Compounds and methods for reducing TUBB4A expression

Abstract

Provided herein are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of TUBB4A RNA and, in some cases, the amount of TUBB4A protein in a cell or subject. Such compounds, methods, and pharmaceutical compositions are useful for ameliorating at least one symptom of a disease or condition associated with TUBB4A. Such symptoms and markers include hypomyelination, demyelination, dysphonia, myodynia, ataxia, spasm, cerebellar and / or basilar joint atrophy, hypopsia, stiffness, microcephalic deformity, focal cortical dysplasia, seizures, and kindergarten death.

Description

[0001] sequence list This application is submitted together with the electronic sequence listing. The sequence listing is provided as a file named BIOL0475SEQ.xml, created on August 1, 2024, and is 30 KB in size. The information of the electronic sequence listing is incorporated herein by reference in its entirety. Technical Field

[0002] This disclosure provides compounds, methods, and pharmaceutical compositions for reducing the amount or activity of TUBB4A RNA in cells or subjects and, in some cases, reducing the amount of TUBB4A protein in cells or subjects. Certain of these compounds, methods, and pharmaceutical compositions can be used to prevent, treat, and / or improve at least one symptom of TUBB4A-related neurodegenerative diseases or conditions, such as TUBB4A-associated leukodystrophy and type 4 dystonia (DYT4). Such symptoms include hypomyelination, demyelination, dysarthria, dystonia, ataxia, spasticity, cerebellar and / or basal ganglia atrophy, visual impairment, rigidity, microcephaly, focal cortical dysplasia, seizures, and early childhood death. These neurodegenerative diseases and conditions include TUBB4A-associated leukodystrophy, such as TUBB4A-leukodystrophy with infancy, isolated hypomyelination with spastic quadriplegia, and hypomyelination with basal ganglia and cerebellar atrophy (H-ABC). Background Technology

[0003] The TUBB4A gene encodes tubulin βIVA (Tubb4A), a protein that, together with α-tubulin, forms a heterodimeric subunit that assembles into microtubules. Tubb4A protein is primarily found in neurons and oligodendrocytes, with the highest expression levels observed in mature myelin-forming oligodendrocytes. Mutations in the TUBB4A gene are associated with the development of TUBB4A-associated leukodystrophy, which encompasses a range of neurological disorders involving decreased myelination and, in some cases, demyelination. Individuals affected by TUBB4A-associated leukodystrophy exhibit varying degrees of severity and combinations of signs and symptoms. Symptoms of TUBB4A-associated leukodystrophy include, for example, decreased myelination, demyelination, dysarthria, dystonia, ataxia, spasticity, cerebellar and / or basal ganglia atrophy, visual impairment, rigidity, microcephaly, focal cortical dysplasia, seizures, and early childhood death.

[0004] Neurological disorders associated with TUBB4A include, but are not limited to, the following: TUBB4A-leukodystrophy with onset in infancy, isolated hypomyelination with spastic quadriplegia, and hypomyelination with basal ganglia and cerebellar atrophy (H-ABC). Isolated hypomyelination with spastic quadriplegia begins in late childhood to early adulthood and symptoms include mild hypomyelination, slowly progressive ataxia and spasticity, variable cerebellar atrophy, motor problems, dysarthria, and learning difficulties (Pizzino A. et al., Neurology. Sep 2014; 83(10):898-902). H-ABC begins in infancy or early childhood and is a more severe form of TUBB4A-associated leukodystrophy. H-ABC symptoms include hypomyelination, cerebellar and basal ganglia atrophy, delayed motor skills development, dystonia, uncontrolled limb movements (choreoathetosis), rigidity, dysphonia, dysphagia, opisthotonus, ataxia, and seizures (Simons C. et al., Am. J. Hum. Genet., May 2013; 92:767-773; Sase S. et al., eLife, 2020; 9:e52986; van der Knaap, MS et al., Neurology, 2007; 69(2):166-171; Joyal K. et al., J. Neuropath. Exp. Neruol., January 2019; 78(1): 3-9). TUBB4A-leukodystrophy with onset in infancy includes symptoms such as poor vision, lack of motor development, progressive spasticity, rigidity, dystonia, uncontrolled seizures, microcephaly, focal cortical dysplasia, cognitive function superior to motor function, and early childhood death.

[0005] Mutations in the TUBB4A gene are also associated with type 4 dystonia (DYT4). DYT4 first occurs in adulthood and is caused by heterozygous mutations in the TUBB4A gene. Symptoms of DYT4 include whispering dysarthria (progressive laryngeal dysarthria), dystonia, and gait ataxia (Hersheson, J., et al., Ann. Neurol., 2013; 73:546-553; Parker, N., J. Neurol. Neurosurg. Psychiat., 1985; 48: 218-224).

[0006] Currently, there are no acceptable options for treating TUBB4A-related neurodegenerative diseases and conditions, such as TUBB4A-associated leukodystrophy (e.g., H-ABC, infancy-onset TUBB4A-leukodystrophy, and solitary hypomyelination with spastic quadriplegia) and DYT4. Therefore, therapies targeting TUBB4A-related diseases and conditions remain in need. TUBB4A-targeting therapeutics could provide a new class of compounds for the effective management of TUBB4A-associated leukodystrophy and / or DYT4. Therefore, the purpose of this article is to provide compounds, methods, and pharmaceutical compositions for the treatment of such diseases and conditions. Summary of the Invention

[0007] This document provides compounds, methods, and compositions for reducing the amount or activity of TUBB4A RNA in cells or subjects and, in some embodiments, for reducing the amount of TUBB4A protein in cells or subjects. In some embodiments, the subject has or is at risk of developing a TUBB4A-related neurodegenerative disease or condition. In some embodiments, the subject has TUBB4A-associated leukodystrophy. In some embodiments, the compound that can be used to reduce TUBB4A RNA expression is an oligomeric compound. In some embodiments, the compound that can be used to reduce TUBB4A RNA expression is a modified oligonucleotide.

[0008] This disclosure also provides methods for improving at least one symptom of a neurodegenerative disease or condition. In some embodiments, the neurodegenerative disease or condition is a TUBB4A-related disease or condition, such as DYT4 and TUBB4A-associated leukodystrophy (e.g., H-ABC, isolated hypomyelination with spastic quadriplegia, and TUBB4A-leukodystrophy with infancy). In some embodiments, the subject has TUBB4A-associated leukodystrophy or type 4 dystonia (DYT4). In some embodiments, symptoms include hypomyelination, demyelination, dysarthria, dystonia, ataxia, spasticity, cerebellar and / or basal ganglia atrophy, visual impairment, rigidity, microcephaly, focal cortical dysplasia, seizures, and early childhood death. Detailed Implementation

[0009] It should be understood that the foregoing general description and the following detailed description are exemplary and illustrative only, and not restrictive. In this document, unless otherwise specified, the use of the singular includes the plural. As used herein, unless otherwise specified, the use of “or” means “and / or”. Furthermore, the use of the term “including” and other forms such as “includes” and “included” is not restrictive. Moreover, unless otherwise specified, terms such as “element” or “component” cover both elements and components that comprise a single unit and elements and components that comprise more than one subunit.

