Composite microbial agent capable of efficiently degrading chlorfenapyr and screening method and application of composite microbial agent

By screening and constructing a composite microbial agent composed of CMJ5, CMJ9, and CMJ10, the problem of low remediation efficiency of chlorfenapyr contaminated soil was solved, achieving efficient and stable degradation of chlorfenapyr with strong adaptability and avoiding secondary pollution.

CN122038162APending Publication Date: 2026-05-15GUANGXI ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610066086.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-19
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

Existing technologies for soil remediation involving chlorfenapyr contaminated soil suffer from low efficiency, long cycles, high costs, and a tendency to generate secondary pollution.

Method used

Multiple bacterial pure cultures with high efficiency in degrading chlorfenapyr were screened out. A composite microbial agent composed of three strains, CMJ5, CMJ9 and CMJ10, in a specific ratio was constructed, and its degradation conditions, including pH, inoculum size and temperature, were optimized.

Benefits of technology

Under optimal conditions, the degradation rate of chlorfenapyr by the compound microbial community reached 97.60%, demonstrating excellent degradation efficiency, good environmental adaptability and great potential for practical application.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122038162A_ABST
    Figure CN122038162A_ABST
Patent Text Reader

Abstract

The invention discloses a compound microbial agent capable of efficiently degrading chlorfenapyr and application of the compound microbial agent, and belongs to the technical field of environmental microorganisms. The compound microbial agent is prepared from three strains of bacteria, namely, Brucella anthropi GXAS CMJ5, Shenotrophomonas maltophilia GXAS CMJ9 and Comamonas terrae GXAS CMJ10, according to a specific ratio, and the compound microbial agent is prepared from three strains of bacteria, namely, Brucella anthropi GXAS CMJ5, Shenotrophomonas maltophilia GXAS CMJ9 and Comamonas terrae GXAS CMJ10. The invention also provides a screening and construction method of the composite flora and an optimal condition for degrading chlorfenapyr. Under the optimal condition, the degradation rate of the composite flora on 150 mg / L chlorfenapyr is as high as 97.60%, and the strains are free from antagonism and high in environmental adaptability. The invention provides efficient, safe and economic special microbial resources and technical schemes for bioremediation of chlorfenapyr polluted soil, water bodies and agricultural products, and has wide application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of environmental microbiology technology, and specifically relates to a highly efficient compound microbial agent for degrading chlorfenapyr, its screening method, and its application. Background Technology

[0002] acaricide ( Chlorfenapyr 4-Bromo-2-(4-chlorophenyl)-1-ethoxymethyl-5-trifluoromethylpyrrole-3-onitrile is a highly effective, broad-spectrum arylpyrrole insecticide and acaricide. Developed by Cyano Corporation in the 1980s, it has been widely used globally for pest and disease control in vegetables, fruit trees, cotton, and other crops. Its mechanism of action is unique: it interferes with the oxidative phosphorylation process in insect mitochondria, blocking ATP synthesis and leading to insect death. Due to its good control effect and long-lasting effect, the annual usage of chlorfenapyr in my country exceeds 3,000 tons, especially in greenhouse agriculture and off-season vegetable production.

[0003] However, chlorfenapyr has a stable chemical structure and is not easily degraded in the environment, easily accumulating in soil. In recent years, with the increase in its use, its residual concentration in continuously cropped soils has exceeded the safety threshold. This not only pollutes the soil environment but can also enter water bodies and the atmosphere through leaching and runoff, ultimately accumulating in crops through the food chain, posing a potential threat to human health. Chlorfenapyr exhibits high ecotoxicity to non-target organisms such as fish, birds, and beneficial insects (such as Trichogramma wasps), and also shows moderate acute toxicity and potential chronic toxicity and carcinogenic risks to mammals. The residue limits for chlorfenapyr in agricultural products vary from country to country. my country's current standard (GB2763-2019) has a more lenient limit for vegetables (10 mg / kg) than the EU standard (0.01 mg / kg), but the problem of residue exceeding the limit still cannot be ignored.

