Application of rice OsMYB87 gene in regulation and control of grain length and grain weight and related mutants

By knocking out the OsMYB87 gene in rice using the CRISPR/Cas9 system, the problem of decreased quality due to increased grain yield in existing technologies has been solved. This method achieves a significant increase in grain length and weight without affecting the appearance quality of rice, providing efficient breeding materials and methods.

CN122038461APending Publication Date: 2026-05-15FOSHAN UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610378632.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-26
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

Existing technologies struggle to improve rice grain length and weight while avoiding negative impacts on rice appearance quality. In particular, loss-of-function mutants of the OsMYB73 gene are often accompanied by a significant increase in endosperm chalkiness, leading to a decline in quality.

Method used

By using gene editing technology, especially the CRISPR/Cas9 system, the rice OsMYB87 gene is knocked out, a loss-of-function mutation is introduced, and the OsMYB87 gene is used as a negative regulator to reduce its expression or function. This is combined with molecular marker-assisted breeding and small molecule inhibitors to regulate grain filling.

Benefits of technology

It significantly increases grain length and weight while maintaining rice appearance quality and avoids significant exacerbation of endosperm chalkiness, providing new breeding targets and materials for the creation of high-yield and high-quality rice varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122038461A_ABST
    Figure CN122038461A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of plant genetic engineering and molecular breeding, and particularly relates to a new function and application of a transcription factor gene OsMYB87 derived from rice, an OsMYB87 function deletion mutant created through a gene editing technology and application of the OsMYB87 function deletion mutant in increasing the rice grain length and grain weight. The OsMYB87 gene found in the invention shows a key differentiated characteristic: preliminary phenotypic observation shows that the phenomenon that chalkiness of endosperm is remarkably aggravated inevitably due to OsMYB73 knockout is not observed while the function deficiency of the OsMYB87 gene brings a remarkable yield increasing effect (grain length and grain weight increase). The OsMYB87 is strongly prompted to be possibly located on a different regulatory pathway, and as a breeding target, the OsMYB87 provides greater possibility and a better potential choice for maintaining the appearance quality of rice commodities while realizing yield increase, so that the OsMYB87 has higher application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering and molecular breeding technology, specifically involving a new function and application of the transcription factor gene OsMYB87 derived from rice, as well as the OsMYB87 loss-of-function mutant created through gene editing technology and its application in improving rice grain length and grain weight. Background Technology

[0002] Rice (Oryza sativa L.) is the staple food of more than half the world's population, and improving its yield and quality has always been the core goal of rice breeding research. Rice yield is directly determined by grain traits, including grain length, grain width, and grain weight; while the appearance quality of rice, especially the amount of chalky endosperm (including white heart and white abdomen), is a key indicator affecting its commercial value and market acceptance. An ideal rice variety should possess both high yield and high quality.

[0003] However, long-term breeding practice and theoretical research have revealed a frequent negative correlation between yield and quality traits, a contradiction known as "high yield without quality, and high quality without high yield." The essence of this contradiction lies in the fact that the genetic networks controlling grain filling, starch synthesis, and accumulation often simultaneously affect both grain size and endosperm density. Therefore, identifying key genes capable of breaking or optimizing this "trait trade-off" to achieve synergistic improvement in yield and quality is a crucial technical challenge that urgently needs to be addressed in the field of rice molecular breeding.

[0004] Among the numerous transcription factor families regulating grain development, members of the R2R3-MYB family have been shown to play a central role. They are widely involved in plant secondary metabolism, cell morphogenesis, and responses to the environment. In recent years, with the development of functional genomics, the functions of some rice MYB genes in grain trait regulation have been gradually revealed, providing potential targets for breeding. The following analysis focuses on the prior art solutions most similar to this invention: Regulatory Function of OsMYB73 Gene: Existing research has clearly reported that the rice MYB transcription factor OsMYB73 is a key factor regulating grain size and chalkiness. Knocking out OsMYB73 using gene editing technology can yield new rice materials with significantly increased grain length. However, this technique has limitations. While OsMYB73 loss-of-function mutants produce larger grains, they often exhibit a negative phenotype with a significant increase in endosperm chalkiness (especially ventral white), leading to a severe decline in rice appearance quality. This indicates that OsMYB73 is a typical "trait-coupled" regulatory factor, whose pathway simultaneously affects yield potential and quality performance. When using it for breeding improvement, a trade-off must be made between increased yield and quality.

[0005] Regulatory Function of OsMYB99 Gene: Recent studies have also revealed the role of OsMYB99 in rice quality formation. Unlike OsMYB73, OsMYB99 has been shown to be a positive regulator of rice quality. Enhancing its expression significantly improves head rice yield and reduces chalkiness. This finding further illustrates the complexity of the MYB family members in the quality regulation network, but also demonstrates that the strategy of improving quality by promoting the expression of specific MYB genes is fundamentally different in application from the strategy of obtaining a yield-increasing phenotype by gene knockout.