[0010] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents or portions thereof cited in this application, including but not limited to patents, patent applications, articles, books, and papers, are hereby expressly incorporated herein by reference in whole or in part.

[0011] definition Unless specifically defined, the nomenclature, procedures, and techniques used in relation to analytical chemistry, synthetic organic chemistry, and pharmaceutical and medicinal chemistry as described herein are those well-known and commonly used in the art. Where permitted, all patents, applications, published applications, and other publications, as well as other data, mentioned throughout this disclosure are incorporated herein by reference in their entirety.

[0012] Unless otherwise stated, the following terms have the following meanings: As used herein, “2’-deoxynucleoside” means a nucleoside containing a 2’-deoxyfuranosyl sugar moiety. Unless otherwise stated, a 2’-deoxynucleoside is a 2’-β-D-deoxynucleoside and contains a 2’-β-D-deoxyribosyl sugar moiety in the stereochemical configuration of β-D ribosyl found in naturally occurring deoxyribonucleic acid (DNA). 2’-deoxynucleoside may contain modified nucleotides or may contain RNA nucleotides (uracil).

[0013] As used herein, “2’-deoxyglycan moiety” means the 2’-H(H)deoxyfuranosyl glycan moiety. Unless otherwise stated, the 2’-deoxyglycan moiety is the 2’-β-D-deoxyribosyl glycan moiety having the β-D-ribosyl stereochemistry found in naturally occurring deoxyribonucleic acid (DNA).

[0014] As used herein, “2’-MOE” refers to the OCH2CH2OCH3 group that replaces the 2’-OH group of the furanyl sugar moiety. “2’-MOE sugar moiety” refers to a sugar moiety having an OCH2CH2OCH3 group that replaces the 2’-OH group of the furanyl sugar moiety. Unless otherwise stated, the 2’-MOE sugar moiety is β-D-ribosyl. “MOE” means O-methoxyethyl.

[0015] As used in this article, “2'-MOE nucleoside” or “2'-OCH2CH2OCH3 nucleoside” or “ribose 2'-MOE” means a nucleoside containing the 2'-MOE sugar moiety (or the 2'-OCH2CH2OCH3 ribosyl sugar moiety).

[0016] As used herein, “2’-OMe” or “2’-O-methyl” refers to a 2’-OCH3 group that replaces the 2’-OH group of the furanyl sugar moiety. “2’-O-methyl sugar moiety” or “2’-O-methyl sugar moiety” refers to a sugar moiety having a 2’-OCH3 group that replaces the 2’-OH group of the furanyl sugar moiety. Unless otherwise stated, 2’-OMe is in the β-D ribosyl stereochemistry configuration.

[0017] As used in this article, "2'-OMe nucleoside" refers to a nucleoside containing the 2'-OMe sugar moiety.

[0018] As used herein, “2’-F” refers to a 2’-fluorine group that replaces the 2’-OH group of the furanyl sugar moiety. “2’-F sugar moiety” refers to a sugar moiety having a 2’-F group that replaces the 2’-OH group of the furanyl sugar moiety. Unless otherwise stated, the 2’-F sugar moiety is β-D-ribosyl.

[0019] As used in this article, "2'-F nucleoside" refers to a nucleoside containing the 2'-F sugar moiety.

[0020] As used herein, “2’-NMA” refers to the 2’-OCH2C(=O)-N(H)CH3 group that replaces the 2’-OH group of the furanose saccharide moiety. “2’-NMA sugar moiety” refers to the sugar moiety having the 2’-OCH2C(=O)-N(H)CH3 group that replaces the 2’-OH group of the furanose saccharide moiety.

[0021] As used in this article, "2'-NMA nucleoside" refers to a nucleoside containing the 2'-NMA sugar moiety.

[0022] As used herein, “2’-substituted nucleoside” means a modified nucleoside that contains a 2’-substituted furanyl sugar moiety.

[0023] As used herein, “2’-substituted sugar moiety” means a furanyl sugar moiety wherein at least one 2’-substituent group is not H or OH. 2’-substituted sugar moiety includes bicyclic sugar moiety wherein a second ring is bonded to a furanyl ring at the 2’-position. 2’-substituted sugar moiety includes, but is not limited to, 2’-OMe sugar moiety, 2’-MOE sugar moiety, 2’-F sugar moiety, 2’-NMA sugar moiety, cEt sugar moiety, and LNA sugar moiety.

[0024] As used in this article, "termination site" refers to the 3' nucleotide of the target nucleic acid that is complementary to the oligonucleotide when the oligonucleotide hybridizes with the target nucleic acid.

[0025] As used in this article, "start site" refers to the 5' nucleotide of the target nucleic acid that is complementary to the oligonucleotide when the oligonucleotide hybridizes with the target nucleic acid.

[0026] As used herein, "5-methylcytosine" refers to cytosine modified with a methyl group attached at the 5-position. 5-methylcytosine is a modified nucleobase.

[0027] As used in this article, “administration” means to administer a drug to a subject.

[0028] As used herein, “improvement” in relation to symptoms of a relevant disease, symptom, or condition means an improvement or reduction in at least one symptom of that relevant disease, symptom, or condition. As used herein, “disease” includes symptom, condition, and injury. Improvement may be a reduction in the severity or frequency of symptoms, a delay in the onset of symptoms, or a slowing of the progression of the severity or frequency of symptoms. The progression, frequency, or severity of symptoms can be determined by subjective or objective measures known in the art and / or described herein.

[0029] As used herein, “antisense activity” means any detectable and / or measurable change attributable to (whether direct and / or indirect) hybridization of an antisense oligonucleotide with its target nucleic acid. In this context, antisense activity is the reduction in the amount or expression of the target nucleic acid or the protein encoded by that target nucleic acid compared to the levels of the target nucleic acid and / or target protein in the absence of an antisense compound. For example, when the compound… in vitro When the amount or activity of the target nucleic acid is altered by 25% or more during the assay, it exhibits antisense activity, or for example, when the compound... in vivo Antisense activity is indicated when the amount or activity of the target nucleic acid is altered by 25% or more during assay. Antisense activity can be assessed in standard assays.

[0030] As used herein, “antisense agent” means an oligomeric compound that contains an antisense oligonucleotide and optionally one or more additional features, such as a sense compound.

[0031] As used herein, “antisense compound” means antisense oligonucleotide and optionally one or more additional features, such as conjugation groups.

