Gene editing system suitable for cotton, application of gene editing system and gene editing method

Abstract

The invention relates to the field of nucleic acid editing, in particular to a gene editing system suitable for cotton, application of the gene editing system and a gene editing method, and the gene editing system CRISPR / Cas12i. 3 contains targeted site sgRNAs and Cas12i. 3 protein; wherein the Cas12i. 3 protein has an amino acid sequence as shown in SEQ ID NO: 1, and the targeting site sgRNAs has a base sequence as shown in SEQ ID NO: 2. According to a gene editing method for cotton multi-gene knockout by utilizing a gene editing system, a corresponding target site sgRNAs is designed aiming at a salt-sensitive protein phosphatase GhTOPP4 target gene, then the sgRNAs, a cotton endogenous Pol III type promoter and Cas12i. 3 protein are mixed to form a compound, and the compound realizes effective editing of cotton genes in a cotton protoplast transformation mode.

Description

Technical Field

[0001] This invention relates to the field of nucleic acid editing, specifically to a gene editing system applicable to cotton, its application, and gene editing methods. Background Technology

[0002] With the continuous improvement of the tetraploid cotton genome information, research on key functional genes such as high yield, high quality, drought resistance, and salt tolerance has gradually unfolded and yielded a series of results. However, compared with other major crops, cotton functional genomics research still needs to be strengthened. The analysis of cotton gene function highly depends on the creation of mutant materials, but traditional physicochemical mutagenesis and T-DNA insertion methods are inefficient and cannot meet breeding needs. In recent years, the rapid development of gene editing technology has provided new avenues for cotton trait improvement. Among them, CRISPR / Cas9 technology, due to its ease of operation and low cost, has become the most widely used gene editing tool in the fields of plants, animals, and microorganisms. While this technology has achieved some success in cotton variety improvement, it also has certain drawbacks. On the one hand, PAM sequences limit the editable range: traditional Cas9 must recognize specific NGG sequences in the genome to cut, which greatly limits the range of editable targets. On the other hand, large fragment editing is difficult; traditional double-strand break-based editing methods are difficult to efficiently and accurately insert or replace large DNA fragments, resulting in low gene editing efficiency, many invalid edits, and increased costs. Furthermore, there is still a lack of new and more effective gene editing methods. Therefore, exploring the application of new nuclease editors in cotton, establishing an efficient cotton gene editing system, and deeply analyzing gene functions and screening for superior targets are of great significance. Summary of the Invention

[0003] The purpose of this invention is to provide a gene editing system suitable for cotton, its application, and a gene editing method.

[0004] To achieve the above objectives, the present invention adopts the following technical solution: A gene editing system suitable for cotton, the gene editing system (CRISPR / Cas12i.3) contains target site sgRNAs and Cas12i.3 protein; wherein, the Cas12i.3 protein has the amino acid sequence shown in SEQ ID NO:1.

[0005] The target site sgRNAs are specific target sequences targeting specific regions of the target genome.

[0006] The gene editing system includes target site sgRNAs, a cotton endogenous Pol III promoter, and a vector backbone containing Cas12i.3 protein.

[0007] The vector backbone containing the Cas12i.3 protein is 3301-cas12i.3.

[0008] The cotton endogenous PolⅢ type promoter is the GhU6 promoter.

[0009] A gene editing method for the gene editing system applicable to cotton, comprising the following steps: S1. Construction of the complex nucleic acid molecule: Design corresponding gRNAs for specific target sequences in the target genome region; introduce them into the promoter to obtain complex nucleic acid molecules; Vector construction of S2.Cas12i gene elements: Using 3301-cas12i.3 as the backbone vector, a cotton endogenous PolⅢ promoter with introduced gRNA was obtained by semi-nested PCR cloning. The complex nucleic acid molecule with introduced promoter was ligated into the 3301-cas12i.3 vector by homologous recombination. S3. Carrier Import: The 3301-cas12i.3 vector, which introduces a complex nucleic acid molecule containing a promoter as described in S2, was transformed into cotton protoplasts.

[0010] An application of the gene editing system described above, specifically its application in mediating infection of cotton callus, cotton organs, and cotton plants; Or, its application in the preparation of cotton-edited cell lines; Or, its application in the preparation of cotton edited germplasm materials; Or, its application in screening cotton gene editing targets; Or, its application in cotton breeding.

[0011] A type of sgRNA targeting the cotton sensitized protein phosphatase gene, wherein the sgRNA has the base sequence shown in SEQ ID NO:2.

