Construction method and application of lung cancer bone metastasis non-human animal model
By constructing a Rosa26-mediated human SLC7A7 conditional overexpression mouse model and achieving KRAS mutation and Tp53 knockout in lung epithelial cells, the process of lung cancer bone metastasis was successfully simulated, overcoming the limitations of existing models in lung cancer bone metastasis research and providing an efficient experimental tool.
Patent Information
- Application Number
- CN202512012448.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-29
- Publication Date
- 2026-05-15
AI Technical Summary
Existing animal models of lung cancer bone metastasis have significant limitations in simulating the process of lung cancer metastasis to the bone. They are unable to efficiently simulate the complex bone microenvironment and its interaction with tumor cells in clinical practice, which affects the research on the mechanism of lung cancer bone metastasis and the development of treatment strategies.
A Rosa26-based human SLC7A7 conditional overexpression mouse model was established by injecting fertilized eggs with Cas9 mRNA and gRNA to construct a KrasLSL-G12D/+; Tp53flox/flox; R26LSL-Slc7a7 mouse model. SLC7A7 overexpression, KRAS mutation, and Tp53 knockout were achieved in lung epithelial cells by intranasal delivery of Cre recombinase, inducing spontaneous lung cancer bone metastasis.
A stable animal model that can simulate the occurrence, development, and distant bone metastasis of lung cancer was successfully constructed, providing an efficient and reliable experimental tool for in-depth research on the mechanism of lung cancer bone metastasis and the development of therapeutic drugs, and has good clinical relevance.
Smart Images

Figure CN122038484A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to a method for constructing and applying a non-human animal model of lung cancer bone metastasis. Background Technology
[0002] Lung cancer is one of the deadliest malignant tumors worldwide, and bone is one of the most common sites of metastasis. Lung cancer bone metastases often lead to a series of serious complications, including bone pain, spinal cord compression, pathological fractures, hypercalcemia, and paralysis. These complications not only severely impact patients' quality of life but also accelerate disease progression and consume significant medical resources. Therefore, in-depth research into the pathogenesis of lung cancer bone metastases and the development of novel diagnostic biomarkers and effective therapeutic drugs have become critical scientific issues urgently needing to be addressed in the fields of medicine and pharmacy.
[0003] In lung cancer research, animal models are crucial tools for exploring pathogenesis and evaluating drug efficacy. However, existing models still have significant limitations in simulating bone metastasis in lung cancer. An ideal model should systematically reproduce the entire process of lung cancer occurrence, progression, invasion, and metastasis, and be suitable for evaluating the therapeutic effects of different drugs. Currently, genetically engineered mouse models (GEMMs) are widely used to simulate gene mutations in human lung cancer. For example, by introducing common mutated genes (such as Kras, p53, EGFR, etc.), some pathological features of NSCLC can be reproduced in mice. Although such models have achieved some success in simulating primary tumors, their incidence of spontaneous bone metastasis is extremely low, making it difficult to effectively simulate the key process of lung cancer metastasis to the bone.
[0004] Currently, commonly used lung cancer bone metastasis models are mostly established based on tumor cell transplantation techniques, mainly including: left ventricular injection of fluorescently labeled lung cancer cells or highly metastatic cell lines to induce multi-organ metastasis, with some cells colonizing in the bone microenvironment; direct intratibial injection of cancer cells to establish local bone metastasis; and local intravascular injection to construct bone metastasis models at specific sites. However, these methods all have significant drawbacks: left ventricular injection easily leads to multiple metastases in the brain, lungs, and adrenal glands, often causing mice to die from non-bone metastatic lesions; tibial injection causes mechanical damage, and the resulting lesions are mostly located in the bone shaft, which does not match the clinically common epiphyseal metastasis; while intravascular injection techniques are complex and have low reproducibility.
[0005] Although the aforementioned methods have made some progress in the study of bone metastases in breast and prostate cancer, an ideal model that can highly simulate spontaneous bone metastases in human lung cancer still exists. Existing models struggle to replicate the complex bone microenvironment and its interactions with tumor cells in clinical settings, severely hindering research into the mechanisms of lung cancer bone metastasis and the development of related treatment strategies.
[0006] Therefore, developing an animal model that can systematically simulate the primary progression and spontaneous bone metastasis of lung cancer and has high clinical relevance has become a key technical problem that urgently needs to be solved in this field. Summary of the Invention
[0007] The purpose of this invention is to address the shortcomings of existing technologies by providing a method for constructing and applying a non-human animal model of lung cancer bone metastasis.