[0032] As used herein, “antisense oligonucleotide” means an oligonucleotide having at least one region (“target region”) that is complementary to the target nucleic acid and capable of antisense activity. An antisense oligonucleotide may pair with a second oligonucleotide (“sense oligonucleotide”) that is complementary to it (e.g., to form an oligomeric duplex), or it may be an unpaired antisense oligonucleotide (in this context, a single-stranded antisense oligonucleotide). Antisense oligonucleotides include, but are not limited to, antisense RNAi oligonucleotides and antisense RNase H oligonucleotides.

[0033] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" means a modified sugar moiety comprising a furanyl sugar moiety and a second ring, wherein the second ring is formed via a bridge connecting two non-twinned atoms in the first ring, thereby forming a bicyclic structure. In some embodiments, the bicyclic sugar moiety does not contain a furanyl sugar moiety. Examples of bicyclic sugar moieties include locked nucleic acid (LNA) sugar moieties and restricted ethyl (cEt) sugar moieties as defined herein.

[0034] As used in this article, "bicyclic nucleoside" or "BNA" refers to a nucleoside that contains a bicyclic sugar moiety.

[0035] As used herein, “flat” or “flat-ended” in the context of oligoduplexes means the absence of unpaired nucleotides at the ends (i.e., no protruding nucleotides). One or both ends of an oligoduplex may be flat.

[0036] As used herein, "cell-targeting portion" means a conjugate portion or part of a conjugate portion that can bind to or interact with a specific cell type or multiple specific cell types. For example, a cell-targeting portion may bind to a surface portion, such as a surface receptor on a specific cell type.

[0037] As used herein, “cerebrospinal fluid” or “CSF” refers to the fluid that fills the space surrounding the brain and spinal cord. “Artificial cerebrospinal fluid” or “aCSF” refers to a fluid that has certain properties similar to cerebrospinal fluid (e.g., osmotic pressure, pH, and / or electrolytes) and is biocompatible with CSF.

[0038] As used in this article, “chiral controlled” in relation to nucleoside bonds means that the chirality at that bond is enriched due to a specific stereochemical configuration.

[0039] As used herein, "chiral enriched" in the context of a group means a plurality of molecules having the same molecular formula, wherein if a particular chiral center is stereorandom as defined herein, the number or percentage of molecules within the group containing a particular stereochemical configuration at that particular chiral center is greater than the number or percentage of molecules within the group expected to contain the same particular stereochemical configuration at the same particular chiral center. A group of chiral enriched molecules, each containing multiple chiral centers, may contain one or more stereorandom chiral centers. In some embodiments, the molecule is a modified oligonucleotide. In some embodiments, the molecule is an oligomeric compound comprising a modified oligonucleotide. In some embodiments, the chiral center is located at the phosphorus atom of the thiophosphate nucleoside internucleotide bond. In some embodiments, the chiral center is located at the phosphorus atom of the methanesulfonyl phosphate nucleoside internucleotide bond.

[0040] As used herein, "cleavable moiety" means a bond or group of atoms that contains at least one bond that would be cleaved under physiological conditions, such as within a cell or subject. For example, a cleavable moiety may be cleaved within a cell or subcellular compartment, such as an endosome or lysosome. A cleavable moiety may be cleaved by endogenous enzymes, such as nucleases.

[0041] As used herein, “complementarity” with respect to a first-linked nucleoside chain (e.g., an oligonucleotide or nucleic acid) and a second-linked nucleoside chain means that, when the nucleobase sequences of the first-linked and second-linked nucleoside chains are compared, the nucleobases of the first-linked and second-linked nucleoside chains are complementary. The complementary first-linked and second-linked nucleoside chains can be, for example, regions of a single nucleic acid molecule (double-stranded regions belonging to self-complementary regions) or regions of separated nucleic acids (oligoduplexes). One or both of the first-linked and second-linked nucleoside chains are, for example, oligonucleotides or regions thereof, or cellular target nucleic acids or regions thereof. Each pair of nucleosides in a complementary pair of first-linked and second-linked nucleoside chains does not require complementarity for the two chains to be “complementary.” Instead, some mismatches are tolerable. Where complementarity is expressed as a percentage, the percentage represents the percentage of nucleobases in the identified first chain that are complementary to nucleobases in a region of equal length in the second chain. Unless otherwise specified, “complementarity” is assumed to be at least 70%. Complementary strands can be 75%, 80%, 85%, 90%, 95%, or 100% complementary. For example, if an oligonucleotide composed of 20 nucleosides is 80% complementary to a nucleic acid, then there are 16 complementary nucleobase pairs and 4 mismatches. If an oligonucleotide composed of 20 nucleosides is at least 80% complementary to a nucleic acid, then there are 16, 17, 18, 19, or 20 complementary nucleobase pairs and 0 to 4 mismatches. As used herein, “completely complementary” or “100% complementary” means that if the two nucleoside chains are of the same length, the nucleobase sequences of the first and second chains of the connecting nucleosides have complementary nucleobases at each nucleoside of the shorter of the two nucleoside chains, or at each nucleoside.

[0042] As used herein, “complementary nucleobase” means a nucleobase that forms a hydrogen bond with each other when two linked nucleoside chains (e.g., an oligonucleotide and a target nucleic acid; or two oligonucleotides) are aligned. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (mC) and guanine (G). Certain modified nucleobases that pair with unmodified nucleobases or with other modified nucleobases are known in the art. For example, hypoxanthine (the nucleobase of nucleoside inosine (I)) can pair with adenine, cytosine, or uracil. In this document, hypoxanthine is considered to be a nucleobase complementary to thymine (T), adenine (A), uracil (U), and cytosine (C).

[0043] As used herein, a “complementary region” of a first-linked nucleoside chain (e.g., an oligonucleotide or nucleic acid) is a range of nucleobases in the first-linked nucleoside chain that is complementary to the nucleoside chain in the second-linked nucleoside chain. A “complementary region” may include mismatches, but the terminal nucleobases of the “complementary region” of the first-linked nucleoside chain are complementary to the nucleoside chain in the second-linked nucleoside chain. A “targeting region” of an oligonucleotide is a complementary region whose nucleobase sequence is complementary to the target nucleobase sequence of a target nucleic acid. A “double-stranded region” is a complementary region of an oligonucleotide having a nucleobase sequence complementary to the nucleobase sequence of a second oligonucleotide. A complementary region may be only a portion of the first and / or second-linked nucleoside chains, or it may constitute the entire first and / or second chains.

[0044] As used herein, a "conjugation group" means a group of atoms directly or indirectly attached to an oligonucleotide that imparts at least one property to the resulting conjugated oligonucleotide. A conjugation group comprises a conjugation moiety and a conjugation linker to the oligonucleotide.

[0045] As used herein, “conjugate linker” means a single bond or a group of atoms containing at least one bond that links the conjugate portion to the oligonucleotide.

[0046] As used herein, “conjugated moiety” means a group of atoms that, when covalently bound to a molecule, alters one or more properties of that molecule compared to the same molecule lacking a conjugated moiety. Such properties include, but are not limited to, pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.

