the nucleic acid aptamer is a nucleic acid aptamer wherein...
[0157] n 22 and n 41 It does not exist;
[0158] n 23 and n 40 It does not exist; and
[0159] n 24 and n 39 It does not exist; and
[0160] Preferably, n6 and n 17 They are complementary nucleotides; and
[0161] Preferably, n7 and n 16 They are complementary nucleotides.
[0162] These characteristics identify some of the best-performing candidates, such as Apt49, Apt66, and Apt75, all of which have been shown to have excellent EphA2 binding and internalization properties.
[0163] In some embodiments of the first aspect of the invention, optionally in combination with any of the above, the nucleic acid aptamer is a nucleic acid aptamer wherein n 21 isU,n 25 It is C, n28 isU,n 31 It is G, n 38 It is G and n 42 Yes, it is A. These characteristics characterize some of the best-performing candidates, such as Apt49, Apt66, Apt75, Apt53, Apt47, and Apt4, all of which exhibit excellent EphA2 binding and internalization properties.
[0164] In some embodiments of the first aspect of the invention, optionally in combination with any of the above, the nucleic acid aptamer is a nucleic acid aptamer wherein...
[0165] n1 of R1 and n of R3 49 Does not exist; and / or
[0166] n2 of R1 and n of R3 48 It does not exist;
[0167] n 50 It is G and n 51 It is A.
[0168] In some embodiments of the first aspect of the invention, optionally in combination with any of the above, the nucleic acid aptamer is a nucleic acid aptamer wherein...
[0169] n1 of R1 and n of R3 49 Complementary;
[0170] n2 of R1 and n of R3 48 Complementary; and
[0171] n 50 It is G and n 51 It is A.
[0172] In a second aspect, the present invention provides nucleic acid aptamers that specifically bind to EphA2, preferably human EphA2, wherein the nucleic acid aptamers are selected from the sequences identified in Tables 2.1 and / or 2.2, or variants having at least 70%, at least 75%, at least 80%, at least 85%, preferably at least 90%, more preferably at least 95%, and even more preferably at least 97% identity with any of them.
[0173] In a preferred embodiment, the aptamer is characterized by having “G” at the position corresponding to the 20th position of the aptamer of formula (I) and “U” at the position corresponding to the 29th position of the aptamer of formula (I).
[0174] As used herein, “sequence identity” or “identity” in the context of two nucleic acid sequences refers to a specified number of identical residues in two sequences when compared by sequence comparison algorithms or by visual inspection.
[0175] As used in this article, "sequence identity percentage" refers to a value determined by comparing two best-aligned sequences. For optimal alignment, the polynucleotide sequence portion may contain additions or deletions (i.e., gaps) compared to the reference sequence (excluding additions or deletions). The percentage is calculated by determining the number of matching positions by identifying the number of identical nucleic acid bases in both sequences, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the sequence identity percentage.
[0176] Sequence identity can be determined in several different ways. To determine sequence identity, various methods and computer programs (e.g., BLAST, T-COFFEE, MUSCLE, MAFFT, etc.) can be used to align sequences, which are available on the World Wide Web at sites such as ncbi.nlm.nili.gov / BLAST, ebi.ac.uk / Tools / msa / tcoffee / , ebi.ac.uk / Tools / msa / muscle / , and mafft.cbrc.jp / alignment / software / . See, for example, Altschul et al. (1990), J. Mol. Bioi. 215:403-10.
[0177] Similarly, in one embodiment of the first aspect of the invention, the nucleic acid aptamer is selected from the sequences identified in Tables 2.1 and / or 2.2, or variants having at least 70%, at least 75%, at least 80%, at least 85%, preferably at least 90%, more preferably at least 95%, and even more preferably at least 97% identity with any of them.
[0178] In another embodiment of the first or second aspect of the invention, the nucleic acid aptamer as defined above is further characterized in that, when using folding prediction software, a 3-stem structure is predicted to account for at least 35% of the folded structure. In a preferred embodiment, at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or at least 99% of the predicted structure is a 3-stem folded structure. In a preferred embodiment, a more stable fold of the aptamer of the first or second aspect is a 3-stem structure.
[0179] For illustrative purposes, the nucleotide sequence of Apt49 (SEQ ID NO: 49) is provided below, in which the predicted region of the 3-stem structure is highlighted (Note: Stem 1 is italicized and underlined, stem 2 is gray, and stem 3 is black). The corresponding folding structure is shown below. Figure 6 middle( Figure 6 The same stem region is highlighted, but stem 1 is marked with a dashed line.
[0180] GGGA GGAC GAUCG GUCC UGUCUGUUCGUCCCCAGACUCGCCCGA
[0181] Folding prediction software is well known in the art, including, for example, OMP Engine (DNA Software), RNAfold (University of Vienna), OligoAnalyzer Tool (Integrated DNA Technologies), mFold (UNAFold web server), MXfold2 (MXfold2 web server), UFold (UFold web server), etc. In a preferred embodiment, Visual OMP v.7.9.81.0 and OMP Engine v.4.0.3.0, both from DNA Software (John Santalucia Jr., 2007), are used for aptamer folding prediction, as described in the examples.
[0182] In some embodiments of the invention, the aptamer has at least 35 nucleotides, preferably at least 38 nucleotides. In some embodiments, optionally in combination with the latter, the aptamer has 50 or fewer nucleotides. In some embodiments, the aptamer has 40 to 50 nucleotides. In other embodiments, the aptamer has 38 to 50 nucleotides, 39 to 49 nucleotides, 40 to 48 nucleotides, 41 to 47 nucleotides, 42 to 46 nucleotides, or 43 to 45 nucleotides. In a preferred embodiment, the aptamer has 42 to 50 nucleotides.
[0183] In some embodiments of the present invention, the aptamer is characterized by having one or more of the following features:
[0184] a) Measured using the surface plasmon resonance (SPR) of the Biacore biosensor system, the binding response is superior to AptP;
[0185] b) with 1 x 10 -9 M or lower KD combined with human EphA2;
[0186] c) Exhibits superior internalization properties compared to AptP in cells expressing EphA2; and / or
[0187] d) Reduced in vitro migration of EphA2-expressing cells (e.g., Ewing sarcoma cells (e.g., A673 cells) or any other EphA2-expressing cells described herein) compared to untreated cells or relative to control aptamers.
[0188] In a preferred embodiment, the aptamer is characterized by having at least two, at least three, or all four of the above-mentioned features.
[0189] In some embodiments, the aptamer is characterized by having a binding response in which the measured value of the aptamer (e.g., at the end of dissociation) is at least one time higher than AptP, more preferably at least 1.5, 2, 3, 4, 5, 6, 7, 8, 9, or at least 10 times higher. In one embodiment, the binding response is measured using surface plasmon resonance (SPR) of the Biacore biosensor system described in the embodiments of this application.
[0190] In some embodiments, the aptamer is equal to or less than 500 pM, 250 pM, 200 pM, 150 pM, 100 pM (10 -10 M), 10 pM (10 -11 M), 1 pM (10 -12 M), 0.1 pM (10 -13 M), 0.01 pM (10 -14 M) or 0.001 pM (10 -15 The dissociation constant (KD) of M is combined with EphA2. The dissociation constant can be measured using techniques known in the art. In one embodiment, the dissociation constant is measured using biolayer interferometry. In another embodiment, it is determined using the SPR of the Biacore biosensor system described in the embodiments of this application.
[0191] In some embodiments, the aptamer has superior cell internalization properties compared to AptP, wherein the measured value of the aptamer is at least one time higher than that of AptP, preferably at least 1.5, 2, 3, 4, 5, 6, 7, 8, 9, or at least 10 times higher. In one embodiment, the cell internalization properties are determined by using a labeled (e.g., fluorescently labeled) aptamer. In another embodiment, the cell internalization properties are determined by RT-qPCR cell internalization assay as described in the embodiments of this application.
[0192] In some embodiments, the aptamer reduces the in vitro migration of EphA2-expressing cells compared to untreated cells or control aptamers. In preferred embodiments, the in vitro inhibition or reduction properties of the aptamer are superior to AptP, and in some cases, the measured value of the aptamer is at least one-fold higher than that of AptP, preferably at least 1.5, 2, 3, 4, 5, 6, 7, 8, 9, or at least 10 times higher. Examples of cells expressing EphA2, as defined above, include cancer cells expressing EphA2, such as Ewing sarcoma cell lines, such as A673, TC252, or SK-N-MC cell lines; breast cancer cell lines, such as the MDA-MB231 cell line; melanoma cell lines, such as the metastatic melanoma cell line A375; and rhabdomyosarcoma cell lines, such as the RH4 cell line. In one embodiment, the in vitro migration inhibition or reduction properties are determined by a transwell migration assay as described in the embodiments of this application. In another embodiment, they are determined by a “wound healing” migration assay as described in the embodiments of this application. In another embodiment, it is determined by colony formation measurement, as described, for example, in Santana-Viera L. et al. 2023.
[0193] In some preferred embodiments, the aptamers are selected from one or more, preferably all, of the aptamers shown in Table 2.1, and the inventors have demonstrated that these aptamers have a superior EphA2 binding response to AptP by surface plasmon resonance (SPR) measurements using the Biacore biosensor system.
[0194] In other preferred embodiments, the aptamer is selected from one or more, preferably all, of the aptamers shown in Table 2.2. The inventors have demonstrated by RT-qPCR cell internalization assays that these aptamers have superior EphA2 binding and cell internalization properties compared to AptP.
[0195] In a third aspect, the present invention relates to a method for producing nucleic acid aptamers of the first or second aspect.
[0196] The aptamers of the present invention can be synthesized by standard solid-phase synthesis using the phosphoramidite method, as is known in the art (see, for example, Beaucage, SL and Lyer, RP 1992). Alternative linker molecules can be used for the linkage between nucleotides. For example, the linker groups of formula P(0)S (thioester); P(S)S (dithioester); P(0)NR'2; P(0)R'; P(0)OR6; CO; or CONR'2 (where R is H (or a salt) or an alkyl group (1-12C) and R6 is an alkyl group (1-9C)) are linked to adjacent nucleotides via -O- or -S-.
[0197] Therefore, in some embodiments, the method for producing the nucleic acid aptamers described herein includes synthesizing the aptamers using a phosphoramidite method via standard solid-phase synthesis.
[0198] In other embodiments, nucleic acid aptamers are synthesized by in vitro transcription using standard or modified reverse transcriptases (Zachary J Kartje, Helen I Janis, Shaoni Mukhopadhyay, Keith T Gagnon: Revisiting T7 RNA polymerase transcription in vitro with the Broccoli RNAaptamer as a simplified real-time fluorescent reporter J Biol Chem. 2021 Jan-Jun;296:100175), which allows the delivery of standard nucleotides or modified nucleotides such as 2'F (Kristina W. Thiel, Luiza I. Hernandez, Justin P. Dassie, William H. Thiel, Xiuying Liu, Katie R. Stockdale, Alissa M. Rothman, Frank J. Hernandez, James O. McNamara and Paloma H. Giangrande: Delivery of chemo-sensitizing siRNAs to HER2+-breastcancer cells using RNA aptamers Nucleic Acids Research, 2012, Vol. 40, No. 136319–6337) or 2'OMe (Paula E Burmeister, Scott D Lewis, Robert F Silva, JeffreyR Preiss, Lillian R Horwitz, P Shannon Pendergrast, Thomas G McCauley, Jeffrey C Kurz, David M Epstein, Charles Wilson, Anthony D Keefe Direct invitro selection of a 2'-O-methyl aptamer to VEGF Chem Biol. 2005 Jan;12(1):25-33) to incorporate aptamer sequences.In some other implementations, nucleic acid aptamers are synthesized as a direct result of the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) process (Michael Kohlberger, Gabriele Gadermaier SELEX: Critical factors and optimization strategies for successful aptamer selection Biotechnol Appl Biochem. 2022;69:1771–1792.).
[0199] Optionally, the method further includes isolating and / or purifying the obtained aptamers. In some embodiments, aptamer purification is performed by chromatography, such as by high-performance liquid chromatography (HPLC) or by polyacrylamide gel electrophoresis.
[0200] The aptamers of the present invention can be coupled to functional substances to form complexes (hereinafter also referred to as chimeras). Thus, the aptamers not only provide preventative or therapeutic effects but can also act as delivery agents for the functional substances to EphA2-positive cancer cells. Therefore, in a fourth aspect, the present invention provides complexes comprising the aptamers as defined in any of the foregoing aspects and embodiments, and one or more portions thereof.
[0201] The coupling between the aptamer and one or more portions (e.g., functional portions) in a complex can be covalent or non-covalent. The complex of the present invention can be a complex in which the aptamer of the present invention is combined with one or more (e.g., two or three) portions of the same or different kinds.
[0202] Preferably, the one or more portions are coupled to the 3'-end of the aptamer.
[0203] In one embodiment of the fourth aspect of the invention, the aptamer is directly connected to the one or more portions; or, alternatively, the aptamer is indirectly connected to the one or more portions via a connector.
[0204] In a particular embodiment of the composite according to any of the foregoing embodiments, a portion is coupled to the aptamer via a spacer or a connector.
[0205] Connectors used to attach aptamers to other parts are well known in the art and can be cleavable or non-cleavable. "Cleavable connectors" include, for example, acid-labile connectors such as hydrazone bonds and protease-labile connectors such as valine-citrulline dipeptides. "Non-cleavable connectors" include, for example, spacers comprising one or more nucleotides, including unmodified and / or modified nucleotides as described herein, or hydrophilic carbon chains such as hexaethylene glycol (HEG).
[0206] In some embodiments, the spacer or linker comprises two or more nucleotides, preferably two to five nucleotides, more preferably two or three nucleotides.
[0207] In one embodiment of the complex of the present invention, the spacer comprises one or more uracil nucleotides. As defined above, these uracil nucleotides may be modified uracil nucleotides. In a preferred embodiment, the spacer is formed of uracil nucleotides. For example, the spacer consists of 2 to 5 uracil nucleotides, particularly 2 or 3 uracil nucleotides, such as UU or 2'FU2'FU.
[0208] In a preferred embodiment, this part is a functional part. There are no particular limitations on the functional part, as long as it adds a new function to the aptamer of the present invention, or can change (e.g., improve) a certain characteristic that the aptamer of the present invention may possess. Examples of functional substances include proteins (e.g., enzymes), peptides, amino acids, lipids, sugars, monosaccharides, nucleic acids (e.g., ribozymes), oligonucleotides (e.g., siRNA, miRNA, antisense oligonucleotides, gapmers), and nucleotides. Further examples of functional parts include affinity substances (e.g., biotin, streptavidin, polynucleotides with affinity for target complementary sequences (e.g., siRNA, microRNA (also called miR, mir, or miRNA), shRNA), antibodies, glutathione agarose, histidine), substances for labeling (e.g., fluorescent substances, luminescent substances, radioactive isotopes), enzymes (e.g., horseradish peroxidase, alkaline phosphatase), and drugs (e.g., chemotherapeutic agents such as doxorubicin, gemcitabine, etc.).