[0012] A gene editing system for multibase knockout cotton editons, the gene editing system containing sgRNAs and Cas12i.3 protein targeting the cotton sensitive salt protein phosphatase gene.

[0013] A gene editing method for multi-gene knockout in cotton using the aforementioned gene editing system, targeting sensitive salt protein phosphatase. GhTOPP4 The target gene was identified, and corresponding sgRNAs were designed to target specific sites. The sgRNAs were then mixed with the cotton endogenous Pol III promoter and Cas12i.3 protein to form a complex. The complex was then transformed into cotton protoplasts to achieve effective editing of cotton genes. Attached Figure Description

[0014] Figure 1This is an agarose gel electrophoresis image of the full-length PCR product of the DNA sequence of SEQ ID No. 3.

[0015] Figure 2 This is a schematic diagram showing the structure and target information of the p7N recombinant vector.

[0016] Figure 3 This is a schematic diagram of the 3301-cas12i.3 recombinant vector structure.

[0017] Figure 4 This is a schematic diagram of the structure and target information of the "3301-12i.3 recombinant vector".

[0018] Figure 5A This is a map showing the subcellular localization and expression of cotton protoplasts.

[0019] Figure 5B This is a graph showing the conversion efficiency of cotton protoplasts.

[0020] Figure 6A For CRISPR / Cas9- GhTOPP4 A comparison of the gene-edited Hi-tom sequencing results with the original gene sequence.

[0021] Figure 6B For CRISPR / Cas9- GhTOPP4 Gene editing efficiency graph based on Hi-tom sequencing analysis.

[0022] Figure 6C For CRISPR / Cas12i- GhTOPP4 A comparison of the gene-edited Hi-tom sequencing results with the original gene sequence.

[0023] Figure 6D For CRISPR / Cas12i- GhTOPP4 Gene editing efficiency graph based on Hi-tom sequencing analysis. Detailed Implementation

[0024] Example 1: Target Selection and Vector Construction CRISPR / Cas12i- GhTOPP4 Target selection and vector construction Based on the genomic sequence information corresponding to the cotton GhTOPP4 gene, a PAM sequence (5'-TTN-3') conforming to the Cas12i.3 recognition characteristics was obtained; subsequently, the cotton salt-sensitive gene was obtained. GhTOPP4 The target site sequence, as shown in SEQ ID No. 2, consists of 22 nucleotides, namely 5'-TCTGAATCTGAGATCAAACAGC-3'. Using the cotton GhU6 promoter as a template, primers to be added to the reaction system were designed as follows: (U6-F0: 5'-GTGTGACTATGCACACATTCTCTCAGGTGGTCAGAGCCATCTGATGCTTCTT-3' U6-F: 5'-attcgagctcggtacCCGGGAAAAAAAAGCTGTTTGATCTCAGATTCAGAGTGTGACTATGCACAC-3' U6-R: 5'-ACGACCGGGTCACGCTGCAAAGCTTTTTAATCTGATGCTCCACC-3') PCR amplification was performed to obtain PCR products. The 50 μL PCR reaction system, amplified using Novizan's Planta® Max Super-Fidelity DNA Polymerase kit, included: 25 μL 2×Phanta Max Buffer, 1 μL dNTPMix (10 mM), 2 μL cDNA, 1 μL Phanta Max Super-Fidelity DNA Polymerase, primer U6-F0: 0.125 μL, primer U6-F: 2.5 μL, primer U6-R: 2.5 μL, and ddH2O to 50 μL. The PCR amplification program was: 95℃ for 3 min; 95℃ for 15 s, 58℃ for 15 s, 72℃ for 30 s, 35 cycles; 72℃ for 5 min. The PCR products were electrophoresed on a 1.5% agarose gel as shown in the image. Figure 1 As shown. After electrophoresis, the target band was cut under UV light and recovered and purified using an agarose gel DNA recovery kit (purchased from Prometheus (Beijing) Biotechnology Co., Ltd., the operation steps are as per the kit's instruction manual).

[0025] Obtaining the 3301-cas12i.3 vector The plant UBI promoter and the base sequence shown in SEQ ID No. 1 were spliced ​​together using conventional gene synthesis methods. The spliced ​​DNA sequence was used as a template DNA sequence, and PCR amplification was performed using upstream primer F1 and downstream primer R1 to obtain a product containing the plant UBI promoter, the nucleic acid sequence encoding the Cas12i.3 protein, and the vector homologous arm. Using the pCAMBIA3301 vector as a backbone, the pCAMBIA3301 vector was digested with HindIII and PmlI, and the vector framework was recovered and purified. The PCR-purified product and the vector framework were ligated to obtain the 3301-cas12i.3 recombinant vector. Its structure is shown in [Figure number missing]. Figure 3 The upstream primer F1 and the downstream primer R1 are as follows: Upstream primer F1: 5'-gacctgcaggcatgc aagctt TGCAGCGTGACCCGGTCG-3', the underlined part is the HindIII restriction site.