[0004] Currently, pesticide removal in the environment mainly relies on natural degradation (such as photolysis and hydrolysis) and microbial degradation. Studies on the degradation of chlorfenapyr in soil largely focus on adsorption behavior and photolysis processes, while systematic research on its specific microbial degradation pathways remains relatively lacking. Although a few reports mention that chlorfenapyr exhibits a certain degradation rate in the field (e.g., a degradation rate of up to 96.8% in soil 30 days after application), its degradation cycle is long and highly dependent on environmental conditions. While chemical catalytic systems such as zero-valent zinc can efficiently degrade chlorfenapyr, they suffer from high costs, potential secondary pollution, and stringent pH requirements.

[0005] Microbial remediation technology has become a research hotspot for the treatment of pesticide-contaminated soil due to its advantages such as simple operation, low cost, environmental friendliness, and no secondary pollution. Previous studies have successfully screened functional strains capable of degrading pollutants such as organophosphates, pyrethroids, and polycyclic aromatic hydrocarbons, and improved remediation efficiency and stability by constructing composite microbial communities to achieve synergistic degradation effects. However, research on the screening of highly efficient and specific degrading strains, the construction of composite microbial communities, and the systematic optimization of degradation conditions for chlorfenapyr, a specific pollutant, remains lacking. Therefore, developing a highly efficient, stable, and environmentally applicable composite microbial agent for chlorfenapyr degradation is of urgent practical significance and important application value for ensuring agricultural product safety, remediating contaminated soil, and protecting the ecological environment. Summary of the Invention

[0006] In view of the above, this invention provides a highly efficient compound microbial agent for degrading chlorfenapyr and its application, aiming to solve the problems of low efficiency, long cycle, high cost, or easy secondary pollution in the existing technology for soil remediation of chlorfenapyr contaminated soil. This invention screens multiple bacterial pure cultures with highly efficient chlorfenapyr degradation capabilities from farmland soil long-term contaminated with chlorfenapyr through concentration gradient acclimation, enrichment culture, and plate isolation technology, and selects four strains with significant degradation effects: CMJ5 (… Brucella anthropi ), CMJ7 ( Ensifer adhaerens ), CMJ9 ( Stenotrophomonas maltophilia ) and CMJ10 ( Comamonas terrae Further, through inter-strain antagonism experiments and degradation performance comparisons, a composite microbial agent (named N10) composed of three strains, CMJ5, CMJ9, and CMJ10, in a specific ratio was constructed, and the optimal environmental conditions (pH, inoculum size, and temperature) for its degradation of chlorfenapyr were systematically optimized. Under optimal conditions, this composite microbial community achieved a degradation rate of up to 97.60% for 150 mg / L chlorfenapyr, demonstrating excellent degradation efficiency, good environmental adaptability, and great potential for practical application.

[0007] This invention provides a compound microbial agent for degrading chlorfenapyr, the compound microbial agent being composed of the following three strains: *Ailuropoda spp.* (human *Ailuropoda spp.*) Brucella anthropi ) strain GXAS CMJ5, Stenotrophomonas maltophilia ( Stenotrophomonas maltophilia strain GXAS CMJ9 and *Trichoderma solani* ( Comamonas terrae ) strain GXAS CMJ10; The human anthrax bacillus strain GXAS CMJ5 is classified and named as follows: Brucella anthropiGXASCMJ5, Chinese classification name: Human paleobacterium GXAS CMJ5, accession number GDMCC NO: 67485; this strain is deposited at Guangdong Provincial Microbial Culture Collection Center, address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, on December 16, 2025. The Stenotrophomonas maltophilia strain GXAS CMJ9 is classified as follows: Stenotrophomonas maltophilia GXAS CMJ9, Chinese classification name: Stenotrophomonas maltophilia GXAS CMJ9, accession number GDMCC NO: 67486; this strain is deposited at Guangdong Provincial Microbial Culture Collection Center, address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, on December 16, 2025. The *Trichoderma solani* strain GXAS CMJ10 is classified as follows: Comamonas terrae GXASCMJ10, classified in Chinese as *Gastromycosis pilosa* GXAS CMJ10, with accession number GDMCC NO: 67487, is deposited at the Guangdong Provincial Center for Microbial Culture Collection, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, on December 16, 2025.