[0008] To achieve the above objectives, the technical solution adopted by the present invention is as follows: The first aspect is to provide a method for constructing a non-human animal model of lung cancer bone metastasis, including the following steps: Step 1: Construction of a Rosa26-based human SLC7A7 conditional overexpression mouse model: (a) Cas9 mRNA and gRNA were obtained through in vitro transcription; (b) Construct a homologous recombination vector (donor vector) comprising a 5' homologous arm, an SLC7A7 gene expression cassette and a 3' homologous arm; wherein the SLC7A7 gene expression cassette is a silent expression cassette, and under induction conditions, the silent expression cassette is converted into an activated SLC7A7 gene expression cassette; (c) Cas9 mRNA, gRNA and the homologous recombination vector were injected into mouse zygotes in vitro to obtain injected zygotes; (d) Regenerating injected fertilized eggs into R26 cells with conditional overexpression of the SLC7A7 gene. LSL-slc7a7 homozygous mice; Step 2, Construction of a spontaneous lung cancer bone metastasis mouse model: (a) R26 LSL-slc7a7 homozygous mice and Kras LSL-G12D / + Tp53 flox / flox Mice were mated, and the resulting heterozygotes were subjected to multiple self-fertilizations. Genotyping was then performed using PCR amplification and DNA sequencing to obtain Kras. LSL-G12D / + ;TP53 flox / flox R26 LSL-Slc7a7 Mice, abbreviated as KPS mice; (b) Administer an effective dose of Cre recombinase to the lungs of the KPS mice.
[0009] Furthermore, the sequence of the gRNA is shown in SEQ ID NO:1.
[0010] Furthermore, the sequences of the first primer pair used to identify the SLC7A7 gene are shown in SEQ ID NO: 2 and SEQ ID NO: 3; the sequences of the second primer pair used to identify the SLC7A7 gene are shown in SEQ ID NO: 4 and SEQ ID NO: 5; the sequences of the primer pair used to identify the Tp53 gene are shown in SEQ ID NO: 6 and SEQ ID NO: 7; and the sequences of the primer pair used to identify the Kras gene are shown in SEQ ID NO: 8 and SEQ ID NO: 9.
[0011] Furthermore, the Cre recombinase is delivered via a viral vector carrying the Cre recombinase gene.
[0012] Furthermore, the viral vector is an adenovirus vector.
[0013] Furthermore, the delivery method is nasal inhalation.
[0014] Furthermore, in the non-human animal model, after delivery of Cre recombinase, SLC7A7 overexpression, KRAS mutation and Tp53 knockout were simultaneously initiated in lung epithelial cells, thereby spontaneously forming lung adenocarcinoma and further inducing tumor metastasis.
[0015] The second aspect is to provide the application of non-human animal models constructed using the above construction method in screening and / or developing drugs for treating bone metastases in lung cancer.
[0016] The present invention adopts the above technical solution and has the following technical effects compared with the prior art: This invention successfully constructed a genetically engineered animal model that can induce the synergistic manipulation of three genes. This model is the first to simultaneously initiate KRAS oncogene mutation, Tp53 tumor suppressor gene knockout, and SLC7A7 overexpression in lung epithelial cells. It can efficiently and stably simulate the entire process of lung adenocarcinoma occurrence, development, and distant bone metastasis. It provides a stable, reliable, and clinically relevant experimental tool for in-depth exploration of the pathogenic mechanism of lung cancer bone metastasis, discovery of novel diagnostic biomarkers, and development of highly effective anti-tumor drugs. Attached Figure Description
[0017] Figure 1 SLC7A7 overexpression accelerated Kras LSL-G12D / + TP53 flox / flox R26 LSL-Slc7a7Tumor development and bone metastasis in mice were studied. A shows representative axial μCT images of KP and KPS mice, with dashed lines indicating tumor lesions. B shows survival curves for KP mice (n=12) and KPS mice (n=38). Time series test results: P < 0.0001. Data are presented as mean ± standard deviation. C shows HE-stained images of the lungs in KP mice after induction of spontaneous lung cancer bone metastasis. D shows the cancellous bone volume fraction (BV / TV, %), trabecular bone number (Tb.N, 1 / mm), trabecular pattern factor (TB.Pf, 1 / mm), and trabecular bone mineral density (BMD, g / cm³) measured by μCT analysis in KP and KPS mice, with n=6 in each group. Detailed Implementation
[0018] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but this is not intended to limit the invention. It should be noted that, unless otherwise specified, the embodiments and features described in the embodiments of the present invention can be combined with each other.