[0006] Regulatory function of the OsMYB110 (also known as MYB9) gene: Studies have shown that OsMYB110 is another member of the MYB family that negatively regulates rice yield. Its loss of function can significantly increase rice grain yield, directly demonstrating the feasibility of mining gene resources that negatively regulate yield within the MYB transcription factor family.

[0007] Currently reported MYB genes that can increase grain size (such as OsMYB73) inevitably lead to deterioration in appearance quality, such as increased chalkiness, when used to improve yield traits. This inherent defect of "increasing yield inevitably leads to decreased quality" severely limits their direct application value in breeding high-yield and high-quality rice varieties.

[0008] For many other members of the MYB family, such as OsMYB87 (LOC_Os07g31470), their biological functions are completely unknown. Existing technologies only focus on sequence annotation or co-expression prediction based on large datasets. Prior to this invention, there were no clear functional reports or experimental evidence regarding whether it participates in grain development regulation, and whether its regulatory effect is similar to OsMYB73 (increasing yield but reducing quality) or has superior regulatory characteristics.

[0009] To address the shortcomings of the existing technology, namely: (1) the function of the OsMYB87 gene is completely unknown and its breeding potential has not been explored; (2) existing MYB gene targets that can be used to increase yield (such as OsMYB73) have the limitation of "increasing yield but losing quality" in trait coupling, which makes it difficult to meet the needs of high-yield and high-quality synergistic breeding; (3) there is a lack of new genetic targets that can significantly increase grain length and grain weight while having less negative impact on the appearance quality of rice or may have decoupling regulatory characteristics. Summary of the Invention

[0010] In view of this, it is necessary to provide a new function and application of the rice transcription factor gene OsMYB87 to address the shortcomings of existing technologies, as well as the application of OsMYB87 loss-of-function mutants created through gene editing technology in improving rice grain length and weight, so as to significantly increase rice grain length and weight while minimizing or avoiding adverse effects on rice appearance quality.

[0011] To solve the above problems, this application adopts the following technical solution: This invention relates to a transcription factor gene OsMYB87 (LOC_Os07g31470) derived from rice, the nucleotide sequence of which is shown in SEQ ID NO:1 and the coding region (CDS) sequence of which is shown in SEQ ID NO:2.

[0012] This invention includes the following: In a first aspect, the present invention provides a method for increasing the length and / or weight of rice grains, characterized by reducing or eliminating the expression or function of the OsMYB87 gene in rice.

[0013] Furthermore, the reduction or elimination of the expression or function of the OsMYB87 gene is achieved through gene editing, gene silencing, chemical mutagenesis, or physical mutagenesis techniques.

[0014] Furthermore, the gene editing technology is selected from at least one of the following groups: CRISPR / Cas9 system, TALEN, ZFN; the gene silencing technology is selected from at least one of the following groups: RNA interference, antisense RNA; the chemical mutagenesis includes EMS mutagenesis; and the physical mutagenesis includes radiation mutagenesis.

[0015] In a preferred embodiment, the gene editing is performed using a CRISPR / Cas9 system, the target sequence of which is sgRNA as shown in SEQ ID NO:3.

[0016] In a second aspect, the present invention provides a method for breeding rice with traits of increased grain length and / or grain weight, characterized in that it includes: detecting molecular markers developed based on the OsMYB87 gene sequence in rice germplasm resources or segregating populations, and selecting rice plants carrying said molecular markers.

[0017] Furthermore, the molecular markers were developed based on nucleotide variations in the OsMYB87 gene that lead to its loss of function.

[0018] Thirdly, this invention provides the application of the OsMYB87 gene as a target in the breeding of rice varieties with traits that increase grain length and / or grain weight.

[0019] Fourthly, this invention provides the application of OsMYB87 protein as a target in screening candidate compounds that regulate rice grain traits.

[0020] Furthermore, the candidate compound is a small molecule inhibitor used to regulate rice grain filling.

[0021] Fifthly, the present invention provides a rice plant or its seeds that are loss-of-function mutants of the OsMYB87 gene, characterized in that, compared with wild-type rice plants, the grain length and / or grain weight of the mutant rice plant are increased.

[0022] Furthermore, the chalkiness of the rice grains from the mutant rice plants was not significantly different from that of the wild-type control.

[0023] Furthermore, in the genome of the mutant rice plant, the coding region of the OsMYB87 gene contains mutations that cause loss of function.

[0024] In a preferred embodiment, the mutation occurs within a conserved domain of the OsMYB87 gene.

[0025] In another preferred embodiment, the mutation includes a deletion or insertion in the nucleotide region from position 32 to 36 of the nucleotide sequence shown in SEQ ID NO:1.