[0008] To further clarify, the ratio of live bacteria counts of the three strains is 1:1:1.

[0009] The present invention also provides a method for preparing the above-mentioned composite microbial agent, comprising the following steps: a) Culture human paleobacterium strain GXAS CMJ5, Stenotrophomonas maltophilia strain GXAS CMJ9 and Trichophyton spp. strain GXAS CMJ10 to the late logarithmic growth stage, respectively. b) Collect the bacterial cells of each strain, resuspend them in sterile physiological saline or buffer, and adjust the concentration of each bacterial suspension to OD0.05. 600 The value is 0.8-1.2; c) Mix the bacterial suspensions of the three strains obtained in step b) in the proportions described in claim 2 to obtain the composite microbial agent.

[0010] The present invention also provides the application of the above-described composite microbial agent or the composite microbial agent prepared by the above-described method in the degradation of acaricides.

[0011] To further clarify, the application is for remediating soil and water bodies contaminated with chlorfenapyr or treating agricultural products containing chlorfenapyr.

[0012] To further explain, the degradation conditions are: pH value of 6.0-9.0, temperature of 25-30℃, and the inoculation amount of the composite microbial agent is 1%-7% of the liquid volume in the substrate to be treated.

[0013] Preferably, the degradation conditions are a pH of 7.0, a temperature of 28°C, and an inoculum amount of the composite microbial agent of 1% of the liquid volume in the substrate to be treated.

[0014] The present invention also provides a chlorfenapyr degrading agent comprising the above-described composite microbial agent.

[0015] To further clarify, the acaricide-degrading agent is in the form of a liquid inoculant, a solid inoculant, or a wettable powder.

[0016] The present invention has the following beneficial effects: 1. The single bacterial strains CMJ5, CMJ7, CMJ9, and CMJ10 obtained by screening in this invention all achieved a degradation rate of over 89.54% for 100 mg / L chlorfenapyr, with the highest reaching 95.17%. The further constructed composite bacterial group N10 (CMJ5+CMJ9+CMJ10) under optimal conditions (pH=7.0, inoculum amount 1%, temperature 28℃) achieved a degradation rate of up to 97.60% for 150 mg / L chlorfenapyr, an improvement of approximately 6.40% compared to the unoptimized group, demonstrating excellent synergistic degradation ability.

[0017] 2. The N10 complex microbial community maintains a degradation rate of over 90% within a wide pH range of 6.0-9.0, with optimal performance under neutral conditions. It also exhibits good temperature adaptability, demonstrating excellent degradation performance within the 25-30℃ range, peaking at 28℃. This broad adaptability enables it to cope with the complex and variable environmental conditions of actual contaminated sites.

[0018] 3. Experiments have confirmed that the three strains of bacteria (CMJ5, CMJ9, and CMJ10) that constitute the complex microbial community N10 do not have any antagonistic effects on each other, can coexist stably and play a synergistic metabolic role, thus ensuring the stability of the microbial community structure and the durability of its function.

[0019] 4. The strains used are derived from the natural environment, and the degradation process is a biotransformation that does not introduce harmful chemicals, thus avoiding secondary pollution. This method is simple to operate and has low cultivation costs, laying a solid foundation for the development of low-cost chlorfenapyr-degrading bacterial agents.

[0020] 5. The invention relates to... Brucella anthropi GXAS CMJ5 Stenotrophomonas maltophilia GXAS CMJ9 and Comamonas terraeGXAS CMJ10 has been deposited as biological material with accession numbers GDMCC NO: 67485, GDMCC NO: 67486 and GDMCC NO: 67487, providing a reliable and reusable dedicated microbial resource for the bioremediation of chlorfenapyr contamination.

[0021] 6. This composite microbial community can be directly used to prepare bioremediation agents for soil, water, or agricultural products contaminated with chlorfenapyr. It can also be embedded as a core functional unit in various environmental remediation products, providing an effective technical solution for the green treatment of pesticide residues. Attached Figure Description

[0022] Figure 1 This is a technical roadmap for the research of this invention.

[0023] Figure 2 The relationship between chlorfenapyr concentration and OD 260 The standard curve of the value.