[0047] As used herein, “restricted ethyl” or “cEt” or “cEt sugar moiety” refers to the β-D ribosyl bicyclic sugar moiety, wherein the second ring of the bicyclic sugar is formed via a bridge connecting the 4'-carbon and 2'-carbon of the β-D ribosyl sugar moiety, wherein the bridge has the formula 4'-CH(CH3)-O-2', and wherein the methyl group of the bridge is... S Configuration.

[0048] As used in this article, "cEt nucleoside" refers to a nucleoside that contains the cEt sugar moiety.

[0049] As used herein, “continuous” in the context of oligonucleotides refers to nucleosides, nucleobases, sugar moieties, or internucleotide bonds that are adjacent to each other. For example, “continuous nucleobases” means nucleobases that are adjacent to each other in the sequence.

[0050] As used herein, a "deoxyregion" refers to a region of 5 to 12 consecutive nucleotides in which at least 70% of the nucleotides contain the β-D-2'-deoxyribosyl sugar moiety. Each nucleotide in the deoxyregion is selected from 2'-β-D-deoxynucleotides, bicyclic nucleotides, and 2'-substituted nucleotides. The deoxyregion supports RNase H activity. The deoxyregion is the interstitial or internal region of a spacer.

[0051] As used herein, "DNA nucleoside" refers to a nucleoside that contains the unmodified sugar portion of DNA. DNA nucleosides may contain modified or unmodified nucleobases. DNA nucleosides may contain uracil nucleobases or modified nucleobases, or they may be debased nucleosides.

[0052] As used in this article, "DNA sugar portion" refers to the unmodified DNA sugar portion.

[0053] As used herein, "double-stranded" refers to a linking nucleoside chain (e.g., an oligonucleotide) or a region thereof that pairs with a complementary linking nucleoside chain or a region thereof. In some embodiments, the linking nucleoside chain and the complementary linking nucleoside chain are separate molecules. In some embodiments, the double-stranded region is formed by a first and second region of a single molecule (e.g., a hairpin structure).

[0054] As used herein, "double strand" or "double-stranded region" refers to a structure formed by the hybridization of complementary base pairs between two linked nucleoside chains or regions thereof (e.g., two separate oligonucleotides or an oligonucleotide and a target nucleic acid). For clarity, "hairpin oligonucleotide" in this document refers to a single linked nucleoside chain containing a double-stranded region and is not considered a double strand.

[0055] As used herein, "spacer" means a modified oligonucleotide comprising an inner region located between an outer region containing one or more nucleotides, wherein the nucleotides comprising the inner region are chemically different from the one or more nucleotides comprising the outer region, and wherein the modified oligonucleotide supports RNase H cleavage. The inner region may be referred to as a "gap," and the outer region may be referred to as a "wing." In some embodiments, the inner region is a deoxygenated region. The location of the inner region or gap refers to the sequence of the nucleotides in the inner region, and is counted starting from the 5' end of the inner region. Unless otherwise stated, "spacer" refers to a glycosylation motif. In some embodiments, each nucleotide in the gap is a 2'-β-D-deoxynucleotide. As used herein, the term "MOE spacer" refers to a spacer having a gap containing a 2'-β-D-deoxynucleotide and wings containing a 2'-MOE nucleotide. Unless otherwise stated, a spacer may comprise one or more modified internucleotide bonds and / or modified nucleobases, and such modifications do not necessarily follow the pattern of glycosylated spacers.

[0056] As used herein, “hybridization” means the process by which complementary regions of two linked nucleoside chains (e.g., oligonucleotides and / or nucleic acids) anneal together to form a double helix or double-stranded region. While not limited to a specific mechanism, the most common hybridization mechanisms involve hydrogen bonds between complementary nucleobases, which can be Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonds.

[0057] As used herein, “nucleoside bond” refers to a covalent bond between adjacent nucleosides in an oligonucleotide. As used herein, “unmodified nucleoside bond” refers to a phosphodiester nucleoside bond. As used herein, “modified nucleoside bond” refers to any nucleoside bond other than a phosphodiester nucleoside bond. “Thiophosphate nucleoside bond” is a modified nucleoside bond in which one of the non-bridging oxygen atoms of the phosphodiester nucleoside bond is replaced by a sulfur atom. “Methanesulfonylaminophosphate nucleoside bond” is a modified nucleoside bond in which one of the non-bridging oxygen atoms of the phosphodiester nucleoside bond is replaced by NS(=O)2CH3. Unless otherwise stated, and in the context of each linked nucleoside containing a furanylose moiety, the nucleoside bond binds the 3'-carbon of one furanylose moiety and the 5'-carbon of the other furanylose moiety.

[0058] As used in this article, “inverted nucleoside” means a nucleoside having 3' to 3' and / or 5' to 5' nucleosides interposed with the remainder of the oligonucleotide.

[0059] As used herein, “inverted sugar moiety” means a furanose sugar moiety having 3’ to 3’ and / or 5’ to 5’ nucleotide internucleotide bonds with the remainder of the oligonucleotide.

[0060] As used in this article, “linked nucleosides” refers to nucleosides linked by a continuous sequence (i.e., there are no additional nucleosides between those linked nucleosides).

[0061] As used herein, "linker nucleoside" refers to a nucleoside that directly or indirectly links an oligonucleotide to the conjugate moiety. Linker nucleosides reside within the conjugate linker of the oligomer. Linker nucleosides are not considered part of the oligonucleotide moiety of the oligomer, even if they are contiguous with the oligonucleotide.

[0062] As used herein, “mismatch” means that the nucleobase of the first linked nucleoside chain or its region (e.g., oligonucleotide, nucleic acid) is not complementary to the corresponding nucleobase of the second linked nucleoside chain or its region when the first and second nucleic acid chains are aligned.

[0063] As used in this article, "motif" refers to the pattern of unmodified and / or modified sugar moieties, nucleobases, and / or nucleoside bonds in an oligonucleotide.

[0064] As used herein, "modified sugar moiety" refers to the atomic group other than the unmodified sugar moiety, which forms the nucleoside corresponding to the β-D-ribosyl sugar in RNA or the β-D-deoxyribosyl sugar in DNA. Modified sugar moieties are selected from modified furanosyl sugar moieties, modified deoxyfuranosyl sugar moieties, cyclic sugar substitutes, bicyclic sugar substitutes, acyclic sugar substitutes, or sugar mimics.

[0065] As used herein, “non-bicyclic modified sugar moiety” means a modified furanyl sugar moiety that contains modifications, such as substituents, that do not form a bridge between two sugar atoms to form a second ring.

[0066] As used in this article, "nucleobase" means an unmodified nucleobase or a modified nucleobase.

[0067] As used herein, “nucleobase sequence” refers to the sequence of consecutive nucleobases in a linked nucleoside chain or its region, regardless of any modification of sugar or nucleoside bonds.