[0209] In one embodiment of the fourth aspect of the present invention, the portion is selected from:
[0210] (i) Antisense oligonucleotides (ASO), siRNA, microRNA, shRNA, or ribozymes;
[0211] (ii) Selected from polysaccharides, lipids (e.g., cholesterol or other lipid fractions), non-protein polymers (e.g., one or more polyethylene glycol (PEG) chains), polyamines, peptides, proteins, small molecules, and combinations thereof;
[0212] (iii) A marker for detection purposes; preferably the marker is selected from biotin, enzymes, cofactors, fluorescent materials, luminescent materials, bioluminescent materials, electron-dense markers, markers for magnetic resonance imaging, radioactive materials, and combinations thereof;
[0213] (iv) Medicines;
[0214] (vi) Nanoparticles; and
[0215] (vii) Any combination thereof.
[0216] In another embodiment of the fourth aspect of the invention, the portion is siRNA, preferably siRNA that recognizes a specific translocation product characterizing cancer expressing EphA2.
[0217] In a fifth aspect, the present invention relates to a method for producing the compound of the fourth aspect of the present invention, wherein the method comprises:
[0218] (i) Providing a nucleic acid aptamer according to the first or second aspect of the present invention; and
[0219] (ii) Connecting the aptamer directly or indirectly to one or more of the parts described herein.
[0220] When the aptamer and siRNA are linked by a nucleotide (e.g., a UU linker), the complex can be synthesized directly as a single entity via solid-phase synthesis. Similarly, the incorporation of a hexaethylene glycol linker between the aptamer and siRNA can be achieved via solid-phase synthesis using hexaethylene glycol phosphoramide (A Jäschke, JP Fürste, E Nordhoff, F Hillenkamp, D Cech, and VA Erdmann Synthesis and properties of oligodeoxyribonucleotide-polyethylene glycol conjugates Nucleic Acids Res. 1994 Nov 11; 22(22): 4810–4817). When using an acid-unstable linker, hydrazone bond formation can be achieved via the conjugation of an aldehyde and a hydrazine (Kölmel, Dominik K.; Kool, Eric T. (2017). "Oximes and Hydrazones in Bioconjugation: Mechanism and Catalysis". Chemical Reviews. 117(15): 10358–10376). When using a protease-unstable linker, the aptamer can be modified with a thiol or alkyne group, and the siRNA can be modified with an amino group. Furthermore, one of the units (aptamer or siRNA) is modified with a divalent linker such as valine-citrulline (Doronina, SO et al. Development of potent monoclonal antibody auristatin conjugates for cancer therapy. Nat. Biotechnol. 21, 778–784 (2003)), which carries a maleimide group (reacting with thiols) or an azide group (reacting with alkynes). A final coupling reaction occurs between the linker-modified unit (aptamer or siRNA) and the other unit.
[0221] In a sixth aspect, the present invention provides compositions comprising aptamers or complexes as defined in any of the foregoing aspects and embodiments.
[0222] In one embodiment of the sixth aspect of the invention, the composition is a pharmaceutical composition comprising a pharmaceutically acceptable excipient and / or carrier.
[0223] The term "excipient and / or carrier" refers to an acceptable material, composition, or medium. Each component must be pharmaceutically acceptable in the sense of compatibility with the other components of the composition. It must also be suitable for contact with human and non-human animal tissues or organs without excessive toxicity, irritation, allergic reactions, immunogenicity, or other problems or complications commensurate with a reasonable benefit / risk ratio. Examples of suitable acceptable excipients are solvents, dispersion media, diluents or other liquid media, dispersing or suspending agents, surfactants, isotonic agents, thickeners or emulsifiers, preservatives, solid binders, lubricants, etc. Unless any conventional excipient medium is incompatible with the substance or its derivatives, for example by producing any undesirable biological effects or interacting in other harmful ways with any other component of the pharmaceutical or cosmetic composition, its use is considered to be within the scope of this invention.
[0224] Formulations of the pharmaceutical compositions described herein may be prepared by any method known in or to be developed in the field of pharmacology. Typically, such preparation methods involve combining the active ingredient (aptamer or complex) with an excipient and / or one or more other auxiliary ingredients, and then, if desired and / or planned, shaping and / or packaging the product into the desired single-dose or multi-dose units.
[0225] The pharmaceutical compositions of the present invention can be prepared, packaged, and / or sold in bulk, as a single unit dose, and / or as multiple single unit doses. As used herein, "unit dose" is a discrete amount of a pharmaceutical composition comprising a predetermined amount of the active ingredient.
[0226] The relative amounts of the active ingredient (aptamer or complex of the present invention), acceptable excipients and / or any additional ingredients in the composition of the present invention will vary depending on the identity, size and / or condition of the subject being treated and further depending on the route of administration of the composition.
[0227] Examples of pharmaceutically acceptable carriers include, but are not limited to: excipients such as sucrose, starch, mannitol, sorbitol, lactose, glucose, cellulose, talc, calcium phosphate, and calcium carbonate; binders such as cellulose, methylcellulose, hydroxypropylcellulose, polypropylene pyrrolidone, gelatin, gum arabic, polyethylene glycol, sucrose, and starch; disintegrants such as starch, carboxymethylcellulose, hydroxypropyl starch, sodium carboxymethyl starch, sodium bicarbonate, calcium phosphate, and calcium citrate; and lubricants such as magnesium stearate, aer osil®, talc and sodium lauryl sulfate; flavoring agents such as citric acid, menthol, ammonium glycyrrhizate, glycine and orange powder; preservatives such as sodium benzoate, sodium bisulfite, methylparaben and propylparaben; stabilizers such as citric acid, sodium citrate and acetic acid; suspending agents such as methylcellulose, polyvinylpyrrolidone and aluminum stearate; dispersants such as surfactants; diluents such as water, brine and orange juice; base waxes such as cocoa butter, polyethylene glycol and kerosene; and so on.
[0228] The compositions of the present invention can be formulated in any form known to those skilled in the art as suitable for desired administration (e.g., oral, parenteral, inhalation).
[0229] In a particular embodiment according to any of the foregoing embodiments, the aptamer and / or complex of the composition or medicament of the present invention is the active ingredient of the composition.
[0230] This invention also provides a solid-phase support on which the aptamer or complex of the invention is immobilized. Examples of solid-phase supports include substrates, resins, plates (e.g., porous plates), filters, cylinders, columns, and porous materials. Substrates can be substrates used for DNA chips, protein chips, etc.; for example, nickel-PTFE (polytetrafluoroethylene) substrates, glass substrates, apatite substrates, silicon substrates, alumina substrates, etc., and substrates prepared by coating these substrates with polymers, etc. Examples of resins include agarose particles, silica particles, copolymers of acrylamide and N,N'-methylenebisacrylamide, polystyrene crosslinked divinylbenzene particles, epichlorohydrin crosslinked dextran particles, cellulose fibers, crosslinked polymers of allyl dextran and N,N'-methylenebisacrylamide, monodisperse synthetic polymers, monodisperse hydrophilic polymers, Sepharose®, Toyopearl®, etc., and also resins prepared by incorporating various functional groups onto these resins. The solid-phase support of the present invention can be used, for example, for the purification, detection, and quantification of EphA2. The adaptor or complex of the present invention can be fixed on a solid support by methods known to those skilled in the art.
[0231] This invention also provides uses and methods for the treatment and / or prevention of the nucleic acid aptamers, complexes or pharmaceutical compositions described herein, for detection and / or quantification (e.g., screening, diagnosis, prognosis or monitoring), particularly for managing cancer or EphA2-related diseases in subjects, such as cancers expressing EphA2.
[0232] As used herein, the term "object" should be understood to include any object, whether human or non-human. Non-human objects may include non-human primates, ungulates (cattle, pigs, sheep, goats, horses, buffalo, and bison), canines, felines, lagomorphs (rabbits, hares, and pikas), rodents (mice, rats, guinea pigs, hamsters, and gerbils), birds, and fish. Preferably, the object is a human.
[0233] As used in this article, the term "treatment" refers to preventive and / or therapeutic treatment.
[0234] Unless otherwise stated, the term "therapeutic treatment" as used herein includes improvement, cure, and / or maintenance of cure of a disease or symptom (i.e., prevention or delay of relapse). Treatment after the onset of a symptom aims to reduce, alleviate, improve, or completely eliminate the symptom and / or its associated symptoms, prevent its worsening, slow its progression, or prevent the symptom from recurring after initial elimination (i.e., prevention of relapse). Unless otherwise stated, the term "treatment" as used herein refers to the act of "treatment".
[0235] As used herein, the term "preventive treatment" refers to the prevention of pathological conditions. Note that, as used herein, this term should not be construed as including the term "therapeutic treatment" as defined herein.
[0236] As used herein, "therapeuticly effective amount" means an amount that is effective when administered in a single or multiple doses to a subject (e.g., a human patient) for the preventative or therapeutic treatment of a disease, symptom, or pathological condition. In some embodiments, it refers to an amount of RNA aptamer, complex, or composition according to the invention sufficient to reduce or inhibit the number of cancer cells expressing EphA2 and / or one or more symptoms of cancer. Those skilled in the art will recognize that such amounts will vary depending on, for example, the type, severity, or level of the particular subject and / or disease. This term is not to be construed as limiting this disclosure to a specific amount of nucleic acid aptamer, complex, or composition.
[0237] EphA2-related diseases include, but are not limited to, cataracts (such as posterior polar cataracts), Pendleley syndrome, and cancers (such as cancers that express EphA2).
[0238] The terms “cancer” and “cancerous” refer to or describe a physiological condition in mammals that is typically characterized by unregulated cell growth. This definition includes both benign and malignant cancers or tumors, as well as dormant tumors or micrometastases. Examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia.
[0239] The term "tumor" refers to an abnormal mass of tissue, which can be benign, pre-malignant, or cancerous. Preferably, the "tumor" is a cancerous tumor. Tumors can be primary or metastatic.
[0240] In some embodiments, the nucleic acid aptamers, complexes, or pharmaceutical compositions described herein are used for preventative or therapeutic treatment of cancer metastasis in a subject. In some embodiments, metastasis in the subject is reduced or inhibited, for example, by reducing the number of metastases or inhibiting the growth of one or more metastatic tumors.
[0241] As used herein, the term “metastasis” refers to distant metastasis affecting organs other than the site of the primary tumor. Metastasis can be defined as the process by which cancer spreads from its primary site or metastasizes to other areas of the body and develops into a similar cancerous lesion in the new location (see, for example: Chambers AF et al., Nat Rev Cancer 2002; 2: 563-72). For example, in colorectal cancer, metastasis to another organ (e.g., the liver) often presents as an intestinal adenocarcinoma pattern. “Metastatic” or “metastatic” cells are typically cells that have lost their adhesive contact with neighboring cells and migrate from the primary site of disease via the bloodstream or lymphatic system to invade adjacent body structures.
[0242] As used herein, the expression “cancer characterized by the expression of EphA2” or “cancer expressing EphA2” refers to a tumor or cancer containing cells expressing EphA2 (EphA2-positive cells). More specifically, it may refer to cancer that overexpresses EphA2, i.e., cancer with cells that overexpress EphA2. Those skilled in the art fully understand which cancers are covered by the expression “cancer characterized by the expression of EphA2” or “cancer expressing EphA2” (Zhou Y. et al., "Emerging and Diverse Functions of the EphA2 Noncanonical Pathway in Cancer Progression", Biol. Pharm. Bull. 40, 1616-1624 (2017)).
[0243] As used herein, the terms “EphA2+”, “EphA2 positive”, or “cells expressing EphA2” are used interchangeably. This term encompasses cell surface expression of EphA2 that can be detected by any suitable means.
[0244] In the context of this invention, cancer is characterized by the expression of EphA2 (cancer expressing EphA2). Therefore, in a particular embodiment, cancer is cancer containing EphA2-positive cells. Similarly, in another particular embodiment, cancer is cancer that overexpresses EphA2. Overexpression of EphA2 means that the expression of EphA2 is at least 2, 3, 4, or 5 times higher than the EphA2 expression in healthy tissue.
[0245] Preferably, cancers expressing EphA2 are selected from: i) soft tissue and bone sarcomas, particularly translocation-related sarcomas (TAS), such as ES (Ewing sarcoma), ARMS (alveolar rhabdomyosarcoma), SS (synovial sarcoma), Ewing-like sarcoma (CIC rearrangement, BCOR rearrangement and EWSR1 rearrangement with non-ETS genes), DSRCT (de novo connective tissue proliferative small round cell tumor), MLS (mixoid liposarcoma); embryonal rhabdomyosarcoma; and osteosarcoma; ii) breast cancer, particularly triple-negative breast cancer; iii) colorectal cancer; iv) melanoma; v) renal cell carcinoma; vi) pancreatic cancer; vii) prostate cancer, and combinations thereof. More preferably, the cancer expressing EphA2 is selected from: soft tissue and bone sarcomas, particularly TAS, such as ES, ARMS, SS; Ewing-like sarcoma (CIC rearrangement, BCOR rearrangement, and EWSR1 rearrangement with non-ETS genes); DSRCT, MLS; osteosarcoma; breast cancer, particularly triple-negative breast cancer; colorectal cancer; melanoma; renal cell carcinoma; pancreatic cancer; prostate cancer, and combinations thereof. In a preferred embodiment, the cancer expressing EphA2 is TAS, preferably ES, ARMS, SS; Ewing-like sarcoma (e.g., CIC rearrangement, BCOR rearrangement, and EWSR1 rearrangement with non-ETS genes), DSRCT, MLS; or breast cancer, preferably triple-negative breast cancer. Even more preferably, the cancer is ES, ARMS, or SS. In other preferred embodiments, the cancer expressing EphA2 is breast cancer, preferably triple-negative breast cancer, melanoma, or pancreatic cancer. In some other preferred embodiments, the cancer is a metastatic form of any of the aforementioned cancer types, preferably metastatic melanoma.