[0024] Figure 3 The bar chart shows the degradation rate of 100 mg / L chlorfenapyr by 12 single strains.

[0025] Figure 4 The colony morphology of four highly efficient degrading bacteria (CMJ5, CMJ7, CMJ9, CMJ10) on LB plates is shown.

[0026] Figure 5 The growth curves of four highly efficient degrading bacteria in LB medium are shown.

[0027] Figure 6 Photographs of the antagonistic experiment between pairs of four highly efficient degrading bacteria, showing no inhibition zone.

[0028] Figure 7 The bar chart shows the degradation rate of 150 mg / L chlorfenapyr by 11 different combinations of microbial communities, indicating that the N10 combination is the best.

[0029] Figure 8 The effect of different pH values ​​on the degradation efficiency of 150 mg / L chlorfenapyr by the N10 complex microbial community.

[0030] Figure 9 The effect of different inoculum amounts on the degradation efficiency of 150 mg / L chlorfenapyr by the N10 microbial complex.

[0031] Figure 10 The effect of different temperatures on the degradation efficiency of 150 mg / L chlorfenapyr by the N10 microbial community. Information on the preservation of biological materials

[0032] The strain information deposited in this application is as follows: human pallidumBrucella anthropi The strain GXAS CMJ5 is classified as follows: Brucella anthropi GXAS CMJ5, Chinese classification name: Human paleobacterium GXAS CMJ5, accession number GDMCC NO:67485; this strain is deposited at Guangdong Provincial Microbial Culture Collection Center, address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, on December 16, 2025.

[0033] Stenotrophomonas maltophilia Stenotrophomonas maltophilia The strain GXAS CMJ9 is classified as follows: Stenotrophomonas maltophilia GXAS CMJ9, Chinese classification name: Stenotrophomonas maltophilia GXAS CMJ9, accession number GDMCC NO: 67486; this strain is deposited at Guangdong Provincial Microbial Culture Collection Center, address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, on December 16, 2025.

[0034] *Trichophyton spp.* Comamonas terrae The strain GXAS CMJ10 is classified as follows: Comamonas terrae GXAS CMJ10, Chinese classification name: *G. CMJ10*, accession number GDMCC NO:67487; this strain is deposited at Guangdong Provincial Center for Microbial Culture Collection, address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, on December 16, 2025. Detailed Implementation

[0035] All features disclosed in this specification, or all steps in all disclosed methods or processes, may be combined in any way, except for mutually exclusive features and / or steps.

[0036] Unless otherwise stated, each feature disclosed in this specification (including any appended claims and abstract) is merely one example of a series of equivalent or similar features.

[0037] Test culture medium (1) Enrichment medium: Tryptone 10.0 g / L, glucose 1.0 g / L, NaCl 1.0 g / L, KH2PO4 1.0 g / L, pH 7.0. (115℃, sterilize for 20 min).

[0038] (2) Inorganic salt culture medium: MgSO4·7H2O 0.2 g / L (sterilized separately), NH4Cl 1.0 g / L, NaCl 1.0 g / L, KH2PO4 1.5 g / L, K2HPO4 4.8 g / L, Ca(NO3)2 0.2 g / L, KNO3 1.8 g / L, FeSO4 0.001 g / L, pH 7.0-7.2. (Solid culture medium: liquid culture medium + agar (2% by volume); sterilized at 121℃ for 20 min).

[0039] (3) LB medium: NaCl 10.0 g / L, yeast extract 5.0 g / L, tryptone 10.0 g / L, pH 7.0. (121℃, sterilize for 20 min). Example 1

[0040] This example demonstrates the isolation, screening, and identification of chlorfenapyr-degrading bacteria. 1. Sample collection and enrichment: 20 g of soil sample was collected from a vegetable planting base in Binyang County that had been using chlorfenapyr for a long time. 200 mL of sterile deionized water was added, stirred evenly, and then allowed to stand.