[0068] As used herein, the “nucleobase sequence” of reference to SEQ ID NO refers only to the nucleobase sequence provided in SEQ ID NO, and therefore, unless otherwise stated, includes compounds in which each nucleobase, each sugar moiety and each nucleoside bond may be independently modified or unmodified, regardless of whether the modifications shown in the referenced SEQ ID NO are present.

[0069] As used in this article, "nucleoside" means "unmodified nucleoside" or "modified nucleoside".

[0070] As used in this article, "unmodified nucleoside" means a compound or subunit that contains an unmodified sugar moiety and an unmodified nucleobase.

[0071] As used herein, “modified nucleoside” means a compound or subunit comprising a sugar moiety and optionally a nucleobase, wherein the sugar moiety is modified and / or the nucleobase is modified or absent.

[0072] As used herein, “nucleoside analogue” means a compound or subunit that contains a sugar analogue and an optional nucleobase.

[0073] As used in this article, "nucleoside overhang" or "overhang" refers to an unpaired nucleoside at either end or both ends of an oligomeric duplex.

[0074] As used herein, “oligomer” means a compound or complex comprising or consisting of at least one modified oligonucleotide and optionally one or more additional features selected from: (a) one or more additional modified or unmodified oligonucleotides, each of which can hybridize or covalently link with and / or hybridize or covalently link with each other; and (b) one or more conjugation groups that can be directly or indirectly covalently attached to any oligonucleotide of such oligomer; and (c) one or more terminal groups. In this document, in the case of describing two oligonucleotides covalently linked to each other, such attachment is not through a direct nucleotide-to-nucleotide bond. Therefore, a single unbranched oligonucleotide comprising only a direct nucleotide-to-nucleotide bond cannot be described as two separate covalently linked oligonucleotides.

[0075] As used herein, “oligonucleotide” means a chain of nucleosides linked by nucleotide bonds, wherein each nucleoside and nucleotide bond may be modified or unmodified. Unless otherwise stated, an oligonucleotide consists of 10–80 linked nucleosides. Unless otherwise stated, when present, no more than 10% of the nucleosides in an oligonucleotide are debased nucleosides. As used herein, “modified oligonucleotide” means an oligonucleotide in which at least one nucleoside and / or nucleotide bond is modified. As used herein, “unmodified oligonucleotide” means an oligonucleotide consisting of unmodified nucleosides linked by phosphodiester nucleotide bonds. An oligonucleotide may pair with a second oligonucleotide complementary to it to form an oligomeric duplex, or it may be unpaired.

[0076] As used herein, “pharmaceutically acceptable diluent” means an ingredient in a pharmaceutical composition suitable for administration to a subject. Typically, a “diluent” lacks pharmacological activity but is necessary or desirable in the preparation of the pharmaceutical composition. For example, a diluent in an injectable composition may be a liquid, such as phosphate-buffered saline (PBS), water, or an aqueous saline solution. Certain carriers or diluents enable pharmaceutical compositions to be formulated, for example, into tablets, pills, sugar-coated pills, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. Pharmaceutically acceptable carriers or diluents may be sterile water, sterile saline, sterile buffer solutions, or sterile artificial cerebrospinal fluid.

[0077] As used herein, "pharmaceutically acceptable salt" means a compound that is physiologically and pharmaceutically acceptable. Pharmacologically acceptable salts retain the desired biological activity of the parent compound without conferring undesirable toxicological effects.

[0078] As used herein, "prodrug" refers to a therapeutic agent that exists in its first form in vitro but is converted to its second form within a subject or its cells. Typically, the conversion of a prodrug within a subject is facilitated by the action of enzymes (e.g., endogenous or viral enzymes) or chemicals present in cells or tissues and / or by physiological conditions. The first form of a prodrug may be less active than the second form.

[0079] As used herein, "pharmaceutical composition" means a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution. A pharmaceutical composition may exhibit activity in a free-uptake assay in certain cell lines.

[0080] As used in this article, "group" refers to multiple molecules that have the same molecular formula.

[0081] As used herein, unless otherwise stated, “RNA” means RNA transcript and includes both precursor mRNA and mature mRNA.

[0082] As used herein, “RNAi agent” means an antisense agent that acts at least partially through RISC or Ago2 to regulate a target nucleic acid and / or the protein encoded by the target nucleic acid. RNAi agents include, but are not limited to, double-stranded siRNA, single-stranded RNAi (ssRNAi), and microRNA, including microRNA mimics. RNAi agents may contain conjugation groups and / or terminal groups. RNAi agents regulate the amount and / or activity of the target nucleic acid. The term RNAi agent does not include antisense agents that act primarily through RNase H.

[0083] As used herein, "RNase H agent" means an antisense agent that functions at least partially via RNase H to regulate a target nucleic acid and / or the protein encoded by the target nucleic acid. RNase H agents may be single-stranded or double-stranded. RNase H agents may contain conjugation groups and / or terminal groups. RNase H agents regulate the amount and / or activity of the target nucleic acid. The term RNase H agent does not include antisense agents that function primarily via RISC / Ago2.

[0084] As used herein, “sense compound” means sense oligonucleotide and optionally one or more additional features, such as conjugation groups.

[0085] As used in this article, “sense oligonucleotide” means an oligonucleotide that can hybridize with antisense oligonucleotides, including the oligonucleotide portion of a sense compound.

[0086] As used herein, "single-stranded" in relation to a linked nucleoside chain (e.g., an oligonucleotide) or its region means that the linked nucleoside chain or its region is unpaired and is not part of a double-stranded structure or double-stranded region resulting from self-complementarity. Single-stranded nucleic acids (e.g., single-stranded oligonucleotides) can hybridize with complementary nucleic acids to form double-stranded structures, at which point they are no longer single-stranded.

[0087] As used herein, “stabilized phosphate group” or “stabilized phosphate moiety” means a 5'-phosphate analog that is metabolically more stable than 5'-phosphate, which is naturally present on DNA or RNA.

[0088] As used herein, "sugar substitute" refers to a nucleoside group, other than the unmodified sugar moiety, that corresponds to the β-D-ribosyl sugar in RNA or the β-D-deoxyribosyl sugar in DNA. Modified nucleosides containing sugar substitutes can be incorporated into one or more sites within an oligonucleotide, and such oligonucleotides can hybridize with complementary oligomers or target nucleic acids. The modified sugar moiety can be selected from modified furanyl or modified deoxyfuranyl sugar moieties, cyclic sugar substitutes, bicyclic sugar substitutes, acyclic sugar substitutes, or sugar mimics.

[0089] As used herein, in the context of a group of molecules with the same molecular formula, "stereorandom" or "stereorandom chiral center" refers to a chiral center with a specific absolute stereochemical configuration that is not controlled during synthesis or is not enriched at that chiral center after synthesis. A stereochemical configuration is random when it is the result of a synthetic method that does not aim to control the stereochemical configuration. For example, in a group of molecules containing stereorandom chiral centers, the number of molecules with a (S) configuration having a stereorandom chiral center can be the same as the number of molecules with a (R) configuration having a stereorandom chiral center ("racemic"). A stereorandom chiral center with a random stereochemical configuration can be located at the phosphorus atom of a stereorandom thiophosphate nucleoside bond or a methanesulfonylaminophosphate nucleoside bond.