[0026] In another preferred embodiment, the mutation includes a deletion or insertion in the nucleotide sequence shown in SEQ ID NO:3.

[0027] Sixthly, the present invention provides a method for creating rice plants with increased grain length and / or grain weight traits, characterized by comprising the following steps: a) Editing or modifying the OsMYB87 gene in rice cells to introduce loss-of-function mutations; b) Regenerate rice plants from the cells obtained in step a); and c) Select plants with grain length and / or grain weight higher than the wild-type control.

[0028] Furthermore, in step a), the loss-of-function mutation is introduced using gene editing technology, gene silencing technology, chemical mutagenesis, or physical mutagenesis.

[0029] Furthermore, the gene editing technology is selected from at least one of the following groups: CRISPR / Cas9 system, TALEN, ZFN; the gene silencing technology is selected from at least one of the following groups: RNA interference, antisense RNA; the chemical mutagenesis includes EMS mutagenesis; and the physical mutagenesis includes radiation mutagenesis.

[0030] In a preferred embodiment, the gene editing is performed using a CRISPR / Cas9 system to edit the OsMYB87 gene, the system containing the sgRNA target sequence shown in SEQ ID NO:3.

[0031] Furthermore, the rice cells described in step a) are derived from japonica rice, indica rice, or their hybrid offspring.

[0032] Furthermore, in step a), the editing or modification tool is introduced into rice cells using Agrobacterium-mediated transformation, gene gun method, or pollen tube pathway method.

[0033] In a seventh aspect, the present invention provides a molecular marker for identifying or breeding rice with traits of increased grain length and / or grain weight, characterized in that the molecular marker is developed based on nucleotide variations in the OsMYB87 gene sequence.

[0034] Furthermore, the nucleotide variation is a mutation that results in the loss of function of the OsMYB87 gene.

[0035] Eighthly, the present invention provides the application of the above-mentioned molecular markers in at least one of the following: a) Rice variety purity identification; b) Selection and mating of rice parents; c) Early generation screening of rice.

[0036] The present application adopts the above technical solution, and its beneficial effects are as follows: Compared with the prior art, the present invention has the following significant advantages: This invention provides a novel target with significant yield-increasing effects and quality-regulating characteristics distinct from existing targets. Compared to existing technologies (such as OsMYB73 knockout), the OsMYB87 gene discovered in this invention exhibits a key differentiating feature: preliminary phenotypic observations show that while its loss of function leads to significant yield increases (increased grain length and weight), the significantly aggravated endosperm chalkiness phenomenon inevitably seen with OsMYB73 knockout was not observed. This strongly suggests that OsMYB87 may reside in a different regulatory pathway, and as a breeding target, it offers greater possibilities and better potential choices for maintaining the commercial appearance quality of rice while achieving yield increases, thus possessing higher application value.

[0037] This invention not only reveals a novel target but also provides a readily implementable technology chain, including a validated specific editing target (SEQ ID NO:3), editing vectors, and specific genetic transformation and identification methods. Those skilled in the art can use this approach to stably and reproducibly obtain OsMYB87 mutants with a consistent yield-increasing phenotype, providing a practical tool and material basis for functional studies and breeding applications.

[0038] Furthermore, this invention creates breeding materials with a clearly defined yield-increasing phenotype that can be directly utilized. The OsMYB87 loss-of-function mutant obtained by this invention has stably integrated the two core superior traits of "increased grain length" and "increased grain weight," which contribute most directly to yield. This material can serve as a valuable genetic donor, directly used in hybridization breeding to accelerate the aggregation of high-yield traits, and has clear prospects for field application. Attached Figure Description

[0039] To more clearly illustrate the technical solutions of the embodiments of this application, the drawings used in the description of the embodiments of this application or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0040] Figure 1 This is a schematic diagram of the construction of the rice OsMYB87 gene knockout vector provided in the embodiments of this application.

[0041] Figure 2A This is a schematic diagram illustrating different editing types of the OsMYB87 gene-editing transgenic lines provided in the embodiments of this application.

[0042] Figure 2B The sequencing verification diagram of the OsMYB87 gene-edited transgenic line provided in the embodiments of this application is shown.

[0043] Figure 3 This is a comparison diagram of the amino acid sequences encoded by CDS in rice OsMYB87 gene knockout plants and wild-type plants provided in the embodiments of this application.

[0044] Figure 4A A comparison image of seeds from wild-type Nipponbare (NIP) and OsMYB87 knockout plants (myb87-ko-1, myb87-ko-2) provided for embodiments of this application.

[0045] Figure 4B Comparison of the appearance of brown rice from wild-type Nipponbare (NIP) and OsMYB87 knockout plants (myb87-ko-1, myb87-ko-2) provided in the embodiments of this application.