[0246] In a further preferred embodiment, the cancer is selected from: sarcomas, such as Ewing sarcoma, Ewing-like sarcoma, rhabdomyosarcoma, such as alveolar rhabdomyosarcoma, colon cancer and / or rectal cancer (e.g., colorectal adenocarcinoma), prostate cancer (e.g., prostate adenocarcinoma), breast cancer (e.g., invasive breast cancer), ovarian cancer, bladder cancer (e.g., bladder urothelial carcinoma), gastric cancer (e.g., gastric adenocarcinoma), mesothelioma, thyroid cancer (e.g., thyroid cancer), kidney cancer (e.g., papillary renal cell carcinoma or clear cell renal cell carcinoma), lung cancer (e.g., lung adenocarcinoma), bile duct cancer, uterine cancer (e.g., uterine carcinosarcoma, intrauterine carcinoma). Cervical squamous cell carcinoma or cervical endometrial adenocarcinoma—also known as “CESC”), liver cancer (e.g., hepatocellular carcinoma), testicular cancer (e.g., testicular germ cell carcinoma), thymoma, pheochromocytoma, and paraganglioma (also known as “PCPG”), adrenocortical carcinoma, glioma (e.g., low-grade glioma), lymphoma (e.g., large B-cell lymphoma), esophageal cancer, pancreatic cancer (e.g., pancreatic adenocarcinoma), melanoma (e.g., uveal melanoma or cutaneous melanoma), brain cancer (e.g., glioblastoma multiforme), and head and neck cancer (e.g., head and neck squamous cell carcinoma). All of these cancers are expressed based on information available in the TCGA database, see examples, for instance. Figure 3 D. Preferably, the cancer is selected from: sarcomas, such as Ewing sarcoma, Ewing-like sarcoma, rhabdomyosarcoma, such as alveolar rhabdomyosarcoma, colon cancer and / or rectal cancer (e.g., colorectal adenocarcinoma), prostate cancer (e.g., prostate adenocarcinoma), breast cancer (e.g., invasive breast cancer), ovarian cancer, bladder cancer (e.g., bladder urothelial carcinoma), gastric cancer (e.g., gastric adenocarcinoma), mesothelioma, thyroid cancer (e.g., thyroid cancer), kidney cancer (e.g., papillary renal cell carcinoma or clear cell renal carcinoma), lung cancer (e.g., lung adenocarcinoma), bile duct cancer, Uterine cancer (e.g., uterine carcinosarcoma, endometrial cancer, or cervical squamous cell carcinoma and cervical adenocarcinoma—also known as “CESC”), liver cancer (e.g., hepatocellular carcinoma), testicular cancer (e.g., testicular germ cell carcinoma), thymoma, pheochromocytoma, and paraganglioma (also known as “PCPG”), esophageal cancer, pancreatic cancer (e.g., pancreatic adenocarcinoma), melanoma (e.g., uveal melanoma or cutaneous melanoma), brain cancer (e.g., glioblastoma multiforme), and head and neck cancer (e.g., head and neck squamous cell carcinoma). In some other preferred embodiments, the cancer is a metastatic form of any of the cancer types described herein.
[0247] The dosage of the aptamer, complex or composition of the present invention varies depending on the type and activity of the active ingredient, the severity of the disease, the recipient, the recipient's drug tolerance, weight, age, etc. Based on the amount of active ingredient per day for an adult, the usual dosage can be from about 0.0001 to about 100 mg / kg, for example from about 0.0001 to about 10 mg / kg, preferably from about 0.005 to about 1 mg / kg.
[0248] Nucleic acid aptamers, complexes, or pharmaceutical compositions as defined in any of the foregoing aspects and embodiments may be administered in combination with another drug in cancer treatment. In this embodiment, the administration of the other drug may be sequential or simultaneous. In another embodiment, administration may be in the form of a single composition or as part of the same composition.
[0249] In the context of this invention, the term "another medicine" may preferably be selected from anticancer agents, anti-allergic agents, anti-nausea agents (or antiemetics), analgesics, cell protectants, and combinations thereof.
[0250] In some embodiments, nucleic acid aptamers, complexes, or pharmaceutical compositions as defined in any of the above aspects and embodiments may be administered in combination with another anticancer treatment.
[0251] As used herein, the term “cancer treatment” can include any treatment used to stop or prevent cancer, including but not limited to surgery, radiation therapy, anticancer agents, and any other existing or developing therapies.
[0252] As used herein, the term "anticancer agent" refers to any therapeutic agent that can be used to treat cancer. Examples of anticancer therapeutic agents include, but are not limited to, TGFβ signaling pathway inhibitors, chemotherapeutic agents, growth inhibitors, cytotoxic agents, antihormonal agents, agents used for radiotherapy, anti-angiogenic agents, apoptotic agents, anti-microtubule agents, and other agents used to treat cancer, such as anti-HER-2 antibodies (e.g., Herceptin®), anti-CD20 antibodies, epidermal growth factor receptor (EGFR) antagonists (e.g., tyrosine kinase inhibitors), HER1 / EGFR inhibitors (e.g., erlotinib (Tarceva®)), platelet-derived growth factor inhibitors (e.g., Gleevec™ (imatinib mesylate)), COX-2 inhibitors (e.g., celecoxib), interferons, cytokines, antagonists that bind to one or more of the following targets (e.g., neutralizing antibodies): ErbB2, ErbB3, ErbB4, PDGFR-β, BlyS, APRIL, BCMA or VEGF receptor, TRAIL / Apo2, and other bioactive agents and organic chemical agents. Combinations thereof are also included in this invention.
[0253] In a seventh aspect, the present invention provides aptamers as defined in the first or second aspect of the invention, complexes as defined in the fourth aspect of the invention, or compositions as defined in the sixth aspect of the invention, which are used as medicines alone or in combination therapy.
[0254] In an eighth aspect, the present invention provides the use of an aptamer as defined in the first or second aspect of the invention or a complex as defined in the fourth aspect of the invention as an EphA2 detection or quantification agent; or as an internalization mediator for cells that target EphA2 expression.
[0255] In a ninth aspect, the present invention provides aptamers as defined in the first or second aspect of the invention, complexes as defined in the fourth aspect of the invention, or compositions as defined in the sixth aspect of the invention, for use in in vivo methods for the detection of a disease; or for use in in vivo methods for the detection or quantification of a target protein; or alternatively, for use in methods including the detection or quantification of a target protein, such as methods for in vivo screening, diagnosis, prognosis, or monitoring of a disease, wherein an increase or decrease in the level of the target protein has been associated with the presence or prognosis of the disease. In some embodiments, the method is used for the in vivo detection of EphA2 or cells expressing EphA2, and the method is used for the detection of EphA2-related diseases. In a preferred embodiment, the cells expressing EphA2 are cancer cells expressing EphA2, and the disease is cancer expressing EphA2.
[0256] In some embodiments, aptamers, as defined in the first or second aspect of the invention, or complexes, as defined in the fourth aspect of the invention, are labeled for in vivo imaging. In one particular embodiment, aptamers or complexes are labeled with a radioactive tracer for nuclear imaging. In another embodiment, aptamers or complexes are labeled with a magnetic resonance imaging agent, such as a superparamagnetic or paramagnetic contrast agent, for magnetic resonance imaging.
[0257] The term "imaging" or "medical imaging" refers to any technique, method, or process used to generate images of the human body for medical purposes. Preferred medical imaging techniques include magnetic resonance imaging (MRI) and nuclear imaging. Nuclear imaging methods typically utilize the properties of isotopes to visualize labeled molecules bound to target cells or tissues. Suitable nuclear imaging methods include scintillation scanning, PET (positron emission tomography), and SPECT (single-photon emission computed tomography).
[0258] This aspect can alternatively be described as a method for in vivo detection (e.g., screening, diagnosis, or monitoring) or prognosis of a disease in a subject, such as an EphA2-related disease, wherein the disease is characterized by comprising cells expressing EphA2, the method comprising the steps of: (a) administering to the subject an effective amount of an aptamer as defined in the first or second aspect of the invention, a complex as defined in the fourth aspect of the invention, or a composition as defined in the sixth aspect of the invention; (b) determining the amount of EphA2 in vivo (e.g., by directly or indirectly detecting the amount of aptamer bound to EphA2); and (c) comparing it to a reference value; wherein if the amount of EphA2 in the sample increases or decreases relative to the reference value (e.g., deviates statistically), it indicates the presence (e.g., the subject has) an EphA2-related disease or the worst prognosis for an EphA2-related disease. In some implementations, the presence or prognosis of a disease is associated with an increase in EphA2 levels (e.g., cancer characterized by expressing EphA2 as defined herein), and an increase in the amount of EphA2 in a sample relative to a reference value indicates the presence (e.g., the subject has) an EphA2-related disease or the worst prognosis associated with an EphA2-related disease.
[0259] As used herein, the term "reference value" refers to a predetermined standard used as a reference for evaluating values or data obtained from samples collected from an object. This "reference value" may also be referred to as a "cutoff value" or a "threshold".
[0260] Reference values can be absolute values, relative values, values with upper or lower limits, ranges of values, averages, medians, mean, z-scores (e.g., mean + or -1 standard deviation (SD)), tertiles, or values compared to a specific control or baseline.
[0261] Furthermore, it should be noted that various statistical and mathematical methods for determining expression thresholds or cutoff levels are known in the art. For example, threshold or cutoff expression levels for a particular biomarker can be selected based on data from receiver operating characteristic (ROC) plots. Those skilled in the art will understand that these threshold or cutoff expression levels can vary, for example, by moving along the ROC plot of a particular biomarker or combination thereof, to obtain different sensitivity or specificity values, thereby affecting overall assay performance.
[0262] Sensitivity, specificity, and / or accuracy are parameters commonly used to describe the effectiveness or performance of a test. In particular, they are used to quantify the superiority and reliability of a distinguishing method. Tests are typically calibrated for desired specificity and sensitivity based on their intended use in clinical practice. High sensitivity corresponds to a high negative predictive value and is generally considered an ideal property for “exclusionary” tests, such as screening tests, which are often followed by confirmatory tests. High specificity corresponds to a high positive predictive value and is generally considered an ideal property for “deterministic” tests, such as companion diagnostic tests.
[0263] Reference values can be based on a single sample value, but are typically based on a large number of samples, with or without the sample being tested. For example, the reference value could be derived from a collection of tumor tissue samples from a reference cancer patient population, for which historical information related to the actual clinical outcomes of the corresponding cancer patients can be obtained.
[0264] In the method of the present invention, a value is considered "reduced" when the value determined in step b) is lower than a reference value. Preferably, a value is considered lower than a reference value when it is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, at least 110%, at least 120%, at least 130%, at least 140%, at least 150%, or more lower than a reference value.
[0265] Similarly, in the context of the method of the present invention, a value is considered "increased" when the value determined in step b) is higher than a reference value. Preferably, a value is considered higher than a reference value when it is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, at least 110%, at least 120%, at least 130%, at least 140%, at least 150%, or more.
[0266] Alternatively or additionally, the object deviates from the reference values described herein by approximately 1.1, 1.2, 1.3, 1.4, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 times (i.e., increases or decreases).
[0267] In a tenth aspect, the present invention provides the use of nucleic acid aptamers as defined in the first or second aspect of the invention, complexes as defined in the fourth aspect of the invention, or compositions as defined in the sixth aspect of the invention as detection or quantification reagents for use in in vitro or ex vivo methods for the detection or quantification of diseases, or for use in in vitro or ex vivo methods for the detection or quantification of target proteins; or alternatively, for use in methods including the in vitro or ex vivo detection or quantification of target proteins, such as for methods for in vitro or ex vivo screening, diagnosis, prognosis, or monitoring of diseases, wherein an increase or decrease in the level of said target protein has been associated with the presence or prognosis of the disease. In some embodiments, the method is used for the in vitro or ex vivo detection of EphA2 or cells expressing EphA2, and the method is used for the detection of EphA2-related diseases. In a preferred embodiment, said cells expressing EphA2 are cancer cells expressing EphA2, and the disease is cancer expressing EphA2.
[0268] This aspect can alternatively be described as a method for in vitro detection (e.g., screening, diagnosis, or monitoring) or prognosis of a disease of the subject, such as an EphA2-related disease, wherein the disease is characterized by containing cells expressing EphA2, the method comprising the steps of: (a) contacting an aptamer as defined in the first aspect of the invention, a complex as defined in the fourth aspect of the invention, or a composition as defined in the sixth aspect of the invention with an isolated test sample from the subject; (b) determining the amount of EphA2 in the test sample (e.g., by directly or indirectly detecting the amount of aptamer bound to EphA2); and (c) comparing with a reference value; wherein if the amount of EphA2 in the sample increases or decreases relative to the reference value (e.g., deviates statistically), it indicates the presence (e.g., the subject has) an EphA2-related disease or the worst prognosis for an EphA2-related disease. In some implementations, the presence or prognosis of a disease is associated with an increase in EphA2 levels (e.g., cancer characterized by expressing EphA2 as defined herein), and an increase in the amount of EphA2 in a sample relative to a reference value indicates the presence (e.g., the subject has) an EphA2-related disease or the worst prognosis associated with an EphA2-related disease.
[0269] The methods described herein for detecting EphA2-related diseases in vivo, in vitro, or ex vivo can be used as a one-time test or as ongoing monitoring of individuals considered at risk of developing EphA2-related diseases, or as monitoring the effectiveness of therapeutic or preventative treatments aimed at inhibiting or delaying the development of EphA2-related diseases (e.g., EphA2-expressing cancers). In these cases, mapping EphA2 expression can be a valuable indicator of individual condition or the effectiveness of therapeutic or preventative treatments. Therefore, it should be understood that the methods of the present invention extend to monitoring increases or decreases in EphA2 expression in an individual relative to its normal levels, or increases or decreases relative to one or more early EphA2 levels determined from biological samples of said individual.
[0270] The in vitro method of the present invention can be applied to any type of biological sample from a patient, such as biopsy samples, tissues, cells, or fluids (serum, saliva, semen, sputum, cerebrospinal fluid (CSF), tears, mucus, sweat, breast milk, brain extracts, etc.). When performing the method of the present invention, the biological sample from a cancer patient is preferably a sample containing tumor cells. The tumor or a portion thereof can be obtained from surgical resection of the patient or through routine biopsy. Preferably, the tumor sample is obtained from the primary tumor. In certain embodiments, optionally in combination with any feature or embodiment described above or below, the biological sample separated from the subject is a tumor biopsy sample, preferably obtained from a resected tumor.
[0271] These types of samples are routinely used in clinical practice, and those skilled in the art will know how to determine the most appropriate means for their acquisition and preservation. Once obtained, samples can be used fresh, frozen, or preserved using appropriate means (e.g., as formalin-fixed, paraffin-embedded tissue samples). Such biological samples can be collected before or after diagnosis, before, during, or after treatment (e.g., surgical resection).
[0272] Methods for quantifying the expression of specific proteins (e.g., EphA2) are well known in the art. Some well-known methods for determining protein expression levels in test samples are based on the specific binding of affinity reagents to the target protein or fragments thereof, such as immunoassays or immunohistochemical (HIC) analyses.
[0273] Those skilled in the art are aware of various types of immunoassays used for quantifying target proteins. These immunoassays may be, for example, enzyme-linked immunosorbent assays (ELISA), fluorescence immunosorbent assays (FIA), chemiluminescent immunoassays (CIA), radioimmunoassays (RIA), enzyme-multiplying immunoassays, solid-phase radioimmunoassays (SPROA), fluorescence polarization (FP) assays, fluorescence resonance energy transfer (FRET) assays, time-resolved fluorescence resonance energy transfer (TR-FRET) assays, surface plasmon resonance (SPR) assays, or immunoblotting assays, such as Western blotting. This specifically covers multiples and any next-generation versions of any of the above methods, such as bead-based flow cytometry immunoassays (e.g., based on Luminex xMAP technology). In a particular embodiment, the immunoassay is an ELISA assay or any multiple version thereof.
[0274] For determining protein expression and localization, immunohistochemistry and in situ hybridization are generally preferred methods. Immunohistochemical (IHC) analysis is typically performed using thin sections of biological samples fixed on coated glass slides. When these sections are from paraffin-embedded tissue samples, they are deparaffinized and preferably processed to recover antigens. Detection can be performed on a single sample or a tissue microarray. Although this procedure is subjectively determined by the pathologist, it is the standard method for measuring IHC results and is well known in the art.