[0041] When the turbidity of the aqueous phase after solid-liquid separation is low, the supernatant of the bacterial suspension is inoculated at a 10:100 (v / v) ratio into an enrichment medium containing 50 mg / L chlorfenapyr (10.0 g / L peptone, 1.0 g / L glucose, 1.0 g / L NaCl, 1.0 g / L KH2PO4, pH 7.0) for selective amplification culture (30℃, 220 r / min) for 5 days. After 5 days, the culture is transferred to an enrichment medium containing 100 mg / L chlorfenapyr at a 10:100 (v / v) ratio and cultured for another 5 days. Subculture is performed according to this procedure. Concentration gradient acclimation is used, with the chlorfenapyr concentration increasing exponentially with each subculture until a 2 g / L chlorfenapyr-resistant bacterial population is obtained.

[0042] 2. Isolation and Purification: The acclimatized bacterial culture was transferred to an inorganic salt liquid medium containing 2 g / L chlorfenapyr and cultured for 72 hours. The culture was then serially diluted 10-fold, and 10 samples were selected... -5 10 -6 10 -7 Three dilutions were plated on inorganic salt solid medium plates containing 2 g / L chlorfenapyr and incubated upside down at 30°C. Single colonies with different morphologies were picked from the plates and repeatedly streaked for purification, eventually yielding 12 pure cultures, named CMJ1 to CMJ12.

[0043] 3. Initial screening of degradation ability: (1) Detection of the maximum absorption wavelength of chlorfenapyr: A U-5100 spectrophotometer was used to perform a full-band spectral scan (240-300 nm) on a 100 mg / L chlorfenapyr standard solution prepared in methanol to determine the position of the characteristic absorption peak of chlorfenapyr. Spectral analysis showed that chlorfenapyr exhibited a characteristic absorption peak in the wavelength range of 255-261 nm, with the absorbance value reaching its maximum at 260 nm. Therefore, 260 nm was selected as the detection wavelength for determining the content of chlorfenapyr by ultraviolet spectrophotometry.

[0044] (2) Preparation of the standard curve for chlorfenapyr: A 1 g / mL chlorfenapyr standard (solution) was serially diluted with chromatographically pure methanol to prepare concentration gradient standard solutions of 0.1 mg / L, 0.25 mg / L, 0.5 mg / L, 1 mg / L, 10 mg / L, 25 mg / L, 50 mg / L, 75 mg / L, and 100 mg / L. The absorbance of each concentration standard solution was measured spectrophotometrically at a characteristic wavelength of 260 nm. A standard curve was constructed with the standard solution concentration as the x-axis and the corresponding UV absorbance at 260 nm as the y-axis. Key parameters such as the correlation coefficient (R²), slope (k), and intercept (b) of the curve were calculated using linear regression analysis. Figure 2 As shown, within a concentration gradient of 0.1-100 mg / L, the content of chlorfenapyr and OD... 260 The values ​​maintain a good linear response, meeting the basic requirements of quantitative analysis. The standard curve is: y = 0.02714x + 0.01832, and the correlation coefficient R0 is [value missing]. 2 =0.9996, with a minimum detection limit of 0.1 mg / L.

[0045] (3) Each purified strain was inoculated into LB liquid medium and cultured under controlled conditions (pH=7.0, 30℃, 220 r / min) to obtain OD. 600 =1.0 was used as the bacterial harvesting standard to provide homogenized bacterial material for subsequent comparative degradation capacity experiments. A 5% inoculum (a certain amount of culture medium was centrifuged (4℃, 12000 r / min) for 10 min, and washed three times with inorganic salt culture medium to remove LB medium components) was inoculated into 100 mg / L chlorfenapyr inorganic salt liquid medium. Three replicate treatment groups were set up, with uninoculated chlorfenapyr inorganic salt medium serving as a blank control. All treatment groups were cultured at 30℃ with shaking at 200 r / min for 7 days. Chlorfenapyr residual concentration was measured daily, and the degradation efficiency of each strain was evaluated through comparative analysis.

[0046] Degradation rate of acaricides: , Parameter definitions: Z0: Chlorfenapyr content in the blank control group; Z: Chlorfenapyr residue after strain treatment. Concentration calculation method: OD 260 The measured values ​​are substituted into the standard curve equation to obtain the solution.