[0046] Figure 5A A bar chart showing the grain length and grain width of wild-type Nipponbare (NIP) and OsMYB87 knockout plants (myb87-ko-1, myb87-ko-2) provided in the embodiments of this application. Figure 5BA bar chart showing the 100-grain weight of wild-type Nipponbare (NIP) and OsMYB87 knockout plants (myb87-ko-1, myb87-ko-2) provided for embodiments of this application. Detailed Implementation

[0047] The embodiments of this application are described in detail below. Examples of these embodiments are shown in the accompanying drawings, wherein the same or similar reference numerals denote the same or similar elements or elements having the same or similar functions throughout. The embodiments described below with reference to the accompanying drawings are exemplary and intended to explain this application, and should not be construed as limiting this application. In the description of this application, it should be understood that the terms "upper", "lower", "horizontal", "inner", "outer", etc., indicate the orientation or positional relationship based on the orientation or positional relationship shown in the accompanying drawings, and are only for the convenience of describing this application and simplifying the description, and do not indicate or imply that the device or element referred to must have a specific orientation, or be constructed and operated in a specific orientation, and therefore should not be construed as a limitation of this application. Furthermore, the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. In the description of this application, "multiple" means two or more, unless otherwise explicitly specified.

[0048] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with the accompanying drawings and embodiments.

[0049] This application provides a method for increasing rice grain length and / or grain weight by reducing or eliminating the expression or function of the OsMYB87 gene in rice.

[0050] It is understood that OsMYB87 provided by this invention is a key transcription factor that negatively regulates rice grain length and weight, and reducing its function can achieve a synergistic increase in grain length and weight.

[0051] Furthermore, the reduction or elimination of the expression or function of the OsMYB87 gene is achieved through gene editing, gene silencing, chemical mutagenesis, or physical mutagenesis techniques.

[0052] Furthermore, the gene editing technology is selected from at least one of the following groups: CRISPR / Cas9 system, TALEN, ZFN; the gene silencing technology is selected from at least one of the following groups: RNA interference, antisense RNA; the chemical mutagenesis includes EMS mutagenesis; and the physical mutagenesis includes radiation mutagenesis.

[0053] Please see Figure 1 The diagram below shows the construction of the rice OsMYB87 gene knockout vector provided in this embodiment. Specifically, it shows the physical map of the recombinant CRISPR knockout vector pHUE411-OsMYB87.

[0054] Furthermore, the gene editing is performed using a CRISPR / Cas9 system, the target sequence of which is sgRNA as shown in SEQ ID NO:3.

[0055] This invention provides a novel target with significant yield-increasing effects and quality-regulating characteristics distinct from existing targets. Compared to existing technologies (such as OsMYB73 knockout), the OsMYB87 gene discovered in this invention exhibits a key differentiating feature: preliminary phenotypic observations show that while its loss of function leads to significant yield increases (increased grain length and weight), the significantly aggravated endosperm chalkiness phenomenon inevitably seen with OsMYB73 knockout was not observed. This strongly suggests that OsMYB87 may reside in a different regulatory pathway, and as a breeding target, it offers greater possibilities and better potential choices for maintaining the commercial appearance quality of rice while achieving yield increases, thus possessing higher application value.

[0056] This application also provides a method for breeding rice with traits that increase grain length and / or grain weight, comprising: detecting molecular markers developed based on the OsMYB87 gene sequence in rice germplasm resources or segregating populations, and selecting rice plants carrying said molecular markers.

[0057] It is understood that this embodiment provides a marker-assisted breeding method. This extends the application of the present invention from direct gene editing to conventional breeding and germplasm resource improvement, achieving efficient transfer and aggregation of superior traits.

[0058] Furthermore, the molecular markers were developed based on nucleotide variations in the OsMYB87 gene that lead to its loss of function.

[0059] It is understood that this embodiment limits the functional type of molecular markers, protects molecular markers developed based on "loss-of-function" variants rather than arbitrary variants, and ensures that the selected plants do indeed have the OsMYB87 loss-of-function phenotype.

[0060] Please see Figure 2A The diagram shows different editing types of OsMYB87 gene-edited transgenic lines. 2B is a sequencing verification diagram of the OsMYB87 gene-edited transgenic lines.

[0061] This application also provides an application of the OsMYB87 gene as a target in the breeding of rice varieties with increased grain length and / or grain weight traits.

[0062] It is understandable that this embodiment protects the application of the gene target itself. Protecting the OsMYB87 gene as a breeding target covers other breeding strategies besides gene editing, such as marker-assisted selection, transgenics, and natural variation screening.

[0063] This application also provides the application of OsMYB87 protein as a target in screening candidate compounds that regulate rice grain traits.

[0064] It is understood that this embodiment extends the application of the present invention from gene manipulation to small molecule compound regulation, providing the possibility for the development of novel plant growth regulators (such as OsMYB87 protein function inhibitors).

[0065] Furthermore, the candidate compound is a small molecule inhibitor used to regulate rice grain filling.