[0275] The method of the present invention is a variant of the antibody-based method described above, wherein the affinity reagent (i.e., an affinity reagent specific to EphA2) is an aptamer of the inventors' first or second aspect or a complex of the present invention's fourth aspect, characterized by binding to the EphA2 protein or a fragment thereof, wherein the affinity reagent is preferably labeled. Illustrative but non-exclusive examples of labels that can be used include radioisotopes, enzymes, fluorophores, chemiluminescent reagents, enzyme cofactors or substrates, enzyme inhibitors, particles, dyes, etc.
[0276] In an eleventh aspect, the present invention provides a kit for detecting or quantifying EphA2, comprising an aptamer as defined in the first or second aspect of the invention, a complex as defined in the fourth aspect of the invention, or a composition as defined in the sixth aspect of the invention, and optionally means for detecting the aptamer or complex.
[0277] In a twelfth aspect, the present invention provides a method for detecting or quantifying EphA2, wherein the method includes the step of detecting or quantifying EphA2 using an aptamer as defined in the first or second aspect of the invention, a complex as defined in the fourth aspect of the invention, a composition as defined in the sixth aspect of the invention, or a kit as defined in the eleventh aspect of the invention.
[0278] In a thirteenth aspect, the present invention provides the use of a kit comprising an aptamer, complex, or composition as defined in the eleventh aspect of the invention for the detection or quantification of EphA2.
[0279] In methods for the in vitro or ex vivo detection or quantification of EphA2, or
[0280] Used in methods for the in vitro or ex vivo detection or quantification of EphA2 for the screening, diagnosis, prognosis, or monitoring of EphA2-related diseases, such as cancers expressing EphA2.
[0281] In a fourteenth aspect, the present invention provides aptamers as defined in the first or second aspect of the invention, complexes as defined in the fourth aspect of the invention, or compositions as defined in the sixth aspect of the invention, for use in a method of preventive or therapeutic treatment of cancer or EphA2-related diseases, preferably cancers expressing EphA2.
[0282] This aspect can also be described as the use of aptamers, complexes, or pharmaceutical compositions as defined above in the preparation of medicaments for treating cancer or EphA2-related diseases, preferably cancers expressing EphA2. This aspect can also be described as a method for treating a subject with cancer or an EphA2-related disease, preferably cancers expressing EphA2, the method comprising administering a therapeutically effective amount of an aptamer, complex, or pharmaceutical composition as defined above to a subject in need.
[0283] It is anticipated that any feature described herein may be optionally combined with any aptamer, complex, composition, pharmaceutical composition, any method of manufacturing thereof; kit, medical use, treatment method, detection method, screening, diagnosis, monitoring or prognostic method, method of preparing a medicament, and any embodiment of the combination therapy of the present invention; and any embodiment discussed in this specification may be practiced for any of these. It should be understood that the specific embodiments described herein are shown by way of illustration and are not intended to limit the invention.
[0284] All publications and patent applications are incorporated herein by reference to the same extent that each individual publication or patent application is specifically and individually indicated to be incorporated by reference.
[0285] The use of the terms "an" or "a kind" may mean "one," but it is also consistent with the meanings of "one or more," "at least one," and "one or more." The use of the term "another" may also refer to one or more. The use of the term "or" in the claims means "and / or," unless it is expressly indicated that it refers only to alternatives or that the alternatives are mutually exclusive.
[0286] As used herein, the terms “comprising” (and any form of inclusion, such as “comprise / comprises”), “having” (and any form of inclusion, such as “have / has”), “including” (and any form of inclusion, such as “includes / include”), or “containing” (and any form of inclusion, such as “contains / contains”) are inclusive or open-ended and do not exclude additional, unlisted elements or method steps. The term “comprising” also covers and explicitly discloses the terms “consisting of” and “substantially consisting of”. As used herein, the phrase “substantially consisting of” limits the scope of the claims to the specified materials or steps and those steps that do not materially affect the essential and novel features of the claimed invention. As used herein, the phrase “consisting of” excludes any element, step, or ingredient not specified in the claims, except for impurities, for example, those typically associated with elements or limitations.
[0287] As used herein, the term "or combinations thereof" refers to all permutations and combinations of the items listed preceding the term. For example, "A, B, C, or combinations thereof" is intended to include at least one of the following: A, B, C, AB, AC, BC, or ABC, and also BA, CA, CB, CBA, BCA, ACB, BAC, or CAB if the order is significant in the particular context. Continuing this example, combinations containing one or more repeated items or terms are explicitly included, such as BB, AAA, AB, BBC, AAABCCCC, CBBAAA, CABABB, etc. Those skilled in the art will understand that, unless explicitly stated otherwise from the context, there is generally no limitation on the number of items or terms in any combination.
[0288] As used herein, approximations, such as, but not limited to, “about,” “around,” and “approximately,” mean that the condition being modified is not necessarily absolute or perfect, but would be considered by those skilled in the art to be sufficiently close to guarantee the existence of the specified condition. The degree of variability in the description will depend on how much change can be made, and still allow those skilled in the art to recognize that the modified feature still possesses the characteristics and capabilities required for the unmodified feature. Generally, but limited by the foregoing discussion, numerical values modified herein by approximations (such as “about”) may differ from the stated value by ±1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10%. Thus, the term “about” may refer to the indicated value ±5% of its value, preferably ±2% of its value, and most preferably, the term “about” refers to the exact indicated value (±0%). The following examples are for illustrative purposes only and should not be construed as limiting the scope of the invention.
[0289] Although the invention has been described in some detail for clarity and understanding purposes, those skilled in the art will understand upon reading this invention that various changes in form and detail may be made without departing from the true scope of the invention and the appended claims.
[0290] The following examples are provided to further illustrate the present invention and are not intended to limit the scope of the invention.
[0291] Example
[0292] Example 1 - Materials and Methods
[0293] Cell culture and transfection
[0294] Ewing sarcoma cell lines were used: A673 (ATCC), A673 EphA2 control and knockout, SK-N-MC, and TC252. Triple-negative breast cancer cell line MDA-MB-231, metastatic melanoma cell line A375 (ATCC), pancreatic adenocarcinoma cell line PANC-1 (ATCC), and rhabdomyosarcoma cell line RH4 were also used. Cell lines were cultured in DMEM-F12 (Life Technologies, Carlsbad, California, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS, Life Technologies) and 1% penicillin-streptomycin (Life Technologies). All cell lines were incubated at 37°C in a humidified atmosphere with 5% CO2 and were periodically checked for mycoplasma infection. All experiments used cells in the low passage (less than 10) exponential growth phase. If cells with a passage greater than 10 were used, STR analysis was performed for cell line authentication.
[0295] For transient gene silencing, cells were transfected with custom siRNA targeting EWS / Fli-1 at doses of 1, 2.5, 5, 10, and 12.5 nM using Lipofectamine 2000 (Life Technologies).
[0296] Combined assay-aptamer ranking measurement
[0297] Surface plasmon resonance (SPR) experiments were performed using a Biacore 2000 instrument equipped with a C1 sensor chip (Cytiva). Recombinant human EphA2 receptor (57 kDa, R&D systems) was immobilized using amine coupling chemistry. Briefly, after equilibrating the chip with 10 mM Hepes, 150 mM NaCl, and pH 7.4, the flow cell surface was activated for 10 min at 37 °C with a 1:1 mixture of 0.1 M NHS (N-hydroxysuccinimide) and 0.4 M MEDC (3-(N,N-dimethylamino)propyl-N-ethylcarbodiimide) at a flow rate of 10 μl / min. EphA2 receptor at a concentration of 90 nM (dissolved in 10 mM sodium acetate, pH 4.0) was immobilized on the measurement flow cell at a density of approximately 200–500 RU. In a reference flow cell, 600 nM bovine serum albumin (66.5 kDa) (dissolved in 10 mM sodium acetate, pH 5.0) was fixed at a comparable density. The flow cell was closed by injection of 1 M ethanolamine (pH 8.0) for 7 minutes.
[0298] To rank the aptamers' binding responses to the immobilized EphA2 receptor, aptamers at concentrations of 2.5 nM, 5 nM, 10 nM, 20 nM, or 30 nM were injected into the measurement and reference flow cells at a flow rate of 30 μl / min at 37 °C. The measurement buffer consisted of 20 mM Hepes, 150 mM NaCl, 2 mM CaCl2, pH 7.4, supplemented with 0.01% Tween 20. The binding complex associated for 60 seconds and dissociated for 90 seconds. Subsequently, the flow cell was regenerated with 1 M NaCl for 30 seconds. The plotted values are triple reference binding responses recorded after 80 seconds of dissociation: the reference includes the response of the aptamer in the measurement flow cell minus the response of the aptamer in the reference flow cell (first reference) and the response of the buffer itself (second reference). To better compare the differences between different measurement runs, a dual-referenced combined response is referenced to AptP, which is used as the reference adapter in each run and set to 100% combined response (triple reference).
[0299] SPR dynamics measurement
[0300] Surface plasmon resonance experiments were performed using a Biacore 2000 instrument equipped with a C1 sensor chip (Cytiva). Recombinant human EphA2 receptor (57 kDa, R&D systems) was immobilized using amine coupling chemistry. Therefore, after equilibrating the chip with 10 mM Hepes, 150 mM NaCl, and pH 7.4, the flow cell surface was activated for 10 min at 37 °C with a 1:1 mixture of 0.1 M NHS (N-hydroxysuccinimide) and 0.4 M EDC (3-(N,N-dimethylamino)propyl-N-ethylcarbodiimide) at a flow rate of 10 μl / min. EphA2 receptor at a concentration of 88 nM (dissolved in 10 mM sodium acetate, pH 4.0) was immobilized at a density of 200–500 RU. In a reference flow cell, 600 nM bovine serum albumin (66.5 kDa) (dissolved in 10 mM sodium acetate, pH 5.0) was fixed at a nearly comparable density. The flow cells were closed by injection of 1 M ethanolamine (pH 8.0) for 7 min. To collect kinetic binding data, aptamers in a series of concentrations in 20 mM Hepes, 150 mM NaCl, 2 mM CaCl2, pH 7.4 (supplemented with 0.01% Tween 20) were injected into two flow cells at a flow rate of 30 μl / min at 37 °C. The complexes were allowed to associate and dissociate for 120 sec and 360 sec, respectively. The surfaces were regenerated with 1 M NaCl for 45 sec. After subtracting the aptamer response on the reference surface and the response of the buffer itself (dual reference) from the binding response, the resulting binding curves were fitted to a Langmuir 1:1 stoichiometric binding model to determine the kinetic rate constant (kJ / kb). a k d and the affinity constant K d Data analysis was performed using the global data analysis options available in the BIAevaluation 4.1 software. Two to four independent measurements were taken for each aptamer, and the constants (k) determined for each aptamer were calculated using GraphPad Prism. a k d K d The geometric mean of the concentrations. For example, the following concentration series were injected to obtain the binding curves.
[0301] Apt49: 0.47 nM, 0.94 nM, 1.88 nM, 3.75 nM, 7.5 nM, 15 nM, 30 nM
[0302] Apt54: 0.37 nM, 1.1 nM, 3.3 nM, 10 nM, 30 nM
[0303] Apt60: 0.195 nM, 039 nM, 0.78 nM, 1.56 nM, 3.13 nM, 6.25 nM, 12.5 nM, 25 nMnM
[0304] Internalization assay
[0305] These assays were performed using A673 cells. 200,000 cells were seeded in 6-well plates and cultured for 24 hours. Cells were first washed with PBS 1X or serum-free medium. Then, cells were incubated with 10 mg / ml tRNA at 37°C for 15 minutes. Next, 200 nM of aptamers were added to the medium, and the cells were incubated at 37°C for 1 hour. Rotation every 30 minutes was recommended. After 1 hour, cells were washed once with cold PBS 1X. Then, cells were washed twice with high-salt buffer (NaCl 0.5M) and incubated at 4°C for 5 minutes. Finally, cells were washed once with PBS 1X before lysis to obtain samples. Aptamers were quantified by RT-qPCR as described below. The internalization capacity of some aptamers was also evaluated in other cell lines such as RH4, MDA-MB-231, A375, and PANC-1 according to the above protocol.
[0306] Transwell migration assay
[0307] Cells were harvested as usual. After additional washing with DMEM, 250,000 cells in 200 µL of serum-free medium were added to the upper chamber of an 8 µm pore size polycarbonate transwell (Transwell Permeable Supports -- Corning, Corning, New York, USA). Simultaneously, 500 µL of complete medium (10% FBS) was added to the lower chamber. For migration assays in the presence of aptamers, cells were pretreated with 100 nM candidate for 6 h before trypsin digestion and seeding into the chambers. Aptamers were also added to the upper chamber. After 24 hours of incubation with A673, cells in the upper chamber were removed with a swab. Migrating cells still attached to the submembrane side were fixed with 70% ethanol for 30 min and stained with crystal violet for 10 min. Transwell membranes were collected, and five images of each transwell were obtained using an optical microscope.
[0308] Typically, the membrane is decolorized with 100% glacial acetic acid solution, and crystal violet is quantified by spectroscopic methods. In some cases, we choose to manually count the number of migrating cells on the membrane directly using ImageJ. Results are expressed as a percentage of the specified control conditions.
[0309] Wound healing migration assay
[0310] A673, TC252, SK-N-MC, MDA-MB-231, RH4, and A375 cells were respectively throttled at 1.5 x 10⁻⁶. 5 (A673, TC252, RH4), 3.5x10 5 (SK-N-MC), 1x10 5 (MDA-MB-231) and 0.8x10 5 Cells were seeded at a density of (A375) cells / well in 2-well silicone inserts (Idibi, Cat. No: 80209) to a final volume of 100 µL per well. Cells were incubated at 37°C and 5% CO2.
[0311] Twenty-four hours after inoculation, remove the insert from the cell culture plate and discard the culture medium. Treat cells with 400 nM aptamer to a final volume of 0.5 mL serum-free medium per well (in a 24-well plate), supplemented with 100 µg / mL yeast tRNA (ThermoFisher, Cat. No: AM7119). Control samples received only serum-free medium supplemented with tRNA.
[0312] Immediately after treatment, images were captured at 4x magnification using a Carl Zeiss™ Axio Vert.A1 inverted microscope (time 0). Cells were monitored periodically to determine the optimal time point for area reduction measurements after treatment. Image quantification was performed using the ImageJ 'Wound_healing_size_tool' plugin.
[0313] RNA extraction and reverse transcription-PCR (RT-PCR)
[0314] Total RNA (0.5 to 1 µg) was extracted using a Maxwell instrument from Promega or a NucleoSpin miRNA from Macherey-Nagel, Duren, Germany (for microarray purposes) for cDNA synthesis using MuLV reverse transcriptase (Life Technologies).
[0315] Quantitative real-time PCR
[0316] Quantitative reverse transcription-PCR (qRT-PCR) was performed on a LightCycler 480 II instrument (Roche) under universal cycling conditions using the TaqMan PCR Mastermix and TaqMan probes from Life Technologies, as well as a small custom TaqMan probe. Cycling threshold (CT) values were normalized relative to TBP or its specific endogenous control. The relative expression levels of target genes in different samples were calculated using the ααCT method.
[0317] aptamer synthesis
[0318] The aptamers were synthesized using solid-phase chemical synthesis of phosphorusamide, followed by HPLC purification (Beaucage, SL; Lyer, RP 1992). These aptamers were 2'F modified in pyrimidine (Chen Z et al. 2023).