[0047] The residue levels of chlorfenapyr were determined daily using ultraviolet spectrophotometry (detection wavelength 260 nm). Results are shown in Table 1 and... Figure 3 As shown, the four strains CMJ5, CMJ7, CMJ9, and CMJ10 exhibited significant degradation effects, with degradation rates of 90.48%, 95.17%, 89.54%, and 91.88% respectively after 7 days.

[0048] Table 1. Degradation rate of chlorfenapyr by each bacterium

[0049] The four highly efficient chlorfenapyr-degrading strains obtained through screening showed significant morphological differences, such as... Figure 4 And Table 2.

[0050] Table 2. Description of colony morphology of the four bacterial strains

[0051] 4. Strain identification: (1) Amplification of the target gene Using total DNA from CMJ5, CMJ7, CMJ9, and CMJ10 as templates, the bacterial 16S rRNA gene was amplified using the universal bacterial primers 27F and 1522R (amplification program and amplification system are shown in Tables 3 and 4). The primer sequences for 27F and 1522R are as follows: Forward primer: 27F, AGAGTTTGATCCTGGCTCAG Reverse primer: 1522R, CGGCTACCTTGTTACGACTT (2) Determine the size of the target band fragment and the gene sequence. PCR amplification products were separated by 1% agarose gel electrophoresis (TAE buffer, 120 V, 30 min). After staining with nucleic acid dyes, the electrophoretic bands were observed under UV transilluminator. The molecular weight of the target fragment was determined using the DL 2000 Plus II DNA Marker. The target band size was between 1.4 and 1.5 kb. The amplification products were sequenced by Shanghai Jieli Biotechnology Co., Ltd. The obtained sequences were submitted to the Ezbiocloud database for comparison with identified 16S rRNA sequences. The bacterial species classification was determined based on the highest similarity match. The results showed that CMJ5 and... Brucella anthropiThe strainESC1 showed 99.57% similarity; CMJ7 and Ensifer adhaerens strain Casida A The similarity reached 99.28%; CMJ9 and Stenotrophomonas maltophilia The strain MTCC 434 showed 99.57% similarity; CMJ10 and Comamonas terrae The four strains showed 99.30% similarity to strain NBRC 106524. Based on this, they were identified as... Brucella anthropi , Ensifer adhaerens , Stenotrophomonas maltophilia and Comamonas terrae .in, Brucella anthropi GXAS CMJ5 [[ID=4 GXASCMJ9 and ​ GXAS CMJ10 has been deposited at the Guangdong Provincial Center for Microbial Culture Collection, with accession numbers GDMCC NO:67485, GDMCC NO:67486 and GDMCC NO:67487.

[0052] Table 3 PCR amplification program

[0053] Table 4 PCR amplification system Example 2

[0054] This example demonstrates the construction and screening of a complex microbial community.

[0055] 1. Growth curve of the strain: Single colonies of the purified chlorfenapyr-degrading bacteria were picked with a sterile toothpick and inoculated into 50 mL of LB liquid medium. The culture was carried out at a constant temperature of 30℃ with shaking at 220 r / min (three replicates were set up). LB medium was used as a blank control. The absorbance (OD) of the culture medium at 600 nm was measured every 12 h using a spectrophotometer. 600 ), dynamically monitor bacterial growth status. Set the culture time (h) as the x-axis, and the corresponding OD... 600 The measured values ​​are plotted on the ordinate (Y-axis) to create a growth kinetic curve for the strain. For example... ​ As shown, the growth dynamics monitoring results of the four strains in LB medium showed that CMJ5, CMJ9, and CMJ10 reached the stationary phase at 40 h, with the former having the highest OD... 600 Approximately 1.6, the latter two OD 600 Approximately 1.9. The stabilization period of CMJ7 is relatively late, around 50 hours, with an OD of... 600The ratio was approximately 1.5; CMJ9 and CMJ10 showed strong growth ability in LB medium, while CMJ5 and CMJ7 showed weaker growth ability in comparison.

[0056] 2. Antagonism Test of Strains: Four strains of bacteria, CMJ5, CMJ7, CMJ9, and CMJ10, were paired and inoculated on LB agar plates using the streak method. The plates were incubated at 30°C for 3-5 days. Observation results showed (e.g.) ​ As shown in the figure, no inhibition zones or growth inhibition zones were formed at the boundaries of the colonies of all combinations, indicating that there is no mutual antagonism between the four strains and that they have the basis for constructing a complex microbial community.