[0026] Downstream primer R1: 5'-gtcacctgtaattca cacgtg CTACTTCTTCTTCTTAGCCTGCCC-3', the underlined part is the PmlI restriction site.

[0027] Recombinant vector construction The plasmid “3301-cas12i.3” was digested with HindIII and XmaI restriction endonucleases. The digestion status was assessed using a 1.5% agarose gel, and the gel was excised under UV light and collected into a 1.5 ml EP tube. The digested vector and the plasmid containing the restriction enzymes were purified and recovered using an agarose gel DNA recovery kit (purchased from Prometheus (Beijing) Biotechnology Co., Ltd.). GhTOPP4 Gene editing target and repetitive sequence of cotton U6 promoter full-length DNA fragment ( Figure 3 The recovered DNA fragment product was homologously recombinated with the enzyme-digested and recovered 3301-cas12i.3 vector fragment at a ratio of 3:1 to obtain the vector structure shown below. Figure 4 As shown, the 10 μL recombination reaction system consisted of: 1 μL of the recovered DNA fragment, 3 μL of the enzyme-digested and recovered 3301-cas12i.3, 2 μL of 5XCEII Buffer, 1 μL of Exnase® II, and ddH2O to a final volume of 10 μL; ligation was performed at 37℃ for 30 min. 5 μL of the ligation product was then transformed into *E. coli* DH5α using the heat shock method (referring to J. Sambrook et al., *Molecular Cloning: A Laboratory Manual* (3rd edition), Science Press, 2002). Positive clones were screened using Kanamycin-resistant LB agar plates, and 5 clones were selected for sequencing (sequencing was performed by Beijing Qingke Sequencing Co., Ltd.) to obtain the inserted DNA sequence. Sequencing results showed that the full-length DNA fragment was 1047 bp, as shown in SEQ ID No. 3; the recombinant plasmid was obtained by replacing the DNA fragment between the HindIII and XmaI restriction sites of “3301-cas12i.3” with the sequence of SEQ ID No. 3 while keeping the other sequences of the vector unchanged.

[0028] Comparative Example 1 CRISPR / Cas9- GhTOPP4 Target selection and vector construction cotton GhTOPP4The corresponding genomic sequence of the gene was used to obtain the PAM sequence (5'-NGG-3') that conforms to the Cas9 recognition characteristics. Two CRISPR / Cas9 target sites were designed, namely... GhTOPP4 -T1 and GhTOPP4 -T2. Target site PCR amplification primers were designed based on the target site and synthesized by Tianyi Huiyuan Biotechnology Co., Ltd.

[0029] Using the intermediate vector pGTR as a template, PCR amplification primers constructed according to the vector described below were used to amplify a DNA fragment containing the target sequence and gRNA+tRNA backbone (as shown in SEQ ID No. 4). The DNA fragment containing the target sequence and gRNA+tRNA backbone was cloned into the final gene-editing expression vector P7N using homologous recombination. The constructed gene-editing recombinant vector was transformed into *E. coli* TOP10, and positive clones were screened by colony PCR. The gene-editing recombinant vectors of the selected positive clones were sequenced to complete the vector construction. Specifically, the recombinant plasmid was obtained by replacing the DNA fragment between the BsaI restriction sites of P7N with the sequence of SEQ ID No. 4 while keeping other sequences of P7N unchanged. Figure 2 As shown.