[0090] As used herein, "chain" or "linked nucleoside chain" refers to a continuous chain of linked nucleosides connected by internucleotide bonds. Linked nucleoside chains have a nucleobase sequence.

[0091] As used in this article, "subject" refers to a human or a non-human animal.

[0092] As used herein, “glycan” means an unmodified or modified sugar moiety. As used herein, “unmodified sugar moiety” means, for example, the 2'-OH(H)β-D-ribosyl sugar moiety found in RNA (“unmodified RNA sugar moiety”) or the 2'-H(H)β-D-ribosyl sugar moiety found in DNA (“unmodified DNA sugar moiety”). An unmodified sugar moiety is a furanyl or deoxyfuranyl sugar moiety in the β-D-ribosyl stereochemistry configuration, having one hydrogen atom at each of the 1', 3', and 4' positions, one oxygen atom at the 3' position, two hydrogen atoms at the 5' position, and two hydrogen atoms at the 2' position, or having one hydrogen atom and one OH atom. As used herein, “modified sugar moiety” or “modified sugar” means a modified furanyl sugar moiety or a sugar substitute.

[0093] As used in this article, "sugar substitute nucleoside" means a nucleoside that contains a "cyclic sugar substitute nucleoside" or a nucleoside that contains a "non-cyclic sugar substitute nucleoside".

[0094] As used in this article, “cyclic sugar substitute nucleosides” are nucleosides having Formula I: Formula I in J is H, C1-C6 alkyl, or C2-C6 alkenyl; X is O, S, C(R1R2), N(R3) or X1-X2, where X1-X2 is C(R1)=C(R2), C(R1R2)-C(R1R2), OC(R1R2), C(R1R2)-O, SC(R1R2), C(R1R2)-S, N(R3)-C(R1R2) or C(R1R2)-N(R3); Y is C(R1R2) or Y 1- Y2, where Y 1- Y2 is C(R1) = C(R2) or C(R1R2) - C(R1R2); Z is C(G1G2) or Z1-Z2 or Z1-Z2-Z3, where Z1-Z2 is C(G1)=C(R1), C(R1)=C(G1), C(G1G2)-C(R1R2), C(R1R2)-C(G1G2); where Z1-Z2-Z3 is C(G1G2)-C(R1R2)-C(R1R2), C(R1R2)-C(G1G2)-C(R1R2) or C(R1R2)-C(R1R2)-C(G1G2); Q is CH or N; Each R1 and R2 is independently H, OH, C1-C6 alkyl, or N (R4); wherein if R1 is OH, then R2 is not OH; Each R3 and R4 is independently H, C1-C6 alkyl or C(=O)R5, wherein R5 is C1-C6 alkyl; Each G1 and G2 is independently H, OH, halogen, or O-[C(R6)(R7)] q -[(C=O) s -X G ] j -R8; where if G1 is OH, then G2 is not OH; Each R6 and R7 is independently H, halogen, C1-C6 alkyl, or substituted C1-C6 alkyl; Each X G It is O, S, or N (E1); R8 is H, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 ynyl, substituted C2-C6 ynyl or N(E2)(E3). E1, E2 and E3 are each independently H, C1-C6 alkyl or substituted C1-C6 alkyl; m is 0 or 1; p is 0 or 1; q is 1 to 6; s is 0 or 1; j is 0 or 1; Bx is a nucleobase; and The condition is that if X is O, Z is C(G1G2), and Q is CH, then m is 1.

[0095] As used in this article, "cyclic sugar substitute" refers to the sugar portion of the cyclic sugar substitute nucleoside.

[0096] As used in this article, "acyclic sugar substitute nucleoside" refers to a nucleoside having formula II, formula III, or formula IV: Formula II Formula III Formula IV in: X is O, S, C(R4R5), N(E1), N(E1)-C (=O); Each J1 and J2 is independently H or C1-C6 alkyl; n is 0, 1, or 2; m is 0, 1, or 2; p is 0 or 1; o is 0 or 1; s is 0 or 1; R1 can be H, OH, halogen, C1-C6 alkyl, C1-C6 alkoxy, C2-C6 alkenyl, C2-C6 alkynyl, or (CH2). q R 8； R2, R3, and R4 are each independently H, OH, halogen, C1-C6 alkyl, C1-C6 alkoxy, C2-C6 alkenyl, C2-C6 alkynyl, S-CH3, N(CH3)(CH3), OCH2CH2OCH3, O-alkylamino, or (CH2). q R8; E1 is H, C1-C6 alkyl, or substituted C1-C6 alkyl; R4 and R5 are independently H, OH, C1-C6 alkyl or N (R7); wherein if R5 is OH, then R6 is not OH; R7 is H, C1-C6 alkyl, or C(=O)R8, wherein R8 is C1-C6 alkyl; R8 is OH, halogen, methoxy, ethoxy, azide, C2-C6 alkenyl, or C2-C6 alkynyl, and q is 1, 2, or 3; and Bx is a nucleobase.

[0097] As used in this article, "acyclic sugar substitute" refers to the sugar portion of the nucleoside in the acyclic sugar substitute.

[0098] As used herein, "glycomimetic" means, other than the furanylose moiety or sugar substitutes (e.g., cyclic or acyclic sugar substitutes), a nucleoside-forming group corresponding to the β-D-ribosylose moiety in RNA.

[0099] As used in this article, "sugar substitute nucleoside" means nucleoside containing cyclic sugar substitutes or nucleoside containing acyclic sugar substitutes.

[0100] As used herein, “symptoms” of a disease or condition means any manifestation, indication, sign, or evidence of the presence or extent of a disease or condition. Symptoms can be apparent to the subject or the medical professional examining or testing that subject. Symptoms can be apparent in invasive diagnostic tests, including but not limited to post-mortem tests. Symptoms can be a lack of characteristic features, such as failure to meet expected developmental milestones. In this article, symptoms include hypomyelination, demyelination, dysarthria, dystonia, ataxia, spasticity, cerebellar and / or basal ganglia atrophy, visual impairment, rigidity, microcephaly, focal cortical dysplasia, seizures, and early childhood death.

[0101] As used herein, “target nucleic acid” and “target RNA” refer to the TUBB4A nucleic acid that the antisense oligonucleotide is designed to influence. As used herein, “target RNA” refers to TUBB4A RNA transcripts and, unless otherwise specified, includes precursor mRNA and mRNA.

[0102] As used in this article, "target region" refers to a portion of a target nucleic acid (e.g., TUBB4A) to which an oligomeric compound is designed to hybridize.

[0103] As used in this article, "terminal group" refers to a chemical group or atomic group covalently attached to the end of an oligonucleotide.