[0019] Experimental methods in the following examples, unless otherwise specified, were performed under standard conditions or as recommended by the manufacturer. Unless otherwise stated, all reagents and materials used in the following examples were commercially available.
[0020] Example 1 This embodiment provides a method for constructing a Rosa26-mediated human SLC7A7 conditional overexpression mouse model, including the following steps: (a) Cas9 mRNA and gRNA were obtained by in vitro transcription; the sequence of the gRNA is shown in SEQ ID NO:1: GGGGACACACTAAGGGAGCTTGG; (b) Construct a homologous recombination vector (donor vector) comprising a 5' homologous arm, an SLC7A7 gene expression cassette and a 3' homologous arm; wherein the SLC7A7 gene expression cassette is a silent expression cassette, and under induction conditions, the silent expression cassette is converted into an activated SLC7A7 gene expression cassette; (c) Cas9 mRNA, gRNA and the homologous recombination vector were injected into mouse zygotes in vitro to obtain injected zygotes; (d) Regenerating injected fertilized eggs into R26 cells with conditional overexpression of the SLC7A7 gene. LSL-slc7a7 Homozygous mice, for subsequent use.
[0021] The more detailed construction methods and verification experiments are all described in the published patent CN117965538A, and will not be described in detail in this invention.
[0022] Example 2 This embodiment provides a method for constructing a mouse model of spontaneous lung cancer bone metastases: R26 LSL-slc7a7 homozygous mice and Kras LSL-G12D / + Tp53 flox / flox Mice were mated, and the resulting heterozygotes were subjected to multiple self-fertilizations. Genotyping was then performed using PCR amplification and DNA sequencing to obtain Kras. LSL-G12D / + ;TP53 flox / flox R26 LSL-Slc7a7 KPS mice, also known as mice with adenosine recombinase, are used in 8-10 week old KPS mice. Ad-Cre is inhaled via nasal drops. The adenovirus carrying the Cre gene specifically reaches the lungs of the mice and expresses Cre recombinase. After recognizing the Loxp site for cleavage, it enables the simultaneous initiation of SLC7A7 overexpression, KRAS mutation and Tp53 knockout in mouse lung epithelial cells, thereby accelerating the spontaneous lung adenocarcinoma process and further inducing lung cancer bone metastasis.
[0023] Among them, Kras LSL-G12D / + Tp53 flox / flox (KP mouse for short) Mice: Animal Center, East China Normal University.
[0024] (1) Kras LSL-G12D / + TP53 flox / flox R26 LSL-Slc7a7 Genotyping of mice: To obtain KPS genetically engineered mice for subsequent research, genotyping was performed on the offspring newborn mice (7-14 days after birth).
[0025] PCR amplification was performed on three key genes using specific primers: SLC7A7 gene knock-in: P1: TCAGATTCTTTTATAGGGGACACA (SEQ ID NO: 2); P2: TAAAGGCCACTCAATGCTCACTAA (SEQ ID NO: 3); P3: AGGCCTGCCCTTTTACTTCC (SEQ ID NO: 4); P4: CGAGAGGGGAAAGACCCTA (SEQ ID NO: 5).
[0026] Tp53 flox allele: F: CACAAAAACAGGTTAAACCCAG (SEQ ID NO: 6); R: AGCACATAGGAGGCAGAGAC (SEQ ID NO: 7).
[0027] Kras mutation: F: CTAGCCACCATGGCTTGAGT (SEQ ID NO: 8); R: TCCGAATTCAGTGACTACAGATG (SEQ ID NO: 9).
[0028] The genotype interpretation criteria are as follows: Wild-type mice amplified a 967bp band only using primer pairs (P1, P2), while no amplification product was found using (P3, P4); heterozygous mice amplified a 967bp band using (P1, P2) and a 355bp band using (P3, P4); homozygous mice showed no amplification band at (P1, P2), but a 355bp band was amplified at (P3, P4). The results showed that, compared to wild-type mice, the 355bp band corresponding to the SLC7A7 gene knock-in was detectable in KPS mice; Kras G12D The band size of the mutated gene is 370 bp; the band size of the flox insertion site in the Tp53 gene is also 370 bp.