[0319] Table 1. Aptamer Sequences
[0320]
[0321]
[0322]
[0323]
[0324] Folding prediction
[0325] Aptamer folding prediction was performed using Visual OMP v.7.9.81.0 and OMP Engine v.4.0.3.0 (both from DNA Software) (John Santalucia Jr., 2007). The folding temperature was fixed at 37 °C, and the salt conditions were set to 150 mM monovalent salt and 10 mM divalent salt (e.g., Mg). 2+ Salt conditions were considered typical physiological conditions. RNA aptamer concentration was set to 1 nM, although substrate concentration was only related to intermolecular binding. The software was set to return all suboptimal folds within an optimal folding free energy of 5 kcal / mol.
[0326] The OMP software uses standard nearest-neighbor binding free energy calculations to determine the equilibrium folding free energy. This software has free energy parameters for RNA, DNA, and various modified nucleotides, including DNA phosphate thioesters, 2'-O-methyl, LNA, PMO, PNA, etc. In this case, the aptamer is modeled as a pure RNA sequence because the folding software lacks a nearest-neighbor energy parameter for 2'-fluorine modifications, and the RNA parameter is estimated to be the closest substitute.
[0327] Example 2. - SPR binding and internalization in EphA2-expressing Ewing sarcoma A673 cell line assays
[0328] The results of SPR binding and A673 cell internalization of the obtained Apt1 to Apt108 aptamers are as follows: Figure 2 Figures A through 2C are shown. These figures include AptP for comparative purposes, which serves as a reference aptamer.
[0329] Aptamers with binding and / or internalization properties superior to AptP are considered positive, while aptamers with values lower than AptP are considered negative.
[0330] The table below provides a classification of aptamers based on their activity:
[0331] Table 2.1. EphA2-specific binding activity with >AptP
[0332]
[0333]
[0334] Table 2.2. EphA2 binding and intracellularization activities with >AptP
[0335]
[0336]
[0337] Table 2.3. Negative (binding and / or internalization properties ≤ AptP)
[0338]
[0339]
[0340] In conclusion, we can identify Apt4, 6, 46, 47, 49, 54, 61, 63, 64, 66, and 67 as the optimal candidate aptamers, demonstrating superior results in both SPR binding and in vitro internalization assays. In fact, the optimal candidate aptamer group comprises those characterized by an internalization value at least five times that of AptP.
[0341] Example 3 - Functional Testing
[0342] 3.A. Migration Measurement
[0343] As described in Materials and Methods, migration assays were performed using several top-performing candidates (Apt46, Apt47, Apt49, Apt63, Apt66, and Apt75). Cells were seeded on top of transwells. After 24 hours, the number of migrating purple-stained cells (shown as dark gray) that were able to cross the transwells was quantified. Any aptamer-treated cells resulted in a significant reduction in the in vitro migration and invasion ability of A673 cells compared to untreated cells (blank). Figure 3 A). Among the candidates tested, Apt46 and Apt49 were found to be the best, followed by Apt66 (A). Figure 3 B).
[0344] To validate these results, another assay, commonly referred to as the “wound healing assay” as described in Materials and Methods, was used to assess cell migration. Here, Apt66 was tested in three different Ewing sarcoma cell lines (A673, SK-N-MC, and TC252). Apt66 reduced the ability of cells to migrate to cell-free regions (i.e., “wounds”) in all three tested cell models. Figure 3 C).
[0345] The observed significant reduction in the migration and invasion abilities of cells expressing EphA2 suggests that the tested aptamers themselves possess anticancer properties, and more specifically, antimetastatic properties, with Apt46, Apt49, and Apt66 showing the best results.
[0346] 3.B. Assays of internalization and migration in other EphA2 cancer types
[0347] EphA2 receptors are highly expressed in different types of cancer, but are not primarily produced in normal adult tissues (Xiao Te et al., 2020). Figure 3 D). EphA2 receptor expression is also associated with poor prognosis and survival (London, M. et al, 2020). Therefore, pancreatic cancer, bladder cancer, ovarian cancer, brain cancer, head and neck cancer, uterine cancer, colorectal cancer, kidney cancer, sarcoma, cervical cancer, rhabdomyosarcoma, prostate cancer, and breast cancer are some examples of cancers with EphA2 overexpression.
[0348] Therefore, we performed internalization assays using different cell lines expressing the EphA2 receptor, including A673 (Ewing sarcoma cell line), MDA-MB-231 (breast cancer cell line), and RH4 (rhabdomyosarcoma cell line). Figure 3 As shown in Figure E, the Apt49 aptamer was strongly internalized in all tested cell lines. The Apt66 aptamer showed better internalization than AptP in all tested cell lines, particularly in the A673 and MDA-MB-231 cell lines. The Apt66 aptamer was further tested in two other cell lines expressing the EphA2 receptor: PANC-1, a pancreatic adenocarcinoma cell line, and A375, a metastatic melanoma cell line. In both cases, the aptamer showed good internalization, achieving approximately 3.5-fold and 2.5-fold improvements in internalization relative to AptP in the A375 and PANC-1 cell lines, respectively. Figure 3 E).
[0349] To verify the functional efficacy of aptamers in inhibiting migration in different cancer types expressing EphA2, wound healing migration assays were performed in MDA-MB-231 (breast cancer), RH4 (rhabdomyosarcoma), and A375 (metastatic melanoma) cell lines. Apt66 reduced the migration ability of cells in all tested cell models. Figure 3 F).
[0350] Example 4 - Chemical Modification
[0351] The main purpose of this assay is to elucidate the modifications that improve stability without affecting the incorporation ability of Apt49 aptamers. Figure 4 A). As described in the materials and methods above, the starting product is Apt49, characterized in that the pyrimidine is 2'F modified.
[0352] 4.A. Phosphothiophosphate (PTO) modification
[0353] As previously described by Lennox, KA et al. (Lennox, KA et al., 2011), phosphate-thioester (PTO) modification is added to the Apt49 aptamer to prevent its degradation by nucleases in circulation or within the cell. When considering the 3-stem conformation, the modification occurs on all nucleotides in their respective blocks: the aptamer loops (L1, L2, and L3) and at the molecular ends (terminals) (see [link to article]). Figure 1 A.2). For example... Figure 4 As shown in B, the addition of PTO to the aptamer terminal increased its internalization capacity, although this was not statistically significant.
[0354] 4.B. 2'-O-methylation (2'OMe) modification
[0355] In another assay, Apt49 was modified by alternating 2'F / 2'OMe in selected blocks. Figure 4 C). Notably, no variant showed better internalization than Apt49. However, some candidates were observed to exhibit higher internalization capacity when alternating 2'F / 2'OMe modifications were performed one by one. Figure 4 As shown in D, when bits 2, 9, 10, 13, 16, and 19 of Apt49 are modified by 2'OMe, the internalization is higher.
[0356] Table 3 below shows the sequences of the various chemically modified aptamers determined. All of these are versions of the Apt49 candidate.
[0357] Table 3. – Apt49 versions including (PTO) or 2'OMe modifications.
[0358]
[0359]
[0360]
[0361] Example 5. - Significance of nucleotides 20 and 29 of the Apt49 variant - Formula I aptamer for aptamer function
[0362] To highlight the importance of nucleotides 20 and 29 of the formula I aptamer, a specific comparative assay was designed in which the corresponding bases in the Apt49 sequence were mutated. Therefore, in the original Apt49 sequence, n 20 It is G, and n 29 It's U.
[0363] The tested Apt49 variants are as follows:
[0364] i) Apt49_UG: Replace the U in the 29th position with G;
[0365] ii) Apt49_GU: Replace the G in the 20th position with U.
[0366] See the corresponding sequences in Table 4 below:
[0367]
[0368] Figure 5 A shows the corresponding 3D conformation structure obtained using RNAfold WebServer, where a change in nucleotide 20 causes Apt49_GU to lose its 3-stem structure.
[0369] In addition, such as Figure 5 As shown in B, the internalization ability of both mutant variants is completely reduced. The results obtained indicate that specific bases at these two positions play a role in aptamer internalization and are therefore crucial when aptamer internalization is desired.
[0370] Example 6 - Predicted motifs in folded structures
[0371] For each generated aptamer, the folded structure was analyzed to determine the number of stems present in the most stable structure, as well as the number of nucleotides in each stem, loop, and stem-to-stem junction. This analysis was performed using OMPDE from DNA Software (USA). For a given aptamer sequence, the program predicts the more likely 3D structure of the aptamer based on a proprietary integrated nucleic acid folding algorithm and creates a ranking indicating the percentage of a given structure predicted to be present.
[0372] Of the 56 positive sequences, 44 were predicted to form 3-stem structures as their most stable folds, and in all these cases, the 3-stem structure was predicted in ≥80% of cases. (See also the section for illustrative purposes.) Figure 1B and 1C. In addition... Figure 6 The 3-stem structure of Apt49 is shown, which is one of the more preferred aptamers of the present invention.
[0373] We further investigated the suboptimal foldings of four positive outliers (Apt34, Apt75, Apt67, and Apt68) and found that in each case, the 3-stem structure was predicted as one of the suboptimal folds. For Apt75, the 3-stem structure was predicted to account for 35.8% of the folded structures.
[0374] In summary, the ability of aptamers to form 3-stem structures is positively correlated with their activity.
[0375] Example 7 - SPR Dynamics Measurement
[0376] SPR kinetic measurements of exemplary binding curves for candidates Apt49, Apt54, and Apt60 were obtained.
[0377] For the on-off (association-dissociation) rate plot, the calculated k a Mean with respect to k d Plotting the mean ( Figure 7 The example diagonal represents K for 0.1 nM and 1 nM. d value.
[0378]
[0379] Therefore, the on-off rate plot visualizes the dynamics (k a k d ) and affinity K d (K) d = k d / k a The relationship between K and K. They have the same affinity. d The fitters (points on the same diagonal) may come from different dynamics of these fitters.
[0380] References
[0381] Xiao T, Xiao Y, Wang W, Tang YY, Xiao Z, Su M. Targeting EphA2 incancer. J Hematol Oncol. 2020 Aug 18;13(1):114. doi: 10.1186 / s13045-020-00944-9. PMID: 32811512; PMCID: PMC7433191.
[0382] Tandon et al.. Emerging strategies for EphA2 receptor targeting forcancer therapeutics. Expert Opin Ther Targets. 2011; 15(1): 31-51.
[0383] Kasinski and Slack, Small RNAs deliver a blow to ovarian cancer.Cancer Discov. 2013; 3: 1220-1221.
[0384] Quinn et al.. Therapy of pancreatic cancer via an EphA2 receptor-targeted delivery of Gemcitabine. Oncotarget. 2016; 7: 17103-17110.
[0385] London M, Gallo E. The EphA2 and cancer connection: potential forimmune-based interventions. Mol Biol Rep. 2020 Oct;47(10):8037-8048. doi:10.1007 / s11033-020-05767-y. Epub 2020 Sep 29. PMID: 32990903.
[0386] Lennox KA, Behlke MA. Chemical modification and design of anti-miRNAoligonucleotides. Gene Ther. 2011 Dec;18(12):1111-20. doi: 10.1038 / gt.2011.100. Epub 2011 Jul 14. PMID: 21753793.
[0387] Thaker, P.H., Deavers, M., Celestino, J., Thornton, A., Fletcher,M.S., Landen, C.N., Kinch,M.S., Kiener, P.A., and Sood, A.K. (2004). EphA2expression is associated with aggressive features in ovarian carcinoma. Clin.Cancer Res. 10, 5145–5150.
[0388] Lin, Y.G., Han, L.Y., Kamat, A.A., Merritt, W.M., Landen, C.N.,Deavers, M.T., Fletcher, M.S., Urbauer, D.L., Kinch, M.S., and Sood, A.K.(2007). EphA2 overexpression is associated with angiogenesis in ovariancancer. Cancer 109, 332–340.
[0389] Walker-Daniels, J., Coffman, K., Azimi, M., Rhim, J.S., Bostwick,D.G., Snyder, P., Kerns, B.J., Waters, D.J., and Kinch, M.S. (1999).Overexpression of the EphA2 tyrosine kinase in prostate cancer. Prostate 41,275–280.
[0390] Zhao, Y., Cai, C., Zhang, M., Shi, L., Wang, J., Zhang, H., Ma, P.,and Li, S. (2021). Ephrin-A2 promotes prostate cancer metastasis by enhancingangiogenesis and promoting EMT. J. Cancer Res. Clin. Oncol. 147, 2013–2023.
[0391] Duxbury, M.S., Ito, H., Zinner, M.J., Ashley, S.W., and Whang, E.E.(2004). EphA2: a determinant of malignant cellular behavior and a potentialtherapeutic target in pancreatic adenocarcinoma. Oncogene 23, 1448–1456.
[0392] Wykosky, J., Gibo, D.M., Stanton, C., and Debinski, W. (2005). EphA2as a novel molecular marker and target in glioblastoma multiforme. Mol.Cancer Res. 3, 541–551.
[0393] Wang, L.F., Fokas, E., Bieker, M., Rose, F., Rexin, P., Zhu, Y.,Pagenstecher, A., Engenhart-Cabillic, R., and An, H.X. (2008). Increasedexpression of EphA2 correlates with adverse outcome in primary and recurrentglioblastoma multiforme patients. Oncol. Rep. 19, 151–156.
[0394] Kinch, M.S., Moore, M.-B., and Harpole, D.H. (2003). Predictive valueof the EphA2 receptor tyrosine kinase in lung cancer recurrence and survival.Clin. Cancer Res. 9, 613–618.
[0395] Margaryan , Nv , Strizzi , L. , Abbott , DE , Seftor , EA , Rao , MS ,Hendrix , MJC , and Hess , AR (2009). EphA2 as a promoter of melanomatumorigenicity. Cancer Biol. Ther. 8 , 279–288 .
[0396] Udayakumar , D. , Zhang , G. , Ji , Z. , Njauw , CN , Mroz , P. , and Tsao ,H. (2011). Epha2 is a critical oncogene in melanoma. Oncogene 30, 4921–4929.
[0397] Miyazaki , T. , Kato , H. , Fukuchi , M. , Nakajima , M. , and Kuwano , H. (2003). EphA2 overexpression correlates with poor prognosis in esophageal squamous cell carcinoma. Int. J. Cancer 103, 657–663.
[0398] Dunne , PD , Dasgupta , S , Blayney , JK , McArt , DG , Redmond , KL ,Weir , JA , Bradley , CA , Sasazuki , T , Shirasawa , S , Wang , T , et al. EphA2 expression is a key driver of migration and invasion and a poorprognostic marker in colorectal cancer. Clin. Cancer Res. 22 , 230–2
[0399] Kataoka , H. , Igarashi , H. , Kanamori , M. , Ihara , M. , Wang , JD , Wang ,YJ , Li , ZY , Shimamura , T. , Kobayashi , T. , Maruyama , K. , et al. (2004).Correlation of EPHA2 overexpression with high microvessel count in humanprimary colorectal cancer. Cancer Sci. 95 , 136–141 .