[0104] As used herein, the term "treating" or "treatment" in relation to a disease refers to the administration of an oligomer to a subject who has or is at risk of developing such a disease. Treating a disease can produce an improvement in at least one symptom of such a disease. In some embodiments, treatment reduces the severity or frequency of symptoms, or delays the onset of symptoms, slows the progression of symptoms, or reduces the severity or frequency of symptoms such that the symptoms of the disease are reduced, no longer noticeable, or never noticeable.

[0105] As used herein, "therapeutic effective amount" means the amount of a drug or composition that provides a therapeutic benefit to a subject. For example, a therapeutically effective amount improves at least one symptom of a disease.

[0106] As used herein, “unmodified nucleobase” means unmodified adenine (A), unmodified thymine (T), unmodified cytosine (C), unmodified uracil (U), or unmodified guanine (G).

[0107] Some embodiments This disclosure provides the following non-limiting numbered embodiments: Example 1. An oligomer comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide includes a targeting region comprising at least 12 consecutive nucleosides, wherein the nucleobase sequence of the targeting region is at least 80% complementary to the nucleobase sequence of an iso-length target region of TUBB4A nucleic acid, and wherein the sugar moiety of at least one nucleoside of the modified oligonucleotide is a modified sugar moiety and / or at least one internucleotide bond of the modified oligonucleotide is a modified internucleotide bond.

[0108] Example 2. The oligomer according to Example 1, wherein the TUBB4A nucleic acid has the nucleobase sequence of SEQ ID NO: 1.

[0109] Example 3. The oligomer according to Example 1 or Example 2, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to the isolength portion of nucleobases 3051 to 3070 of SEQ ID NO: 1.

[0110] Example 4. An oligomer according to any one of Examples 1 to 3, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to the isolength portion of the TUBB4A nucleic acid.

[0111] Example 5. An oligomer comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or 20 consecutive nucleosides, and wherein the sugar portion of at least one nucleoside of the modified oligonucleotide is a modified sugar portion and / or at least one internucleotide bond of the modified oligonucleotide is a modified internucleotide bond.

[0112] Example 6. The oligomer according to Example 5, wherein the modified oligonucleotide consists of 16 to 25 linked nucleosides and has a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 5.

[0113] Example 7. The oligomer according to Example 5 or Example 6, wherein the modified oligonucleotide has a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 5.

[0114] Example 8. An oligomer according to any one of Examples 5 to 7, wherein the modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of SEQ ID NO: 5.

[0115] Example 9. An oligomer according to any one of Examples 5 to 8, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an isolength portion of the TUBB4A nucleic acid, wherein the TUBB4A nucleic acid has the nucleobase sequence of SEQ ID NO: 1.

[0116] Example 10. An oligomer according to any one of Examples 5 to 9, wherein the modified oligonucleotide comprises 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 Composed of 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 22, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides.

[0117] Example 11. An oligomer according to any one of Examples 5 to 10, wherein the modified oligonucleotide consists of 20 linked nucleosides.

[0118] Example 12. An oligomer according to any one of Examples 5 to 11, wherein at least one nucleoside of the modified oligonucleotide is a modified nucleoside.

[0119] Example 13. The oligomer according to Example 12, wherein the at least one modified nucleoside comprises a modified sugar moiety.

[0120] Example 14. The oligomer according to Example 13, wherein the modified sugar moiety comprises a bicyclic sugar moiety.

[0121] Example 15. The oligomer according to Example 13 or Example 14, wherein the bicyclic sugar moiety comprises a 2'-4' bridge selected from -O-CH2- and -O-CH(CH3)-.

[0122] Example 16. An oligomer according to any one of Examples 13 to 14, wherein the modified nucleoside comprises a non-bicyclic modified sugar moiety.

[0123] Example 17. The oligomer according to Example 16, wherein the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety, a 2'-OMe sugar moiety, or a β-D-deoxyxylose sugar moiety.

[0124] Example 18. The oligomer according to Example 16 or Example 17, wherein the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety.

[0125] Example 19. An oligomer according to any one of Examples 5 to 18, wherein at least one nucleoside internucleotide bond of the modified oligonucleotide is a phosphate thioester nucleoside internucleotide bond.

[0126] Example 20. The oligomer according to Example 19, wherein at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17 or at least 18 nucleoside bonds of the modified oligonucleotide are phosphate thioester nucleoside bonds.

[0127] Example 21. An oligomer according to any one of Examples 5 to 20, wherein at least one nucleoside internucleotide bond of the modified oligonucleotide is a phosphodiester nucleoside internucleotide bond.

[0128] Example 22. An oligomer according to any one of Examples 5 to 21, wherein the modified oligonucleotide contains a nucleoside internucleotide motif (5' to 3') of sooooosssssssssssooss, wherein each "s" represents a thiophosphate nucleoside internucleotide bond and each "o" represents a phosphodiester nucleoside internucleotide bond.

[0129] Example 23. An oligomer according to any one of Examples 5 to 22, wherein the modified oligonucleotide contains at least one modified nucleobase.

[0130] Example 24. The oligomer according to Example 23, wherein the modified nucleobase is 5-methylcytosine.

[0131] Example 25. The oligomer according to Example 24, wherein each cytosine is 5-methylcytosine.

[0132] Example 26. An oligomer according to any one of Examples 5 to 25, wherein one or more nucleosides of the modified oligonucleotide contain unmodified nucleobases.

[0133] Example 27. An oligomer according to any one of Examples 5 to 26, wherein the modified oligonucleotide contains a deoxygenated region.

[0134] Example 28. The oligomer according to Example 27, wherein each nucleoside in the deoxygenated region is a 2'-β-D-deoxynucleoside.

[0135] Example 29. An oligomer according to Example 27 or Example 28, wherein the deoxygenated region is composed of 6, 7, 8, 9, 10 or 6 to 10 linked nucleosides.

[0136] Example 30. An oligomer according to any one of Examples 27 to 29, wherein each nucleoside immediately adjacent to the deoxygenated region comprises a modified sugar moiety.

[0137] Example 31. An oligomer according to any one of Examples 27 to 30, wherein the deoxygenated region is connected to a 5' external region on the 5' side and to a 3' external region on the 3' side, the 5' external region being composed of 1 to 6 linked 5' external region nucleosides, and the 3' external region being composed of 1 to 6 linked 3' external region nucleosides; in The 3' nucleotide in the 5' outer region contains a modified sugar moiety; and The 5' nucleotide in the 3' outer region contains a modified sugar moiety.

[0138] Example 32. The oligomer according to Example 31, wherein each nucleoside in the 3' outer region comprises a modified sugar moiety.

[0139] Example 33. The oligomer according to Example 31 or Example 32, wherein each nucleoside in the 5' outer region comprises a modified sugar moiety.