[0066] It is understood that this embodiment explicitly protects small molecule inhibitor compounds and their application in regulating grain filling, reserving protection space for the future development of novel chemical regulators.

[0067] This application also provides a rice plant or its seeds that are loss-of-function mutants of the OsMYB87 gene, wherein the grain length and / or grain weight of the mutant rice plant are increased compared with wild-type rice plants.

[0068] It is understood that this embodiment covers all OsMYB87 loss-of-function mutants obtained through different technical means (gene editing, mutagenesis, etc.), and is not limited to materials created by CRISPR / Cas9.

[0069] Furthermore, the chalkiness of the rice grains from the mutant rice plants was not significantly different from that of the wild-type control.

[0070] Furthermore, in the genome of the mutant rice plant, the coding region of the OsMYB87 gene contains mutations that cause loss of function.

[0071] Furthermore, the mutation occurs within a conserved domain of the OsMYB87 gene.

[0072] Furthermore, the mutation includes a deletion or insertion in the nucleotide region from position 32 to 36 of the nucleotide sequence shown in SEQ ID NO:1.

[0073] Furthermore, the mutation includes deletions or insertions in the nucleotide sequence shown in SEQ ID NO:3.

[0074] It is understood that the OsMYB87 loss-of-function mutant obtained in this invention has stably integrated the two core desirable traits that contribute most directly to yield: "increased grain length" and "increased grain weight." This material can serve as a valuable genetic donor, directly used in hybridization breeding to accelerate the aggregation of high-yield traits, and has clear prospects for field application.

[0075] This application also provides a method for creating rice plants with traits that increase grain length and / or grain weight, comprising the following steps: a) Editing or modifying the OsMYB87 gene in rice cells to introduce loss-of-function mutations; b) Regenerate rice plants from the cells obtained in step a); and c) Select plants with grain length and / or grain weight higher than the wild-type control.

[0076] Furthermore, in step a), the loss-of-function mutation is introduced using gene editing technology, gene silencing technology, chemical mutagenesis, or physical mutagenesis.

[0077] Furthermore, the gene editing technology is selected from at least one of the following groups: CRISPR / Cas9 system, TALEN, ZFN; the gene silencing technology is selected from at least one of the following groups: RNA interference, antisense RNA; the chemical mutagenesis includes EMS mutagenesis; and the physical mutagenesis includes radiation mutagenesis.

[0078] Furthermore, the gene editing was performed using the CRISPR / Cas9 system to edit the OsMYB87 gene, and the sgRNA target sequence contained in the system is shown in SEQ ID NO:3.

[0079] Furthermore, the rice cells described in step a) are derived from japonica rice, indica rice, or their hybrid offspring.

[0080] Furthermore, in step a), the editing or modification tool is introduced into rice cells using Agrobacterium-mediated transformation, gene gun method, or pollen tube pathway method.

[0081] This application also provides a molecular marker for identifying or breeding rice with increased grain length and / or grain weight traits, said molecular marker being developed based on nucleotide variations in the OsMYB87 gene sequence.

[0082] Furthermore, the nucleotide variation is a mutation that results in the loss of function of the OsMYB87 gene.

[0083] Furthermore, the molecular markers are used in at least one of the following: a) Rice variety purity identification; b) Selection and mating of rice parents; c) Early generation screening of rice.

[0084] Compared to existing technologies (such as OsMYB73 knockout), the OsMYB87 gene discovered in this invention exhibits a key differentiating feature: preliminary phenotypic observations show that while its loss of function leads to a significant increase in yield (increased grain length and weight), the significantly aggravated endosperm chalkiness that is inevitably caused by OsMYB73 knockout was not observed. This strongly suggests that OsMYB87 may be located in a different regulatory pathway, and as a breeding target, it offers greater possibilities and better potential choices for maintaining the commercial appearance quality of rice while achieving increased yield, thus possessing higher application value.

[0085] In the embodiments of the present invention, unless otherwise specified, the reagents, methods, and instruments used are all conventional reagents, methods, and instruments in the technical field. Those skilled in the art will understand that, based on the concept of the present invention, conventional adjustments or substitutions to experimental conditions or steps still fall within the scope of the present invention.

[0086] The sequence list involved in the embodiments of this application is described as follows. SEQ ID NO:1: Genomic nucleotide sequence of rice OsMYB87 gene (LOC_Os07g31470)

[0087] SEQ ID NO:2: Nucleotide sequence of the coding region (CDS) of the rice OsMYB87 gene

[0088] SEQ ID NO:3: CRISPR / Cas9 gene editing target sequence

[0089] SEQ ID NO:4: MYB87-81-qF upstream primer for quantitative PCR

[0090] SEQ ID NO:5: MYB87-81-qR downstream primer for quantitative PCR

[0091] SEQ ID NO:6: Mutation identification upstream primer MYB87-cas9-mut-740-F

[0092] SEQ ID NO:7: Mutation identification downstream primer MYB87-cas9-mut-740-R.