[0057] 3. Comparison of the construction and degradation performance of the composite microbial community: Four dominant bacteria were prepared by dividing the bacterial suspensions into equal volumes (OD). 600 Eleven different combinations were designed by mixing (e.g., 1.0 mg / L chlorfenapyr) (as shown in Table 5). Each combination was inoculated at 5% of the total inoculum into an inorganic salt liquid medium (pH=7.0) containing 150 mg / L chlorfenapyr, and cultured at 30℃ and 200 r / min for 7 days with shaking. The degradation rate of chlorfenapyr was then determined.

[0058] Table 5. Combination methods of complex microbial communities

[0059] Results Analysis: Degradation experiment results (e.g.) ​ As shown in the figure, the degradation efficiency of different bacterial complexes varies. The N9, N10, and N11 complexes exhibited high degradation efficiency. All three complexes contain CMJ9, and considering the growth curve characteristics, CMJ9 demonstrates a growth advantage (a shorter logarithmic growth phase followed by the longest sustained stationary phase). The rapidly growing CMJ9 may provide key metabolic functions for the bacterial complexes or promote synergy among them. Among these, the N10 complex (CMJ5+CMJ9+CMJ10) achieved the highest degradation rate of 91.73%, significantly better than most two-bacterial complexes and the four-bacterial complex (N11), and was thus identified as the optimal complex, named complex N10. Example 3

[0060] This embodiment optimizes the conditions for the degradation of acaricides by the N10 microbial community.

[0061] 1. Determination of optimal pH: Liquid culture media containing 150 mg / L chlorfenapyr were prepared with pH values ​​of 6.0, 7.0, 8.0, and 9.0, respectively. The N10 compound bacterial consortium was inoculated into each of these media at a 5% inoculation rate and cultured at 30℃ with shaking at 220 r / min for 7 days. The degradation rate was then measured. Results (e.g.) ​As shown in the figure, the degradation rate was highest at pH 7.0 (94.28%), and remained above 91.44% in the pH range of 6.0-9.0, indicating that the bacterial community has a wide pH adaptability range and is most suitable under neutral conditions.

[0062] 2. Determination of optimal inoculum size: Under pH 7.0 conditions, inoculum size gradients of 1%, 3%, 5%, and 7% were established, and inoculated into inorganic salt liquid medium containing 150 mg / L chlorfenapyr, and cultured at 30℃ and 220 r / min for 7 days. Results (e.g.) ​ As shown in the figure, the degradation rate was highest (97.45%) at an inoculum size of 1%, and the degradation rate was higher than 94% at all inoculum sizes. Therefore, 1% is the preferred inoculum size for economic efficiency.

[0063] 3. Determination of optimal temperature: Under conditions of pH=7.0 and inoculum size of 1%, the culture temperature gradient was set at 25℃, 28℃, 30℃, and 33℃, and the culture was carried out with shaking in an inorganic salt liquid medium containing 150 mg / L chlorfenapyr for 7 days. Results (e.g.) ​ As shown in the figure, the degradation rate was highest at 28℃, reaching 97.61%; the degradation rates were also relatively high at 25℃ and 30℃, at 95.89% and 93.61%, respectively; however, when the temperature rose to 33℃, the degradation rate dropped sharply to 17.72%. Therefore, 28℃ was determined to be the optimal temperature for the degradation of chlorfenapyr by the N10 complex microbial community. Example 4

[0064] This embodiment verifies the degradation efficiency of the composite microbial community N10 under optimal conditions.

[0065] Under optimized conditions (pH=7.0, inoculum size 1%, temperature 28℃), the compound microbial community N10 was inoculated into an inorganic salt liquid medium with an initial concentration of 150 mg / L chlorfenapyr, and cultured with shaking at 220 r / min for 7 days. Samples were taken daily, and the residual concentration of chlorfenapyr was determined by ultraviolet spectrophotometry. The experimental results showed that after 7 days of culture, the degradation rate of chlorfenapyr reached 97.60%, fully verifying that the compound microbial community N10 has extremely high degradation efficiency and application potential under optimal conditions.