[0400] Saito , T. , Masuda , N. , Miyazaki , T. , Kanoh , K. , Suzuki , H. , Shimura , T. , Asao , T. , and Kuwano , H. (2004). Expression of EphA2 and E-cadherin in colorectal cancer: correlation with cancer metastasis. Oncol. Rep. 11 , 605–611 .
[0401] Giordano , G. , Merlini , A. , Ferrero , G. , Messiano , G. , Fiorino , E. ,Brusco , S. , Centomo , ML , Leuci , V. , D'ambrosio , L. , Aglietta , M. , et al.(2021). EphA2 expression in bone sarcomas: bioinformatic analyzes andpreclinical characterization in patient-derived models of osteosarcoma,ewing's sarcoma and chondrosarcoma. Cells 10 ,
[0402] Posthumadeboer, J., Piersma, S.R., Pham, T.v., van Egmond, P.W.,Knol, J.C., Cleton-Jansen, A.M., van Geer, M.A., van Beusechem, V.W.,Kaspers, G.J.L., van Royen, B.J., et al. (2013). Surface proteomic analysisof osteosarcoma identifies EPHA2 as receptor for targeted drug delivery. Br.J. Cancer 109, 2142–2154.
[0403] Zhang, X. (2021). The expression profile and prognostic values ofEPHA family members in breast cancer. Front. Oncol. 11, 619949.
[0404] Brantley-Sieders, D.M., Zhuang, G., Hicks, D., Fang, W.B., Hwang, Y.,Cates, J.M.M., Coffman, K., Jackson, D., Bruckheimer, E., Muraoka-Cook, R.S.,and Chen, J. (2008). The receptor tyrosine kinase EphA2 promotes mammaryadenocarcinoma tumorigenesis and metastatic progression in mice by amplifyingErbB2 signaling. J. Clin. Invest. 118, 64–78.
[0405] Zelinski, D.P., Zantek, N.D., Stewart, J.C., Irizarry, A.R., andKinch, M.S. (2001). EphA2 overexpression causes tumorigenesis of mammaryepithelial cells. Cancer Res. 61, 2301–2306.
[0406] Brantley-Sieders, D.M., Fang, W.B., Hicks, D.J., Zhuang, G., Shyr,Y., and Chen, J. (2005). Impaired tumor microenvironment in EphA2-deficientmice inhibits tumor angiogenesis and metastatic progression. Faseb. J. 19,1884–1886.
[0407] Carles-Kinch, K., Kilpatrick, K.E., Stewart, J.C., and Kinch, M.S.(2002). Antibody targeting of the EphA2 tyrosine kinase inhibits malignantcell behavior. Cancer Res. 62, 2840–2847.
[0408] Yang, Y., Nian, S., Li, L., Wen, X., Liu, Q., Zhang, B., Lan, Y.,Yuan, Q., and Ye, Y. (2021). Fully human recombinant antibodies against EphA2from a multi-tumor patient immune library suitable for tumor-targetedtherapy. Bioengineered 12, 10379–10400.
[0409] Biao-xue, R., Xi-guang, C., Shuan-ying, Y., Wei, L., and Zong-juan,M. (2011). EphA2-Dependent molecular targeting therapy for malignant tumors.Curr. Cancer Drug Targets 11, 1082–1097.
[0410] Jackson, D., Gooya, J., Mao, S., Kinneer, K., Xu, L., Camara, M.,Fazenbaker, C., Fleming, R., Swamynathan, S., Meyer, D., et al. (2008). Ahuman antibody-drug conjugate targeting EphA2 inhibits tumor growth in vivo.Cancer Res. 68, 9367–9374.
[0411] Koolpe, M., Dail, M., and Pasquale, E.B. (2002). An ephrin mimeticpeptide that selectively targets the EphA2 receptor. J. Biol. Chem. 277,46974–46979.
[0412] Wang, S., Placzek, W.J., Stebbins, J.L., Mitra, S., Noberini, R.,Koolpe, M., Zhang, Z., Dahl, R., Pasquale, E.B., and Pellecchia, M. (2012).Novel targeted system to deliver chemotherapeutic drugs to EphA2-expressingcancer cells. J. Med. Chem. 55, 2427–2436.
[0413] Odeh, F., Nsairat, H., Alshaer, W., Ismail, M.A., Esawi, E., Qaqish,B., Bawab, A.A., Ismail, S.I., and Jo, A.A.B. (2019). Aptamers chemistry:chemical modifications and conjugation strategies. Molecules 25, 3.
[0414] Adachi, T., & Nakamura, Y. (2019). Aptamers: A Review of TheirChemical Properties and Modifications for Therapeutic Application. Molecules(Basel, Switzerland), 24(23), 4229.
[0415] Beaucage, S. L.; Lyer, R. P. (1992). "Advances in the Synthesis ofOligonucleotides by the Phosphoramidite Approach". Tetrahedron. 48 (12):2223.
[0416] Chen Z, Luo H, Gubu A, Yu S, Zhang H, Dai H, Zhang Y, Zhang B, Ma Y,Lu A, Zhang G. (2023). Chemically modified aptamers for improving bindingaffinity to the target proteins via enhanced non-covalent bonding. Front CellDev Biol. 11:1091809.
[0417] Santana-Viera L, Dassie JP, Rosàs-Lapeña M, Garcia-Monclús S, Chicón-Bosch M, Pérez-Capó M, Pozo LD, Sanchez-Serra S, Almacellas-Rabaiget O,Maqueda-Marcos S, López-Alemany R, Thiel WH, Giangrande PH, Tirado OM.Combination of protein and cell internalization SELEX identifies a potentialRNA therapeutic and delivery platform to treat EphA2-expressing tumors. MolTher Nucleic Acids. 2023 May 8;32:758-772.
[0418] John Santalucia, Jr. (2007) "Physical principles and visual-OMPsoftware for optimal PCR design." in Methods in Molecular Biology, HumanaPress, 402:3-34, 1-59745-528-8:3
[0419] Zachary J Kartje, Helen I Janis, Shaoni Mukhopadhyay, Keith T GagnonRevisiting T7 RNA polymerase transcription in vitro with the Broccoli RNAaptamer as a simplified real-time fluorescent reporter J Biol Chem. 2021 Jan-Jun;296:100175
[0420] Kristina W. Thiel, Luiza I. Hernandez, Justin P. Dassie, William H.Thiel, Xiuying Liu, Katie R. Stockdale, Alissa M. Rothman, Frank J.Hernandez, James O. McNamara and Paloma H. Giangrande Delivery of chemo-sensitizing siRNAs to HER2+-breast cancer cells using RNA aptamers NucleicAcids Research, 2012, Vol. 40, No. 13 6319–6337
[0421] Paula E Burmeister, Scott D Lewis, Robert F Silva, Jeffrey R Preiss,Lillian R Horwitz, P Shannon Pendergrast, Thomas G McCauley, Jeffrey C Kurz,David M Epstein, Charles Wilson, Anthony D Keefe Direct in vitro selection ofa 2'-O-methyl aptamer to VEGF Chem Biol. 2005 Jan;12(1):25-33
[0422] Michael Kohlberger, Gabriele Gadermaier SELEX: Critical factors andoptimization strategies for successful aptamer selection Biotechnol ApplBiochem. 2022;69:1771–1792.
[0423] A Jäschke, JP Fürste, E Nordhoff, F Hillenkamp, D Cech, and V AErdmann Synthesis and properties of oligodeoxyribonucleotide-polyethyleneglycol conjugates Nucleic Acids Res. 1994 Nov 11; 22(22): 4810–4817.
[0424] Kölmel, Dominik K.; Kool, Eric T. (2017). "Oximes and Hydrazones inBioconjugation: Mechanism and Catalysis". Chemical Reviews. 117 (15): 10358–10376.
[0425] Doronina, SO et al. Development of potent monoclonal antibodyauristatin conjugates for cancer therapy. Nat. Biotechnol. 21, 778–784 (2003)
[0426] The project of this invention
[0427] 1. A nucleic acid aptamer that specifically binds to EphA2, preferably human EphA2, said aptamer comprising three polynucleotide regions, defined as follows, provided in the 5' to 3' sequence of said aptamer: region 1, region 2, and region 3, wherein:
[0428] i. Region 1 has equation (R1):
[0429] 5' n1n2G AG n6n7C n9 n 10 n 11 n 12 n 13 GG n 16 n 17 C 3'
[0430] in:
[0431] n1 and n2 are independently selected from G, dG, or -;
[0432] n6 is G, dG, or -;
[0433] n7 is A, dA, or -;
[0434] n9 is G, dG, or -;
[0435] n 10 It is A, dA, or -;
[0436] n 11 It is U, dU, or -;
[0437] n 12 It is G, dG, or -;
[0438] n 13 It is C, dC, or -;
[0439] n 16 It is U, dU, or -;
[0440] n 17 It is C, dC, or -;
[0441] G, A, U, and C are ribonucleotides; dG, dA, dU, and dC are 2'-deoxyribonucleotides, where the corresponding ribonucleotide or deoxyribonucleotide includes its modified form, and "-" indicates the absence of nucleotides;
[0442] The premise is:
[0443] n6 and n 17 Neither the complementary nucleotide nor, alternatively, is present.
[0444] n7 and n 16 Neither the complementary nucleotide nor, alternatively, is present.
[0445] When n1 is -, then n 12 Yes; and
[0446] When n7 is -, then n 11 It is U or dU;
[0447] ii. Region 2 has equation (R2):
[0448] 5' UG n 21 n 22 n 23 n 24 n 25 UG n 28 UC n 31 UCCCCA n 38 n 39 n 40 n 41 n 42 3'
[0449] in:
[0450] n 21 It is U, dU, or -;
[0451] n 22 It is C, dC, or -;
[0452] n 23 It is G, dG, or -;
[0453] n 24 It is U, dU, or -;
[0454] n 25 It is C, dC, or -;
[0455] n 28 It is U, dU, or -;
[0456] n 31 It is G, dG, or -;
[0457] n 38 It is G, dG, or -;
[0458] n 39 It is A, dA, or -;
[0459] n 40 It is C, dC, or -;
[0460] n 41 It is G, dG, or -;
[0461] n 42 It is A, dA, or -;
[0462] The premise is:
[0463] n 21 and n 42 Neither the complementary nucleotide nor, alternatively, is present.
[0464] n 22 and n 41 Neither the complementary nucleotide nor, alternatively, is present.
[0465] n 23 and n 40 Neither the complementary nucleotide nor, alternatively, is present.
[0466] n 24 and n 39 Neither complementary nucleotides nor, alternatively, are present; and
[0467] n 25 and n 38 Neither the complementary nucleotide nor, alternatively, is present.
[0468] iii. Region 3 has equation (R3):
[0469] 5' CUCGC n 48 n 49 n 50 n 51 3'
[0470] in:
[0471] n 48 It is C, dC, or -;
[0472] n 49 It is C, dC, or -;
[0473] n 50 It is G, dG, or -;
[0474] n 51 It is A, dA, or -;
[0475] The premise is:
[0476] n1 of R1 and n of R3 49 Neither is a complementary nucleotide nor, alternatively, is present; and
[0477] n2 of R1 and n of R3 48 Neither the complementary nucleotide nor, alternatively, is present.
[0478] Preferably, the aptamer is further characterized in that:
[0479] a) Having a length of 50 or fewer nucleotides; and / or
[0480] b) R1 of n 11 and / or n 12 It does not exist.
[0481] 2. The nucleic acid aptamer according to Project 1, comprising or consisting of the sequence of formula (I):
[0482]
[0483] Nucleotides n1, n2, n6, n7, n9 to n 13 n 16 n 17 n 21 up to n 25 n 28 n 31 n 38 up to n 42 and n 48 up to n 51 As defined in Project 1, the preferred option is where n25 It is C and n 28 It's U.
[0484] 3. The nucleic acid aptamer according to any one of the foregoing items, wherein the nucleotide is a ribonucleotide.
[0485] 4. Nucleic acid aptamers as described in items 1 to 3, wherein...
[0486] i. When n9 to n 13 If two or more of them are missing, then n6 and n 17 They are complementary nucleotides and n7 and n 16 They are complementary nucleotides; and / or
[0487] ii. When n9 to n 13 If only one of them is missing, then n 11 or n 12 It does not exist.
[0488] 5. Nucleic acid aptamers according to any one of items 1 to 4, wherein all nucleotides n9 to n 13 Neither of them exists; n6 and n 17 Complementary, and n7 and n 16 Complementary.
[0489] 6. Nucleic acid aptamers according to any one of items 1 to 5, wherein n 23 and n 40 It does not exist; and
[0490] n 21 With n 42 Complementary; and / or
[0491] n 25 With n 38 Complementary.
[0492] 7. Nucleic acid aptamers according to any one of items 1 to 6, wherein
[0493] n 22 and n 41 It does not exist;
[0494] n 23 and n 40 It does not exist; and
[0495] n 24 and n 39 It does not exist; and
[0496] Preferably, n6 and n 17 They are complementary nucleotides; and
[0497] Preferably, n7 and n 16 They are complementary nucleotides.
[0498] 8. The nucleic acid aptamer according to any one of the foregoing items, wherein n 21 isU,n 25 It is C, n 28 isU,n 31 It is G, n 38 It is G and n 42 It is A.
[0499] 9. The nucleic acid aptamer according to any one of the foregoing items, wherein
[0500] n1 of R1 and n of R3 49 Does not exist; and / or
[0501] n2 of R1 and n of R3 48 It does not exist;
[0502] n 50 It is G and n 51 It is A.
[0503] 10. The nucleic acid aptamer according to any one of the foregoing items, wherein
[0504] n1 of R1 and n of R3 49 Complementary;
[0505] n2 of R1 and n of R3 48 Complementary; and
[0506] n 50 It is G and n 51 It is A.
[0507] 11. A nucleic acid aptamer that specifically binds to EphA2, preferably human EphA2, wherein the nucleic acid aptamer is selected from sequences identified in Tables 2.1 and / or 2.2, or variants having at least 85%, preferably at least 90%, more preferably at least 95% identity with any of them.
[0508] 12. The nucleic acid aptamer according to any one of items 1 to 10, wherein the aptamer is selected from the sequences identified in Tables 2.1 and / or 2.2, or variants having at least 85%, preferably at least 90%, more preferably at least 95% identity with any of them.
[0509] 13. The nucleic acid aptamer according to any one of the preceding items, wherein the nucleic acid aptamer is further characterized in that, when using folding prediction software (e.g., OMP DE from DNA Software), the predicted 3-stem structure accounts for at least 35% of the folded structure.
[0510] 14. The nucleic acid aptamer according to any one of the preceding items, wherein the aptamer contains at least 38 nucleotides, preferably 40 to 50 nucleotides.
[0511] 15. The nucleic acid aptamer according to any one of the preceding items, wherein the aptamer is characterized by having one or more of the following features:
[0512] a. By using surface plasmon resonance (SPR) measurements with the Biacore biosensor system, the binding response is superior to AptP, preferably wherein the measured value of the aptamer (e.g. at the end of dissociation) is at least one time higher than that of AptP, more preferably at least 1.5 or 2 times higher.