[0029] (2) Kras LSL-G12D / + TP53 flox / flox R26 LSL-Slc7a7 Mice become a new model animal for lung cancer bone metastasis Eight to ten-week-old KPS mice were inoculated with Ad-Cre adenovirus via intranasal drip. This virus specifically infects lung tissue and expresses Cre recombinase, mediating gene recombination by recognizing the loxP site, thereby simultaneously achieving SLC7A7 overexpression, KRAS mutation, and Tp53 gene knockout in lung epithelial cells. Tumor development was monitored using micro-CT, and the results showed that, compared to KP mice, KPS mice developed significant lung tumors 4-5 weeks after infection. Figure 1 A), and H&E staining confirmed the formation of a lung tumor (A), Figure 1 C). Survival analysis showed that the median survival of KPS mice was significantly shorter than that of KP mice by approximately 1-2 months. Figure 1 B). Micro-CT examination of the bones of the deceased mice revealed significant bone destruction in the KPS mice. Figure 1 D), indicating that the lung cancer cells have metastasized to the bone.
[0030] In summary, these results confirm that SLC7A7 knock-in can significantly accelerate the process of lung cancer bone metastasis in KP mice, thus successfully constructing a novel mouse model of lung cancer bone metastasis.
[0031] The above description is merely a preferred embodiment of the present invention and does not limit the implementation and protection scope of the present invention. Those skilled in the art should realize that any equivalent substitutions and obvious changes made based on the content and illustrations of the present invention should be included within the protection scope of the present invention.
Claims
1. A method for constructing a non-human animal model of lung cancer bone metastasis, characterized in that, Includes the following steps: Step 1: Construction of a Rosa26-based human SLC7A7 conditional overexpression mouse model: (a) Cas9 mRNA and gRNA were obtained through in vitro transcription; (b) Construct a homologous recombination vector (donor vector) comprising a 5' homologous arm, an SLC7A7 gene expression cassette and a 3' homologous arm; wherein the SLC7A7 gene expression cassette is a silent expression cassette, and under induction conditions, the silent expression cassette is converted into an activated SLC7A7 gene expression cassette; (c) Cas9 mRNA, gRNA and the homologous recombination vector were injected into mouse zygotes in vitro to obtain injected zygotes; (d) Regenerating injected fertilized eggs into R26 cells with conditional overexpression of the SLC7A7 gene. LSL-slc7a7 homozygous mice; Step 2, Construction of a spontaneous lung cancer bone metastasis mouse model: (a) R26 LSL-slc7a7 homozygous mice and Kras LSL-G12D / + Tp53 flox / flox Mice were mated, and the resulting heterozygotes were subjected to multiple self-fertilizations. Genotyping was then performed using PCR amplification and DNA sequencing to obtain Kras. LSL-G12D / + ;TP53 flox / flox R26 LSL-Slc7a7 Mice, abbreviated as KPS mice; (b) Administer an effective dose of Cre recombinase to the lungs of the KPS mice.
2. The construction method according to claim 1, characterized in that, The sequence of the gRNA is shown in SEQ ID NO:
1.
3. The construction method according to claim 1, characterized in that, The sequences of the first primer pair used to identify the SLC7A7 gene are shown in SEQ ID NO: 2 and SEQ ID NO: 3; the sequences of the second primer pair used to identify the SLC7A7 gene are shown in SEQ ID NO: 4 and SEQ ID NO: 5; the sequences of the primer pair used to identify the Tp53 gene are shown in SEQ ID NO: 6 and SEQ ID NO: 7; and the sequences of the primer pair used to identify the Kras gene are shown in SEQ ID NO: 8 and SEQ ID NO:
9.
4. The construction method according to claim 1, characterized in that, The Cre recombinase is delivered via a viral vector carrying the Cre recombinase gene.
5. The construction method according to claim 4, characterized in that, The viral vector is an adenovirus vector.
6. The construction method according to claim 4, characterized in that, The delivery method is nasal inhalation.
7. The construction method according to claim 1, characterized in that, In the non-human animal model, after delivery of Cre recombinase, SLC7A7 overexpression, KRAS mutation and Tp53 knockout were simultaneously initiated in lung epithelial cells, thereby spontaneously forming lung adenocarcinoma and further inducing tumor metastasis.
8. The use of a non-human animal model constructed by the construction method according to any one of claims 1-7 in screening and / or developing drugs for treating bone metastases of lung cancer.