[0066] In summary, this invention, through systematic screening, obtained four highly efficient chlorfenapyr-degrading bacteria from contaminated soil and successfully constructed a non-antagonistic, synergistically effective complex bacterial community N10 (composed of...). ​ CMJ5 ​ CMJ9 and ​(CMJ10 composition). Through single-factor experiments, the optimal conditions for the degradation of chlorfenapyr by this composite microbial community were determined to be pH 7.0, inoculum size 1%, and temperature 28℃. Under these optimal conditions, the composite microbial community N10 achieved a degradation rate of 97.60% for 150 mg / L chlorfenapyr. Its high efficiency, environmental adaptability, and strain synergy were fully verified, providing core microbial resources and key technical parameters for the development of composite microbial agents for the remediation of chlorfenapyr-contaminated environments.

[0067] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the appended claims.

Claims

1. A compound microbial agent for degrading chlorfenapyr, characterized in that, The compound microbial agent consists of the following three strains: *Ailuropoda cirrhosa* (… Brucella anthropi ) strain GXAS CMJ5, Stenotrophomonas maltophilia ( Stenotrophomonas maltophilia strain GXAS CMJ9 and *Trichoderma solani* ( Comamonas terrae ) strain GXAS CMJ10; The human anthrax bacillus strain GXAS CMJ5 is classified and named as follows: Brucella anthropi GXASCMJ5, Chinese classification name: Human paleobacterium GXAS CMJ5, accession number GDMCC NO: 67485; this strain is deposited at Guangdong Provincial Microbial Culture Collection Center, address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, on December 16, 2025. The Stenotrophomonas maltophilia strain GXAS CMJ9 is classified as follows: Stenotrophomonas maltophilia GXAS CMJ9, Chinese classification name: Stenotrophomonas maltophilia GXAS CMJ9, accession number GDMCC NO: 67486; this strain is deposited at Guangdong Provincial Microbial Culture Collection Center, address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, on December 16, 2025. The *Trichoderma solani* strain GXAS CMJ10 is classified as follows: Comamonas terrae GXAS CMJ10, Chinese classification name: *G. CMJ10*, accession number GDMCC NO: 67487; this strain is deposited at Guangdong Provincial Center for Microbial Culture Collection, address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, on December 16, 2025.

2. The compound microbial agent according to claim 1, characterized in that, The ratio of live bacteria count of the three strains is 1:1:

1.

3. A method for preparing the composite microbial agent according to claim 1 or 2, characterized in that, Includes the following steps: a) Culture human paleobacterium strain GXAS CMJ5, Stenotrophomonas maltophilia strain GXAS CMJ9 and Trichophyton spp. strain GXAS CMJ10 to the late logarithmic growth stage, respectively. b) Collect the bacterial cells of each strain, resuspend them in sterile physiological saline or buffer, and adjust the concentration of each bacterial suspension to OD0.

05. 600 The value is 0.8-1.2; c) Mix the bacterial suspensions of the three strains obtained in step b) in the proportions described in claim 2 to obtain the composite microbial agent.

4. The application of the composite microbial agent according to claim 1 or 2 or the composite microbial agent prepared by the method according to claim 3 in the degradation of acaricides.

5. The application according to claim 4, characterized in that, The application is for remediating soil and water contaminated with chlorfenapyr or treating agricultural products containing chlorfenapyr.

6. The application according to claim 4 or 5, characterized in that, The degradation conditions are: pH value of 6.0-9.0, temperature of 25-30℃, and the inoculation amount of the composite microbial agent is 1%-7% of the liquid volume in the substrate to be treated.

7. The application according to claim 6, characterized in that, The degradation conditions are: pH 7.0; temperature 28°C; and the inoculum amount of the composite microbial agent is 1% of the liquid volume in the substrate to be treated.

8. A chlorfenapyr degrading agent, characterized in that, It contains the composite microbial agent as described in claim 1 or 2.

9. The acaricide degrading agent according to claim 8, characterized in that, Its formulations include liquid inoculants, solid inoculants, or wettable powders.