[0513] b. SPR was measured using the Biacore biosensor system at a rate of 1 x 10⁻⁶. -9 M or lower KD combined with human EphA2;
[0514] c. The aptamer exhibits superior internalization properties in EphA2-expressing cells as determined by RT-qPCR, wherein the measured value of the aptamer is at least one-fold higher than that of AptP, more preferably at least 1.5 or 2 times higher; and / or
[0515] d. Reduced in vitro migration of EphA2-expressing cells, such as A673 cells, compared to untreated cells or control aptamers.
[0516] 16. The nucleic acid aptamer according to any one of the preceding items, wherein one or more nucleotides are chemically modified, preferably, wherein the chemical modification includes one or more of the following:
[0517] i. Modifications to the sugar ring, such as 2'-substitution, 4'-oxygen substitution, or locked nucleic acids.
[0518] ii. Modifications to the phosphodiester bond, such as methylphosphonate or thiophosphate and triazole modification; and
[0519] iii. Modifications on nucleic acid bases, such as the C5 position of pyrimidine and the N7 position of purine.
[0520] 17. The nucleic acid aptamer according to item 16, wherein at least one of the nucleotide sequences, preferably all pyrimidine moieties, is a 2'-substituted pyrimidine.
[0521] 18. The nucleic acid aptamer according to item 16 or 17, wherein one or more 2' substitutions are selected from 2'-F (2'-fluorine), 2'-MOE (2'-methoxyethyl), and 2'-OMe (2'-O-methyl).
[0522] 19. A complex comprising an aptamer and one or more portions as defined in any of the preceding items.
[0523] 20. The complex according to item 19, wherein the aptamer is directly connected to the one or more portions; or, alternatively, the aptamer is indirectly connected to the one or more portions via a connector.
[0524] 21. The complex according to any one of items 19 to 20, wherein said portion is selected from:
[0525] (i) Antisense oligonucleotides (ASO), siRNA, microRNA, shRNA, or ribozymes;
[0526] (ii) Selected from polysaccharides, lipids (e.g., cholesterol or other lipid fractions), non-protein polymers (e.g., one or more polyethylene glycol (PEG) chains), polyamines, peptides, proteins, small molecules, and combinations thereof;
[0527] (iii) A marker for detection purposes; preferably the marker is selected from biotin, enzymes, cofactors, fluorescent materials, luminescent materials, bioluminescent materials, electron-dense markers, markers for magnetic resonance imaging, radioactive materials, and combinations thereof;
[0528] (iv) Medicines;
[0529] (vi) Nanoparticles; and
[0530] (vii) Any combination thereof.
[0531] 22. The complex according to any one of items 19 to 21, wherein said portion is siRNA, preferably siRNA that recognizes a specific translocation product characterizing cancer expressing EphA2.
[0532] 23. A composition comprising the aptamer of any one of items 1 to 18 or the complex of any one of items 19 to 22.
[0533] 24. The composition according to item 23, wherein the composition is a pharmaceutical composition comprising a pharmaceutically acceptable excipient and / or carrier.
[0534] 25. The aptamer of any one of items 1 to 18, the complex of any one of items 19 to 22, or the pharmaceutical composition of item 24, used as a medicine.
[0535] 26. The use of the aptamer of any one of items 1 to 18 or the complex of any one of items 19 to 22 as an EphA2 detection or quantification agent; or as an internalization mediator for cells that target EphA2 expression.
[0536] 27. The aptamer of any one of items 1 to 18, the complex of any one of items 19 to 22, or the composition of item 23 or 24, for use in in vivo detection methods, such as in vivo diagnostic methods.
[0537] 28. The use of the nucleic acid aptamer of any one of items 1 to 18, the complex of any one of items 19 to 22, or the composition of item 23 or 24 as a detection agent in an in vitro or ex vivo detection method, such as a diagnostic agent in an in vitro or ex vivo diagnostic method.
[0538] 29. A kit for detecting or quantifying EphA2, comprising an aptamer as described in any one of items 1 to 18, a complex as described in any one of items 19 to 22, or a composition as described in item 23 or 24; and optionally, means for detecting the aptamer or the complex.
[0539] 30. A method for detecting or quantifying EphA2, wherein the method comprises the step of detecting or quantifying EphA2 using an aptamer as described in any one of items 1 to 18, a complex as described in any one of items 19 to 22, a composition as described in item 23 or 24, or a kit as described in item 29.
[0540] 31. A nucleic acid aptamer that specifically binds to EphA2, preferably human EphA2, said aptamer comprising three polynucleotide regions, defined as follows, provided in the 5' to 3' sequence of said aptamer: region 1, region 2, and region 3, wherein:
[0541] i. Region 1 has equation (R1):
[0542] 5' n1n2G AG n6n7C n9 n 10 n 11 n 12 n 13 GG n 16 n 17 C 3'
[0543] in:
[0544] n1 and n2 are independently selected from G, dG, or -;
[0545] n6 is G, dG, or -;
[0546] n7 is A, dA, or -;
[0547] n9 is G, dG, or -;
[0548] n 10 It is A, dA, or -;
[0549] n 11 It is U, dU, or -;
[0550] n 12 It is G, dG, or -;
[0551] n 13 It is C, dC, or -;
[0552] n 16 It is U, dU, or -;
[0553] n 17 It is C, dC, or -;
[0554] Where G, A, U, and C are ribonucleotides; dG, dA, dU, and dC are 2'-deoxyribonucleotides, wherein unless otherwise specified, the corresponding nucleotides include unmodified nucleotides and their modified forms, and "-" indicates the absence of nucleotides;
[0555] The premise is:
[0556] n6 and n 17 Neither the complementary nucleotide nor, alternatively, is present.
[0557] n7 and n 16 Neither the complementary nucleotide nor, alternatively, is present.
[0558] When n1 is -, then n 12 Yes; and
[0559] When n7 is -, then n 11 It is U or dU;
[0560] ii. Region 2 has equation (R2):
[0561] 5' UG n 21 n 22 n 23 n 24 n 25 UG n 28 UC n 31 UCCCCA n 38 n 39 n 40 n 41 n 42 3'
[0562] in:
[0563] n 21 It is U, dU, or -;
[0564] n 22 It is C, dC, or -;
[0565] n 23 It is G, dG, or -;
[0566] n 24 It is U, dU, or -;
[0567] n 25 It is C, dC, or -;
[0568] n 28 It is U, dU, or -;
[0569] n 31 It is G, dG, or -;
[0570] n 38 It is G, dG, or -;
[0571] n 39 It is A, dA, or -;
[0572] n 40 It is C, dC, or -;
[0573] n 41 It is G, dG, or -;
[0574] n 42 It is A, dA, or -;
[0575] The premise is:
[0576] n 21 and n 42 Neither the complementary nucleotide nor, alternatively, is present.
[0577] n 22 and n 41 Neither the complementary nucleotide nor, alternatively, is present.
[0578] n 23 and n 40 Neither the complementary nucleotide nor, alternatively, is present.
[0579] n 24 and n 39 Neither complementary nucleotides nor, alternatively, are present; and
[0580] n 25 and n 38 Neither the complementary nucleotide nor, alternatively, is present.
[0581] iii. Region 3 has equation (R3):
[0582] 5' CUCGC n 48 n 49 n 50 n51 3'
[0583] in:
[0584] n 48 It is C, dC, or -;
[0585] n 49 It is C, dC, or -;
[0586] n 50 It is G, dG, or -;
[0587] n 51 It is A, dA, or -;
[0588] The premise is:
[0589] n1 of R1 and n of R3 49 Neither is a complementary nucleotide nor, alternatively, is present; and
[0590] n2 of R1 and n of R3 48 Neither the complementary nucleotide nor, alternatively, is present.
[0591] Or alternatively
[0592] A complex comprising a nucleic acid aptamer, wherein the aptamer is directly linked to one or more portions; or, alternatively, the aptamer is indirectly linked to one or more portions via a linker; or
[0593] Pharmaceutical compositions comprising aptamers or aptamer complexes,
[0594] Methods for in vivo detection of EphA-related diseases in subjects, such as in vivo diagnosis or treatment.
[0595] 32. Use of nucleic acid aptamers, complexes or compositions as defined in Item 31 as diagnostic agents in in vitro or ex vivo detection methods, such as in vitro or ex vivo diagnosis of EphA-related diseases.
[0596] 33. Nucleic acid aptamers, complexes, or compositions for the use described in item 31 or for the use described in item 32, wherein the EphA2-related disease is a cancer characterized by the expression of EphA2, preferably the cancer being selected from Ewing sarcoma, Ewing-like sarcoma, rhabdomyosarcoma (such as alveolar rhabdomyosarcoma), colon cancer, prostate cancer, breast cancer, ovarian cancer, bladder cancer, esophageal cancer, pancreatic adenocarcinoma, brain cancer, head and neck cancer, cervical squamous cell carcinoma, and cervical endometrial adenocarcinoma.
[0597] 34. The nucleic acid aptamer, complex, or composition in the method for treating EphA2-related diseases according to item 31 or 33, wherein the aptamer, the complex, or the pharmaceutical composition is administered in combination with another drug.
[0598] 35. The nucleic acid aptamer, complex, or composition in the method for treating EphA2-related diseases according to item 34, wherein the aptamer, the complex, or the pharmaceutical composition may be administered sequentially or simultaneously with other drugs, and is part of the same composition or a separate composition.
[0599] 36. Nucleic acid aptamers, complexes, or compositions for the purposes described in Item 31 or 33 to 36, or for the purposes described in Item 32 or 33, wherein the aptamer, the complex, or the composition is as defined in Item 31.
[0600] 37. A kit comprising the aptamer, complex, or composition defined in item 31 and optionally means for detecting the aptamer or complex for the purpose of detecting, for example, diagnosing EphA2-related diseases, preferably wherein said EphA2-related diseases are cancers characterized by the expression of EphA2, such as Ewing sarcoma, Ewing-like sarcoma, rhabdomyosarcoma (e.g., alveolar rhabdomyosarcoma), colon cancer, prostate cancer, breast cancer, ovarian cancer, bladder cancer, esophageal cancer, pancreatic adenocarcinoma, brain cancer, head and neck cancer, cervical squamous cell carcinoma, or cervical endometrial adenocarcinoma.
[0601] 38. A method for detecting, for example diagnosing, EphA2-related diseases, wherein the method includes the step of detecting or quantifying EphA2 using an aptamer, complex, or composition or kit as defined in item 31; preferably, wherein the EphA2-related disease is a cancer characterized by the expression of EphA2, such as Ewing sarcoma, Ewing-like sarcoma, rhabdomyosarcoma (e.g., alveolar rhabdomyosarcoma), colon cancer, prostate cancer, breast cancer, ovarian cancer, bladder cancer, esophageal cancer, pancreatic adenocarcinoma, brain cancer, head and neck cancer, cervical squamous cell carcinoma, or cervical endometrial adenocarcinoma.
[0602] Further items of the present invention
[0603] 39. A nucleic acid aptamer that specifically binds to EphA2, preferably human EphA2, said aptamer comprising three polynucleotide regions, defined as follows, provided in the 5' to 3' sequence of said aptamer: region 1, region 2, and region 3, wherein:
[0604] i. Region 1 has equation (R1):
[0605] 5' n1n2G AG n6n7C n9 n 10 n 11 n 12 n 13 GG n 16 n 17 C 3'
[0606] in:
[0607] n1 and n2 are independently selected from G or -;
[0608] n6 is G or -;
[0609] n7 is either A or -;
[0610] n9 is either G or -;
[0611] n 10 It is either A or -;
[0612] n 11 It is either U or -;
[0613] n 12 It is G or -;
[0614] n 13 It is C or -;
[0615] n 16 It is either U or -;
[0616] n 17 It is C or -;
[0617] G, A, U, and C are ribonucleotides; they include both their unmodified and modified forms, and "-" indicates the absence of nucleotides.
[0618] The premise is:
[0619] n6 and n 17 Neither the complementary nucleotide nor, alternatively, is present.
[0620] n7 and n 16 Neither the complementary nucleotide nor, alternatively, is present.
[0621] When n1 is -, then n 12 Yes; and
[0622] When n7 is -, then n 11 is U;
[0623] ii. Region 2 has equation (R2):
[0624] 5' UG n 21 n 22 n 23 n 24 n 25 UG n 28 UC n 31 UCCCCA n 38 n 39 n 40 n 41 n 423'
[0625] in:
[0626] n 21 It is either U or -;
[0627] n 22 It is C or -;
[0628] n 23 It is G or -;
[0629] n 24 It is either U or -;
[0630] n 25 It is C or -;
[0631] n 28 It is either U or -;
[0632] n 31 It is G or -;
[0633] n 38 It is G or -;
[0634] n 39 It is either A or -;
[0635] n 40 It is C or -;
[0636] n 41 It is G or -;
[0637] n 42 It is either A or -;
[0638] The premise is:
[0639] n 21 and n 42 Neither the complementary nucleotide nor, alternatively, is present.
[0640] n 22 and n 41 Neither the complementary nucleotide nor, alternatively, is present.
[0641] n 23 and n 40 Neither the complementary nucleotide nor, alternatively, is present.
[0642] n 24 and n 39 Neither complementary nucleotides nor, alternatively, are present; and
[0643] n 25 and n 38 Neither the complementary nucleotide nor, alternatively, is present.
[0644] iii. Region 3 has equation (R3):
[0645] 5' CUCGC n 48 n 49 n 50 n 51 3'
[0646] in:
[0647] n 48 It is C or -;
[0648] n 49 It is C or -;
[0649] n 50 It is G or -;
[0650] n 51 It is either A or -;
[0651] The premise is:
[0652] n1 of R1 and n of R3 49 Neither is a complementary nucleotide nor, alternatively, is present; and
[0653] n2 of R1 and n of R3 48 Neither the complementary nucleotide nor, alternatively, is present.
[0654] The aptamer is further characterized in that:
[0655] a) Having a length of 50 or fewer nucleotides; and / or
[0656] b) R1 of n 11 and / or n 12 It does not exist.
[0657] 40. The nucleic acid aptamer according to Item 39, comprising or consisting of the sequence of formula (I):
[0658]
[0659] Nucleotides n1, n2, n6, n7, n9 to n 13 n 16 n 17 n 21 up to n 25 n 28 n 31 n 38 up to n 42 and n 48 up to n 51 As defined in claim 1, preferably n 25 It is C and n 28 It's U.
[0660] 41. The nucleic acid aptamer according to any one of items 39 or 40, wherein the aptamer is selected from the sequences identified in Table 2.1 and / or Table 2.2, or variants having at least 85%, preferably at least 90%, more preferably at least 95% identity with any of them.
[0661] 42. A complex comprising an aptamer as defined in any of the preceding claims and one or more portions selected from:
[0662] (i) Antisense oligonucleotides (ASO), siRNA, microRNA, shRNA, or ribozymes;
[0663] (ii) Selected from polysaccharides, lipids (e.g., cholesterol or other lipid fractions), non-protein polymers (e.g., one or more polyethylene glycol (PEG) chains), polyamines, peptides, proteins, small molecules, and combinations thereof;
[0664] (iii) A marker for detection purposes; preferably the marker is selected from biotin, enzymes, cofactors, fluorescent materials, luminescent materials, bioluminescent materials, electron-dense markers, markers for magnetic resonance imaging, radioactive materials, and combinations thereof;
[0665] (iv) Medicines;
[0666] (vi) Nanoparticles; and
[0667] (vii) Any combination thereof.