[0093]

[0094] Example 1: Construction of rice OsMYB87 gene knockout vector This embodiment aims to construct a CRISPR / Cas9 gene editing vector for knocking out the rice OsMYB87 gene (LOC_Os07g31470).

[0095] First, based on the nucleotide sequence of the OsMYB87 gene (SEQ ID NO:1), a gene knockout target with low potential off-target risk was designed in the first exon region of its coding region. The final selected specific sgRNA target sequence is: AGCAAGCAGAAGGTGAAGCG (SEQ ID NO:3).

[0096] Specific primers containing the above-mentioned target were synthesized, and fragments containing the target sequence and gRNA backbone were obtained by PCR amplification. The intermediate vector pHUE411 was digested with restriction endonucleases, and the above PCR fragment was recombined with the linearized vector using a recombination ligation kit to construct a complete knockout vector, named pHUE411-OsMYB87.

[0097] The ligation product was transformed into competent Escherichia coli DH5α, and positive clones were identified by colony PCR and sequenced. Sequencing results confirmed that the target sequence was correctly and completely ligated into the vector without mutation, indicating that the rice OsMYB87 gene knockout vector was successfully constructed.

[0098] Example 2: Genetic transformation of OsMYB87 gene knockout vector and obtaining positive plants This embodiment aims to introduce the knockout vector constructed in Example 1 into the rice variety "Nipponbare" to obtain transgenic plants.

[0099] The correctly sequenced pHUE411-OsMYB87 knockout plasmid from Example 1 was transformed into Agrobacterium strain EHA105. Using Agrobacterium-mediated genetic transformation, prepared mature embryo callus tissue of 'Nipponbare' was infected and co-cultured. After a series of steps including antibacterial washing, hygromycin selection culture, differentiation, rooting, and seedling strengthening, T0 generation regenerated plants were finally obtained.

[0100] To preliminarily confirm whether the expression of the target gene was affected, RNA was extracted from some T0 generation transgenic plants, reverse transcribed into cDNA, and then detected by real-time quantitative PCR using specific quantitative primers for the OsMYB87 gene.

[0101] The quantitative primer sequences are as follows: MYB87-81-qF: 5'-GAGCTTCAGGGATCAGAAC-3' (SEQ ID NO: 4) MYB87-81-qR: 5'-ATGGAAGAGGACGAGGAG-3' (SEQ ID NO: 5) The results showed that the expression level of OsMYB87 in some T0 generation plants was significantly lower than that in the wild-type control. Two independent transformation events with low expression levels (named myb87-ko-1 and myb87-ko-2, respectively) were selected for single-plant harvesting and subsequent propagation to obtain stably inherited T1 generation materials.

[0102] Example 3: Molecular identification of OsMYB87 gene knockout positive plants This embodiment aims to identify the genotype of the T0 generation positive plants obtained in Example 2 to confirm whether the expected mutation has occurred at the target site.

[0103] Genomic DNA was extracted from leaves of T0 generation hygromycin (Hyg)-positive plants (myb87-ko-1 and myb87-ko-2) and wild-type 'Nipponbare' plants, respectively. Specific primers located on both sides of the target site (SEQ ID NO:3) were designed to amplify the target region by PCR.

[0104] The primer sequences for identification are as follows: MYB87-cas9-mut-740-F: 5'-TTTGGCAGTAGAGGACAAGGAAC-3' (SEQ ID NO: 6) MYB87-cas9-mut-740-R: 5'-AGGAGACGGCAGCGATGGAG-3' (SEQ ID NO: 7) The obtained PCR products were purified and directly subjected to Sanger sequencing. The sequencing results were compared with the wild-type SEQ ID NO:1 sequence. The results showed that both T0 generation plants had biallelic mutations in the target region, but the mutation types were different: The myb87-ko-1 strain exhibits a 5-base deletion at the target site. This deletion results in a frameshift of the open reading frame in its coding region, followed shortly by the introduction of an early stop codon.

[0105] The myb87-ko-2 strain exhibits a 4-base deletion at the target site. This deletion also leads to a frameshift mutation in the coding region, causing premature termination of protein translation.

[0106] The above results indicate that the OsMYB87 gene in both strains was successfully edited, and its gene function is expected to be lost.

[0107] Two T0 generation lines, myb87-ko-1 and myb87-ko-2, were self-crossed to harvest T1 generation seeds. T1 generation seeds were then sown, and DNA was extracted from the leaves of each individual plant. PCR amplification and sequencing were performed using the same primers (SEQ ID NO: 6 and 7). Plants with homozygous deletions of the target region were screened out; these were identified as target homozygous mutants for subsequent analysis.