[0030] The target site GhTOPP4 -T1 and GhTOPP4 -T2 and PCR primers constructed from the vector As shown below: Target site: GhTOPP4 -T1 5'-GTATATCGAGAGAGGTGAGA-3' GhTOPP4 -T2 5'-CGTTTTGAAGATTTGTGACTT-3' PCR amplification primers constructed from the vector: pRGEB32-7s 5'-AAGCATCAGATGggcaAACAAAGCACCAGTGGTCTAG-3' inf pRGEB32-7s 5'-AAGCATCAGATGGGCAAACAAA-3' GhTOPP4 -T1as 5'-AGAGAACTTTTTTCTATTGCTGCACCAGCCGGGAAT-3' GhTOPP4 -T1s 5'-GCAATAGAAAAAAGTTCTCTGTTTTAGAGCTAGAAATA-3' GhTOPP4-T2as 5'-CCACAGGAAGACAGTTAAAGTGCACCAGCCGGGAAT-3' GhTOPP4 -inf-T2as 5'-TTCTAGCTTAAAACCCACAGGAAGACAGTTAAAG-3' Example 2: Analysis of cotton protoplast conversion efficiency Using subcellular localization technology, a GFP (green fluorescent protein gene) vector carrying a nuclear localization gene was used as a positive control. The editing vector or GFP positive control vector obtained in Example 1 and Comparative Example 1 were transformed into cotton protoplasts by PEG-mediated protoplast transformation. The transformation efficiency of the same batch was observed, recorded and analyzed by confocal microscopy.

[0031] The methods for separating and transforming cotton protoplasts are as follows: Cotton protoplast isolation (Cellulase R10 and Macerozyme R10 were purchased from Onozuka, and other reagents were purchased from Sigma-Aldrich).

[0032] Enzymatic hydrolysate (10 mL): 1.5% Cellulase R10, 0.4% Macerozyme R10, 0.4 M mannitol, 20 m M KCl, 20 m M MES pH 5.7, 2% sucrose, 10 m M CaCl2.

[0033] WI solution: 20mM KCl, 0.5M mannitol, 4mM MES, pH 5.7.

[0034] W5 solution: 125mM CaCl2, 154mM NaCl, 5mM KCl, 2mM MES, pH 5.7.

[0035] MMg solution: 0.4M mannitol, 15mM MgCl2, 4mM MES, pH 5.7.

[0036] 40% (w / v) PEG conversion solution: 0.2M mannitol, 100mM CaCl2, 4g PEG 4000.

[0037] Using the "sandwich method," peel off the lower epidermis of the cotton cotyledons. Cut the tender middle part of the cotton cotyledons into even, thin slices about 1-2 mm thick, spreading them evenly across the entire culture dish. Immerse the slices in the enzyme solution, protecting them from light and vacuum-sealing for 2 hours. After standing at room temperature for 6 hours, gently shake the culture dish to release the protoplasts. Add an equal volume of W5, filter the mixture through a 200-mesh nylon membrane, and collect the protoplasts in a 50 ml protoplast tube. Filter the mixture a second time through a 400-mesh sieve, and centrifuge at 700 rpm for 2 minutes to collect the protoplasts. Resuspend the protoplasts in 5 ml of W5 and centrifuge at 700 rpm for 2 minutes. Remove the W5 and add 5 ml of fresh W5. Incubate on ice for 30 minutes to precipitate the protoplasts. Remove the W5, add 1 ml of MMg, mix well, and adjust the cell number to 2 × 10⁻⁶ cells / mL. 5 Quantities per ml are used for conversion.

[0038] Take 10 μg of plasmid DNA, add 100 μL of protoplasts and 110 μL of 40% PEG solution for transformation; mix gently, incubate at room temperature for 5 min, and stop the reaction with 800 μL of W5. Centrifuge at 700 rpm for 2 min, remove the PEG, and resuspend the protoplasts in 50 μL of WI. Aliquot the protoplasts into WI culture plates containing 250 μL each, incubate under light at room temperature for 48 h, and collect by centrifugation.

[0039] Using a pipette tip with the tip cut off, a small amount of protoplasts containing the positive control was aspirated and dropped onto a glass slide. The expression of GFP was observed and recorded under a laser confocal microscope.

[0040] The results showed that obvious green fluorescence could be observed in the nuclei of the transformed cotton protoplast cells. Figure 5A As shown, by calculating the protoplast transformation efficiency with different replicates, the average transformation efficiency reached 58.7%. Figure 5B As shown, the recombinant vector can be successfully transferred into cotton protoplasts, and the PEG-mediated cotton protoplast transformation method has high efficiency.

[0041] Example 3: Cotton protoplast DNA extraction and Hi-tom sequencing analysis DNA was extracted from cotton protoplasts using the CTAB method. Protoplasts were centrifuged at 700 rpm for 2 min. The supernatant was discarded, and 600 μL of preheated CTAB solution (100 mM Tris-HCl, pH 8.0; 1.4 M NaCl; 200 mM EDTA, pH 8.0; 2% CTAB (w / v), 2% PVP40, 2% (v / v) 2-mercaptoethanol) was added to the centrifuge tube. The tube was vigorously shaken for 10 s to mix, and incubated at 60°C for 40 min, inverting the tube every 10 minutes. Then, an equal volume of chloroform:isoamyl alcohol (24:1 (v / v)) was added, and the tube was gently extracted. The tube was centrifuged at 12000 rpm at 4°C for 10 min. The supernatant was collected and extracted again, and 0.6 volumes of pre-chilled isopropanol were added. The tube was slowly inverted and incubated at -20°C for 60 min. Centrifuge at 12000 rpm and 4℃ for 10 min, discard the supernatant, wash the precipitate twice with 70% ethanol and once with anhydrous ethanol. Allow the ethanol to evaporate completely, dissolve in sterile water, and use as a template for subsequent PCR reactions.