[0668] 43. A composition comprising the aptamer of any one of items 39 to 41 or the complex of claim 4, preferably wherein the composition is a pharmaceutical composition comprising a pharmaceutically acceptable excipient and / or carrier.
[0669] 44. The aptamer of any one of items 39 to 41, the complex of item 42, or the composition of item 43, used alone or as a combination therapy, as a medicine.
[0670] 45. The aptamer of any one of items 39 to 41, the complex of item 42, or the composition of item 43, used in an in vivo detection or quantification method for a target protein, or in an in vivo detection or prognostic method for a disease.
[0671] 46. The nucleic acid aptamer of any one of items 39 to 41, the complex of item 42, or the composition of item 43 as a detection agent or quantification agent in an in vitro or ex vivo detection or quantification method for a target protein, or in an in vitro or ex vivo detection or prognostic method for a disease.
[0672] 47. A kit for detecting or quantifying EphA2, comprising the aptamer of any one of items 39 to 41, the complex of item 42, or the composition of item 43; and optionally, means for detecting the aptamer or the complex.
[0673] 48. A nucleic acid aptamer that specifically binds to EphA2, preferably human EphA2, said aptamer comprising three polynucleotide regions, defined as follows, provided in the 5' to 3' sequence of said aptamer: region 1, region 2, and region 3, wherein:
[0674] i. Region 1 has equation (R1):
[0675] 5' n1n2G AG n6n7C n9 n 10 n 11 n 12 n 13 GG n 16 n 17 C 3'
[0676] in:
[0677] n1 and n2 are independently selected from G or -;
[0678] n6 is G or -;
[0679] n7 is either A or -;
[0680] n9 is either G or -;
[0681] n 10 It is either A or -;
[0682] n 11 It is either U or -;
[0683] n 12 It is G or -;
[0684] n 13 It is C or -;
[0685] n 16 It is either U or -;
[0686] n 17 It is C or -;
[0687] G, A, U, and C are ribonucleotides; they include both their unmodified and modified forms, and "-" indicates the absence of nucleotides.
[0688] The premise is:
[0689] n6 and n 17 Neither the complementary nucleotide nor, alternatively, is present.
[0690] n7 and n 16 Neither the complementary nucleotide nor, alternatively, is present.
[0691] When n1 is -, then n 12 Yes; and
[0692] When n7 is -, then n 11 is U;
[0693] ii. Region 2 has equation (R2):
[0694] 5' UG n 21 n 22 n 23 n 24 n 25 UG n 28 UC n 31 UCCCCA n 38 n 39 n 40 n 41 n 42 3'
[0695] in:
[0696] n 21 It is either U or -;
[0697] n 22 It is C or -;
[0698] n 23 It is G or -;
[0699] n 24 It is either U or -;
[0700] n 25 It is C or -;
[0701] n 28 It is either U or -;
[0702] n 31 It is G or -;
[0703] n 38 It is G or -;
[0704] n 39 It is either A or -;
[0705] n 40 It is C or -;
[0706] n 41 It is G or -;
[0707] n 42 It is either A or -;
[0708] The premise is:
[0709] n 21 and n 42 Neither the complementary nucleotide nor, alternatively, is present.
[0710] n 22 and n 41 Neither the complementary nucleotide nor, alternatively, is present.
[0711] n 23 and n 40 Neither the complementary nucleotide nor, alternatively, is present.
[0712] n 24 and n 39 Neither complementary nucleotides nor, alternatively, are present; and
[0713] n 25 and n 38 Neither the complementary nucleotide nor, alternatively, is present.
[0714] iii. Region 3 has equation (R3):
[0715] 5' CUCGC n 48 n 49 n 50 n 51 3'
[0716] in:
[0717] n 48 It is C or -;
[0718] n 49 It is C or -;
[0719] n 50 It is G or -;
[0720] n 51 It is either A or -;
[0721] The premise is:
[0722] n1 of R1 and n of R3 49 Neither is a complementary nucleotide nor, alternatively, is present; and
[0723] n2 of R1 and n of R3 48 Neither the complementary nucleotide nor, alternatively, is present.
[0724] Or alternatively
[0725] A complex comprising a nucleic acid aptamer, wherein the aptamer is directly linked to one or more portions; or, alternatively, the aptamer is indirectly linked to one or more portions via a linker; or
[0726] Composition comprising an aptamer or an aptamer complex,
[0727] For
[0728] Methods for in vivo detection or quantification of EphA2; or
[0729] Methods for the in vivo detection or quantification of EphA2 or cells expressing EphA2 for the screening, diagnosis, prognosis, or monitoring of EphA2-related diseases.
[0730] Methods for treating cancer or EphA2-related diseases in the target population;
[0731] Preferably, the EphA2-related disease is a cancer characterized by the expression of EphA2, and preferably the cancer is selected from Ewing sarcoma, Ewing-like sarcoma, rhabdomyosarcoma (such as alveolar rhabdomyosarcoma), colon cancer, prostate cancer, breast cancer, ovarian cancer, bladder cancer, esophageal cancer, pancreatic adenocarcinoma, brain cancer, head and neck cancer, cervical squamous cell carcinoma and cervical endometrial adenocarcinoma.
[0732] 49. The use of nucleic acid aptamers or complexes as defined in Item 48 as EphA2 detection or quantification agents; or as internalization mediators for cells that target EphA2 expression.
[0733] 50. The use of nucleic acid aptamers, complexes, or compositions as defined in Item 48 as detection or quantification agents in in vitro or ex vivo methods for the detection or quantification of EphA2, or in methods including the in vitro or ex vivo detection or quantification of EphA2 for the screening, diagnosis, prognosis, or monitoring of EphA2-related diseases.
[0734] Preferably, the EphA2-related disease is a cancer characterized by the expression of EphA2, and preferably the cancer is selected from Ewing sarcoma, Ewing-like sarcoma, rhabdomyosarcoma (such as alveolar rhabdomyosarcoma), colon cancer, prostate cancer, breast cancer, ovarian cancer, bladder cancer, esophageal cancer, pancreatic adenocarcinoma, brain cancer, head and neck cancer, cervical squamous cell carcinoma and cervical endometrial adenocarcinoma.
[0735] 51. The nucleic acid aptamer, complex, or composition in the method for treating EphA2-related diseases according to item 48, or the use according to item 50, wherein the aptamer, the complex, or the pharmaceutical composition is administered in combination with another drug.
[0736] 52. A kit containing the aptamer, complex, or composition defined in item 48, and optionally means for detecting the aptamer or complex, for the detection or quantification of EphA2.
[0737] In methods for the in vitro or ex vivo detection or quantification of EphA2, or
[0738] Use in methods for the in vitro or ex vivo detection or quantification of EphA2 for the screening, diagnosis, prognosis, or monitoring of EphA2-related diseases.
[0739] Preferably, the EphA2-related disease is a cancer characterized by the expression of EphA2, such as Ewing sarcoma, Ewing-like sarcoma, rhabdomyosarcoma (e.g., alveolar rhabdomyosarcoma), colon cancer, prostate cancer, breast cancer, ovarian cancer, bladder cancer, esophageal cancer, pancreatic adenocarcinoma, brain cancer, head and neck cancer, cervical squamous cell carcinoma, or cervical endometrial adenocarcinoma.
[0740] 53. A method for producing the nucleic acid aptamer of any one of items 39 to 41, wherein the method comprises synthesizing the aptamer using a standard solid-phase method via phosphoramide synthesis; or synthesizing the aptamer by in vitro transcription using a standard or modified reverse transcriptase or as a direct result of an exponential enrichment ligand system evolution (SELEX) process.
[0741] 54. A method for producing a complex, wherein the method comprises:
[0742] (i) Providing a nucleic acid aptamer according to the first aspect of the present invention; and
[0743] (ii) Connect the aptamer directly or indirectly to one or more parts.
Claims
1. A nucleic acid aptamer that specifically binds to EphA2, preferably human EphA2, said aptamer comprising or consisting of the sequence of formula (I): Nucleotides n1, n2, n6, n7, n9 to n 13 n 16 n 17 n 21 up to n 25 n 28 n 31 n 38 up to n 42 and n 48 up to n 51 Defined as follows: n1 and n2 are independently selected from G or -; n6 is G or -; n7 is either A or -; n9 is either G or -; n 10 It is either A or -; n 11 It is either U or -; n 12 It is G or -; n 13 It is C or -; n 16 It is either U or -; n 17 It is C or -; G, A, U, and C are ribonucleotides; they include both their unmodified and modified forms, and "-" indicates the absence of nucleotides. The premise is: n6 and n 17 Neither the complementary nucleotide nor, alternatively, is present. n7 and n 16 Neither the complementary nucleotide nor, alternatively, is present. When n1 is -, then n 12 Yes; and When n7 is -, then n 11 is U; in: n 21 It is either U or -; n 22 It is C or -; n 23 It is G or -; n 24 It is either U or -; n 25 It is C or -; n 28 It is either U or -; n 31 It is G or -; n 38 It is G or -; n 39 It is either A or -; n 40 It is C or -; n 41 It is G or -; n 42 It is either A or -; The premise is: n 21 and n 42 Neither the complementary nucleotide nor, alternatively, is present. n 22 and n 41 Neither the complementary nucleotide nor, alternatively, is present. n 23 and n 40 Neither the complementary nucleotide nor, alternatively, is present. n 24 and n 39 Neither complementary nucleotides nor, alternatively, are present; and n 25 and n 38 Neither the complementary nucleotide nor, alternatively, is present. in: n 48 It is C or -; n 49 It is C or -; n 50 It is G or -; n 51 It is either A or -; The premise is: n1 and n 49 Neither the complementary nucleotide nor, alternatively, is present. as well as n2 and n 48 Neither complementary nucleotides nor, alternatively, are present; and The aptamers are selected from the sequences identified in Table 2.1 and / or Table 2.2, or variants that have at least 85% identity with any of them.
2. The nucleic acid aptamer according to claim 1, wherein n 25 It is C and n 28 isU,n 11 and / or n 12 It does not exist, and / or the aptamer has a length of 50 or fewer nucleotides.
3. The nucleic acid aptamer according to claim 1 or 2, wherein the aptamer is selected from the sequences identified in Table 2.1 and / or Table 2.2, or variants having at least 90% identity, preferably 95% identity, with any of them.
4. A complex comprising an aptamer as defined in any of the preceding claims and one or more portions, wherein the aptamer is directly or indirectly connected to the one or more portions, preferably the portions being selected from: (i) Antisense oligonucleotides (ASO), siRNA, microRNA, shRNA, or ribozymes; (ii) Selected from polysaccharides, lipids (e.g., cholesterol or other lipid fractions), non-protein polymers (e.g., one or more polyethylene glycol (PEG) chains), polyamines, peptides, proteins, small molecules, and combinations thereof; (iii) A marker for detection purposes; preferably the marker is selected from biotin, enzymes, cofactors, fluorescent materials, luminescent materials, bioluminescent materials, electron-dense markers, markers for magnetic resonance imaging, radioactive materials, and combinations thereof; (iv) Medicines; (vi) Nanoparticles; and (vii) Any combination thereof.
5. A composition comprising the aptamer of any one of claims 1 to 3 or the complex of claim 4, preferably wherein the composition is a pharmaceutical composition comprising a pharmaceutically acceptable excipient and / or carrier.
6. The aptamer of any one of claims 1 to 3, the complex of claim 4, or the composition of claim 5, used alone or as a combination therapy, as a medicine.
7. The aptamer of any one of claims 1 to 3, the complex of claim 4, or the composition of claim 5, used in in vivo detection or quantification methods of target proteins, or in in vivo detection or prognostic methods of diseases.
8. The nucleic acid aptamer of any one of claims 1 to 3, the complex of claim 4, or the composition of claim 5, as a detection agent or quantification agent in in vitro or ex vivo detection or quantification methods of target proteins, or in in vitro or ex vivo detection or prognostic methods of diseases.
9. A kit for detecting or quantifying EphA2, comprising an aptamer according to any one of claims 1 to 3, a complex according to claim 4, or a composition according to claim 5; and optionally, means for detecting said aptamer or complex.
10. The nucleic acid aptamer as defined in any one of claims 1 to 3, or the complex as defined in claim 4, or the composition as defined in claim 5, used for Methods for in vivo detection or quantification of EphA2; or Methods for the in vivo detection or quantification of EphA2 or EphA2-expressing cells for the screening, diagnosis, prognosis, or monitoring of EphA2-related diseases, or Methods for treating cancer or EphA2-related diseases in patients.
11. The use of the nucleic acid aptamer or complex as defined in claim 10 as an EphA2 detection or quantification agent; or as an internalization mediator for cells that target EphA2 expression.
12. The nucleic acid aptamer, complex, or composition as defined in claim 10 as a detection or quantification reagent. Used in in vitro or ex vivo detection or quantification methods for EphA2, or Use in methods for the in vitro or ex vivo detection or quantification of EphA2 for the screening, diagnosis, prognosis, or monitoring of EphA2-related diseases.
13. The nucleic acid aptamer, complex, or composition in the method for treating EphA2-related diseases according to claim 10, or the use according to claim 12, wherein the aptamer, the complex, or the pharmaceutical composition is administered in combination with another drug.
14. A kit comprising the aptamer, complex, or composition as defined in claim 10, and optionally means for detecting said aptamer or complex, for detecting or quantifying EphA2. In methods for the in vitro or ex vivo detection or quantification of EphA2, or Use in methods for the in vitro or ex vivo detection or quantification of EphA2 for the screening, diagnosis, prognosis, or monitoring of EphA2-related diseases.
15. The use of the nucleic acid aptamer, complex, or composition according to claim 10, the use of the nucleic acid aptamer, complex, or composition according to claim 12, or the use of the kit according to claim 14, wherein the EphA2-related disease is a cancer characterized by the expression of EphA2, preferably a sarcoma, such as Ewing sarcoma, Ewing-like sarcoma, rhabdomyosarcoma (e.g., alveolar rhabdomyosarcoma), colorectal cancer, prostate cancer, breast cancer, ovarian cancer, bladder cancer, gastric cancer, mesothelioma, thyroid cancer, kidney cancer, lung cancer, bile duct cancer, uterine cancer, liver cancer, testicular cancer, thymoma, pheochromocytoma and paraganglioma (also known as "PCPG"), esophageal cancer, pancreatic cancer, melanoma, brain cancer, and head and neck cancer.
16. The use of the nucleic acid aptamer, complex, or composition according to claim 15, the use of the nucleic acid aptamer, complex, or composition according to claim 15, or the use of the kit according to claim 15, wherein the cancer expressing EphA2 is metastatic.
17. A method for producing nucleic acid aptamers according to any one of claims 1 to 3, wherein the method comprises: synthesizing aptamers by standard solid-phase synthesis using a phosphoramide method; or synthesizing aptamers by in vitro transcription using a standard or modified reverse transcriptase or as a direct result of an exponential enrichment ligand system evolution (SELEX) process.
18. A method for producing the complex of claim 4, wherein the method comprises: (i) Providing a nucleic acid aptamer according to the first aspect of the present invention; and (ii) Connect the aptamer directly or indirectly to one or more parts.