[0108] Example 4: Protein sequence alignment analysis between OsMYB87 gene knockout plants and wild-type plants This embodiment aims to verify the loss of function of the OsMYB87 gene in the homozygous mutant obtained in Example 3 at the protein level.

[0109] Total RNA was extracted from the T1 generation homozygous mutant plants (myb87-ko-1, myb87-ko-2) obtained in Example 3 and from the wild-type 'Nipponbare' varietal, and cDNA was obtained by reverse transcription. The coding region (CDS, SEQ ID NO:2) of the OsMYB87 gene was amplified by PCR and sequenced. The sequenced coding region was translated into an amino acid sequence using bioinformatics software and compared with the wild-type OsMYB87 protein sequence.

[0110] For comparison results, please refer to the appendix to the instruction manual. Figure 3 , Figure 3 The amino acid sequence alignment diagram of the CDS encoded by OsMYB87 gene knockout plants and wild-type plants in rice confirms that: The myb87-ko-1 mutant: Due to the deletion of 5 bases, the protein sequence undergoes a frameshift starting from the region corresponding to the target site, resulting in premature termination of translation. The encoded protein is only a small segment of the N-terminus of the wild-type protein, and the key conserved MYB domain is destroyed.

[0111] The myb87-ko-2 mutant: Due to the deletion of 4 bases, its protein sequence also undergoes a frameshift starting from the region corresponding to the target site, causing premature termination of translation and preventing the formation of a complete and functional OsMYB87 protein.

[0112] The results confirm at the protein level that myb87-ko-1 and myb87-ko-2 created in this invention are OsMYB87 loss-of-function mutants.

[0113] Example 5: Phenotypic observation and agronomic trait investigation of OsMYB87 gene knockout plants This embodiment aims to investigate the effect of OsMYB87 gene loss of function on rice yield-related traits, especially grain traits, in order to verify the beneficial effects of the present invention.

[0114] The T1 generation homozygous mutants (myb87-ko-1, myb87-ko-2) identified in Example 4 and wild-type 'Nipponbare' plants were planted under the same growing season and field cultivation management conditions, with three replicate plots for each line. After maturity, each plot was harvested individually, and the following traits were examined: Grain trait assessment: 100 plump grains were randomly selected from each line, and their grain length and width were measured using an intelligent seed analysis system (such as Top Cloud Agriculture TPKZ-3), and the weight of 100 grains was also measured. Figure 4A A comparison of grains from wild-type Nipponbare (NIP) and OsMYB87 knockout plants (myb87-ko-1, myb87-ko-2) was presented. The mean and standard error were calculated, and statistical analysis (t-test) was performed.

[0115] Preliminary observation of appearance quality: Harvested rice from each strain was hulled to obtain brown rice, and photographed and compared against the same white background. For example... Figure 4B Comparison of the appearance of brown rice from wild-type Nipponbare (NIP) and OsMYB87 knockout plants (myb87-ko-1, myb87-ko-2).

[0116] result: Yield-related traits: Compared with the wild-type control, the grain traits of both OsMYB87 loss-of-function mutants were significantly altered (see the instruction manual appendix). Figure 5A and 5B Figure A shows a bar chart of grain length and width for wild-type Nipponbare (NIP) and OsMYB87 knockout plants (myb87-ko-1, myb87-ko-2). Figure B shows a bar chart of 100-grain weight for wild-type Nipponbare (NIP) and OsMYB87 knockout plants (myb87-ko-1, myb87-ko-2). Specific data are as follows: Granule length: The average granule length of the myb87-ko-1 mutant was significantly increased by 5.49% compared with the wild-type control, with a highly significant difference (p<0.001); the average granule length of the myb87-ko-2 mutant was significantly increased by 5.90% compared with the wild-type, with a similarly highly significant difference (p<0.001).

[0117] Grain weight: The average weight per 100 grains of the myb87-ko-1 mutant was significantly increased by 3.34% compared with the wild-type control, with a highly significant difference (p<0.001); the average weight per 100 grains of the myb87-ko-2 mutant was significantly increased by 1.36% compared with the wild-type, with a highly significant difference (p<0.001).

[0118] Grain width: The average grain width of the myb87-ko-1 mutant was not significantly different from that of the wild-type control (p>0.05). This indicates that the loss of function of the OsMYB87 gene specifically regulates grain longitudinal elongation without affecting lateral development.

[0119] Appearance quality: Observe the appearance of brown rice by comparison (see the instruction manual). Figure 4B In representative samples from both mutants, no visually noticeable deterioration or difference was found in chalkiness (including chalky grain rate and chalkiness degree) compared to the wild-type control. This indicates that the loss of function of OsMYB87 did not negatively affect the appearance quality of rice while achieving increased yield.