[0042] The gene editing efficiency of the editing vector was analyzed using the high-throughput mutation analysis platform Hi-tom (available at https: / / doi.org / www.hi-tom.net / hi-tom / ). The method was as follows: conventional primers were designed using PCR primer design principles, with a bridging sequence 5'-ggagtgagtacggtgtgc-3' added to the front end of the forward primer; the reverse primer also had a bridging sequence 5'-gagttggatgctggatgg-3' added to the front end. After verifying the amplified DNA fragment, Hi-tom sequencing analysis was performed. The sequencing results were compared with the original cotton GhTOPP4 gene sequence. The results showed that the Cas9 nuclease did not produce effective editing at the editing target site. Figure 6A As shown, a deletion of only one base near the target site is generated. Figure 6B As shown, this indicates that the Cas9 nuclease has low efficiency in editing GhTOPP4 in cotton protoplasts. In contrast, the Cas12i nuclease can effectively introduce large deletions into cotton, such as... Figure 6C As shown, varying numbers of polybasic insertions or deletions were simultaneously generated near the target site, such as... Figure 6D As shown.

[0043] SEQ ID No. 1 is the amino acid sequence of the Cas12i.3 protein: SEQ ID No. 2 is CRISPR / Cas12i- GhTOPP4 Target sequence TCTGAATCTGAGATCAAACAGC SEQ ID No. 3 is the full-length sequence of the cotton U6 promoter containing gene editing targets and repetitive sequences. SEQ ID No. 4 is the combined sequence of gRNA + tRNA and CRISPR / Cas9- GhTOPP4 gene target AACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCAGCAATAGAAAAAAGTTCTCTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCACTTTAACTGTCTTCCTGTGG。

Claims

1. A gene editing system suitable for cotton, characterized in that: The gene editing system CRISPR / Cas12i.3 contains target site sgRNAs and Cas12i.3 protein; wherein, the Cas12i.3 protein has the amino acid sequence shown in SEQ ID NO:1, and the target site sgRNAs have the base sequence shown in SEQ ID NO:

2.

2. The gene editing system for cotton according to claim 1, characterized in that: The gene editing system includes target site sgRNAs, a cotton endogenous Pol III promoter, and a vector backbone containing Cas12i.3 protein.

3. The gene editing system for cotton according to claim 2, characterized in that: The vector backbone containing the Cas12i.3 protein is 3301-cas12i.

3.

4. A gene editing method for a gene editing system suitable for cotton as described in claim 1, characterized in that: Includes the following steps: S1. Construction of the complex nucleic acid molecule: Target sequences in the target genome region are designed with corresponding gRNAs; these gRNAs are then introduced into the promoter to obtain complex nucleic acid molecules. Vector construction of S2.Cas12i.3 gene elements: Using 3301-cas12i.3 as the backbone vector, a cotton endogenous PolⅢ promoter with introduced gRNA was obtained by semi-nested PCR cloning. The complex nucleic acid molecule with introduced promoter was ligated into the 3301-cas12i.3 vector by homologous recombination. S3. Carrier Import: The vector of the Cas12i.3 gene element described in S2 was transformed into cotton protoplasts.

5. The gene editing method for a gene editing system suitable for cotton according to claim 4, characterized in that: Targeting the target gene of the sensitive salt protein phosphatase GhTOPP4, corresponding target site sgRNAs were designed. The sgRNAs were then mixed with the cotton endogenous Pol III promoter and Cas12i.3 protein to form a complex. The complex was then transformed into cotton protoplasts to achieve effective editing of cotton genes.

6. The application of the gene editing system for cotton as described in claim 1, characterized in that: The application of the gene editing system in mediating infection of cotton callus, cotton organs, and cotton plants; Or, its application in the preparation of cotton-edited cell lines; Or, its application in the preparation of cotton edited germplasm materials; Or, its application in screening cotton gene editing targets; Or, its application in cotton breeding.

Images