[0120] The results of the above embodiments demonstrate that this invention completes a closed loop of functional verification, from "molecular target design and vector construction" → "genetic transformation and mutant creation" → "molecular and protein-level verification of gene knockout (DNA sequencing and protein sequence alignment)" → "field identification of key yield-increasing traits". All experimental evidence corroborates each other, conclusively proving that: By specifically knocking out the rice OsMYB87 gene using CRISPR / Cas9 technology, new rice germplasm can be stably and reproducibly created with a significant synergistic increase in grain length and weight, while maintaining stable grain width. Specifically, the mutant grain length increased by more than 5.5%, and the 100-grain weight increased by more than 1.3%, with both differences reaching a highly significant level (p<0.001), while the appearance quality (chalky white) of the rice did not show any visible deterioration.

[0121] This invention not only reveals for the first time that OsMYB87 is a key transcription factor that negatively regulates rice grain length and weight, but also provides a complete technical solution that is experimentally verified, has a clear pathway, is highly operable, and yields predictable results. This solution provides effective new targets and directly usable high-quality germplasm materials for high-yield rice breeding, and has significant theoretical and practical value.

[0122] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

[0123] It is understood that the technical features of the above embodiments can be combined arbitrarily. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0124] The above are merely preferred embodiments of this application, and only specifically describe the technical principles of this application. These descriptions are only for explaining the principles of this application and should not be construed as limiting the scope of protection of this application in any way. Based on this explanation, any modifications, equivalent substitutions, and improvements made within the spirit and principles of this application, as well as other specific embodiments of this application that can be conceived by those skilled in the art without creative effort, should be included within the scope of protection of this application.

Claims

1. A method for increasing rice grain length and / or grain weight, characterized in that, Reduce or eliminate the expression or function of the OsMYB87 gene in rice.

2. The method according to claim 1, characterized in that, The reduction or elimination of the expression or function of the OsMYB87 gene is achieved through gene editing, gene silencing, chemical mutagenesis, or physical mutagenesis techniques. The gene editing technology is selected from at least one of the following groups: CRISPR / Cas9 system, TALEN, ZFN; the gene silencing technology is selected from at least one of the following groups: RNA interference, antisense RNA; the chemical mutagenesis includes EMS mutagenesis; the physical mutagenesis includes radiation mutagenesis; The gene editing was performed using the CRISPR / Cas9 system, and the target sequence of the sgRNA contained in the system is shown in SEQ ID NO:

3.

3. A method for breeding rice varieties with increased grain length and / or grain weight traits, characterized in that, include: Detect molecular markers based on the OsMYB87 gene sequence in rice germplasm resources or segregating populations, and select rice plants carrying the molecular markers.

4. The method according to claim 3, characterized in that, The molecular markers were developed based on nucleotide variations in the OsMYB87 gene that lead to its loss of function.

5. Application of the OsMYB87 gene as a target in the breeding of rice varieties with increased grain length and / or grain weight traits; or application of the OsMYB87 protein as a target in the screening of candidate compounds that regulate rice grain traits.

6. The application according to claim 5, characterized in that, The candidate compound is a small molecule inhibitor used to regulate rice grain filling.

7. A rice plant or its seeds that are a loss-of-function mutant of the OsMYB87 gene, characterized in that, Compared with wild-type rice plants, the mutant rice plants have increased grain length and / or grain weight.

8. The mutant rice plant or its seeds according to claim 7, characterized in that, The chalkiness of the rice grains from the mutant rice plants was not significantly different from that of the wild-type control; the coding region of the OsMYB87 gene in the genome of the mutant rice plants contained a mutation that caused loss of function; the mutation occurred within a conserved domain of the OsMYB87 gene; the mutation included a deletion or insertion in the nucleotide region from position 32 to 36 of the nucleotide sequence shown in SEQ ID NO:1; or the mutation included a deletion or insertion in the nucleotide sequence shown in SEQ ID NO:

3.

9. A method for creating rice plants with traits that increase grain length and / or grain weight, characterized in that, Includes the following steps: a) Editing or modifying the OsMYB87 gene in rice cells to introduce loss-of-function mutations; b) Regenerate rice plants from the cells obtained in step a); as well as c) Select plants with grain length and / or grain weight higher than the wild-type control.

10. The method according to any one of claims 9, characterized in that, The rice cells described in step a) are derived from japonica rice, indica rice, or their hybrid offspring; in step a), the editing or modification tools are introduced into the rice cells using Agrobacterium-mediated transformation, gene gun method, or pollen tube pathway method.

11. A molecular marker for identifying or breeding rice with traits of increased grain length and / or grain weight, characterized in that, The molecular markers were developed based on nucleotide variations in the OsMYB87 gene sequence.

12. The molecular marker according to claim 11, characterized in that, The nucleotide variation is a mutation that causes loss of function of the OsMYB87 gene.

13. The use of the molecular marker of claim 12 in at least one of the following: a) Rice variety purity identification; b) Selection and mating of rice parents; c) Early generation screening of rice.