[0140] Example 34. The oligomer according to Example 33, wherein the modified oligonucleotide has: The 5' outer region consists of 5 linked nucleosides; The deoxygenated region consisting of 10 linked nucleosides; and The 3' outer region consists of 5 linked nucleosides; Each of the 5' external region nucleosides and each of the 3' external region nucleosides is a 2'-MOE nucleoside.

[0141] Example 35. An oligomer comprising a modified oligonucleotide according to the following chemical symbols: m C es A eo T e o G eo A eo m C ds T ds T ds T ds A ds A ds G ds m C ds T ds T ds m Ceo A eo m C es A es A e (SEQ ID NO: 6), in: A = adenine nucleobase, m C = 5-methylcytosine nucleobase; G = Guanine nucleobase; T = thymine nucleobase; e = 2'-MOE sugar moiety; d = 2'-β-D-deoxyribosyl sugar moiety; s = thiophosphate nucleoside bond; and o = phosphate diester nucleoside bond; and The oligomeric compounds optionally contain conjugated groups or terminal groups.

[0142] Example 36. An oligomer according to any one of Examples 1 to 35, which is composed of the modified oligonucleotide.

[0143] Example 37. An oligomer according to any one of Examples 1 to 36, wherein the oligomer compound comprises a conjugate group.

[0144] Example 38. The oligomer according to Example 37, wherein the conjugate group comprises a conjugate linker and a conjugate moiety.

[0145] Example 39. The oligomer according to Example 38, wherein the conjugate linker is composed of single bonds.

[0146] Example 40. The oligomer according to any one of Examples 38 to 39, wherein the conjugate linker is cleavable.

[0147] Example 41. An oligomer according to any one of Examples 38 to 40, wherein the conjugate linker comprises 1 to 3 linker-nucleosides.

[0148] Example 42. An oligomer according to any one of Examples 38 to 41, wherein the conjugate linker does not contain any linker nucleoside.

[0149] Example 43. An oligomer according to any one of Examples 38 to 42, wherein the conjugation group is attached to the 5' end of the modified oligonucleotide.

[0150] Example 44. An oligomer according to any one of Examples 38 to 42, wherein the conjugation group is attached to the 3' end of the modified oligonucleotide.

[0151] Example 45. An oligomer according to any one of Examples 1 to 44, wherein the oligomer compound comprises a terminal group.

[0152] Example 46. The oligomer according to Example 45, wherein the terminal group is a debased sugar moiety.

[0153] Example 47. An oligomer according to any one of Examples 1 to 46, wherein the oligomer is a single-chain oligomer.

[0154] Example 48. A modified oligonucleotide based on the following chemical structure: (SEQ ID NO: 6) or a pharmaceutically acceptable salt thereof.

[0155] Example 49. The modified oligonucleotide according to Example 48, wherein the modified oligonucleotide is a pharmaceutically acceptable salt, including one or more cations selected from sodium, potassium, calcium and magnesium.

[0156] Example 50. The modified oligonucleotide according to Example 49, wherein the modified oligonucleotide is a sodium or potassium salt.

[0157] Example 51. A modified oligonucleotide based on the following chemical structure: (SEQ ID NO: 6).

[0158] Example 52. A chiral enrichment group of an oligomer according to any one of Examples 1 to 47 or a chiral enrichment group of a modified oligonucleotide according to any one of Examples 48 to 51, wherein the group is enriched with a modified oligonucleotide comprising at least one thiophosphate nucleoside bond having a specific stereochemical configuration.

[0159] Example 53. A chiral enrichment group according to Example 52, wherein the group is enriched with at least one having (Sp) or (Rp) Modified oligonucleotides with specific configurations of thiophosphate nucleoside bonds.

[0160] Example 54. A chiral enrichment group according to Example 52, wherein the group is enriched with modified oligonucleotides having a specific, independently selected stereochemical configuration at each thiophosphate nucleoside internucleotide bond.

[0161] Example 55. A chiral enrichment group according to Example 52, wherein the group is enriched with a specific thiophosphate nucleoside internucleotide bond. (Rp) Configuration and has at each of the remaining thiophosphate nucleoside internucleotide bonds (Sp) Modified oligonucleotides with different configurations.

[0162] Example 56. A chiral enrichment group according to Example 52, wherein the group is enriched with having a chiral enrichment in the 5' to 3' direction. Sp , Sp and Rp Modified oligonucleotides with at least three consecutive thiophosphate nucleoside bonds in configuration.

[0163] Example 57. A group of oligomers according to any one of Examples 1 to 47 or a group of modified oligonucleotides according to any one of Examples 48 to 51, wherein each of the phosphate thioester nucleoside internucleotides of the modified oligonucleotide is stereorandom.

[0164] Example 58. A pharmaceutical composition comprising an oligomer according to any one of Examples 1 to 47, a modified oligonucleotide according to any one of Examples 48 to 51, or a group according to any one of Examples 52 to 57, and a pharmaceutically acceptable diluent.

[0165] Example 59. The pharmaceutical composition according to Example 58, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid, water, or phosphate-buffered saline.

[0166] Example 60. A pharmaceutical composition according to Example 58 or Example 59, wherein the pharmaceutical composition is substantially composed of the modified oligonucleotide, the oligomeric compound or the group thereof, and artificial cerebrospinal fluid.

[0167] Example 61. A pharmaceutical composition according to any one of Examples 58 to 60, wherein the pharmaceutical composition is substantially composed of the modified oligonucleotide, the oligomeric compound or the group and the phosphate buffered saline.

[0168] Example 62. A method comprising administering to a subject an oligomer according to any one of Examples 1 to 47, a modified oligonucleotide according to any one of Examples 48 to 51, a group according to any one of Examples 52 to 57, or a pharmaceutical composition according to any one of Examples 58 to 61.

[0169] Example 63. The method according to Example 62, wherein the application of the oligomer, the modified oligonucleotide, the group, or the pharmaceutical composition improves at least one symptom of a disease or condition associated with TUBB4A.

[0170] Example 64. The method according to Example 62 or Example 63, wherein administration of the oligomer, the modified oligonucleotide, the group, or the pharmaceutical composition reduces or slows the progression of hypomyelination, demyelination, dysphonia, dystonia, ataxia, spasticity, cerebellar and / or basal ganglia atrophy, visual impairment, rigidity, microcephaly, focal cortical dysplasia, seizures, and early childhood death.

[0171] Example 65. The method according to any one of Examples 62 to 64, wherein the TUBB4A protein level is reduced in the subject.

[0172] Example 66. The method according to any one of Examples 63 to 65, wherein the disease or condition associated with TUBB4A is a neurodegenerative disease or condition.

[0173] Example 67. The method according to any one of Examples 63 to 65, wherein the disease or condition associated with TUBB4A is leukodystrophy or type 4 dystonia (DYT4) associated with TUBB4A.

[0174] Example 68. The method according to Example 67, wherein the TUBB4A-associated leukodystrophy is selected from TUBB4A-leukodystrophy with onset in infancy, isolated hypomyelination with spastic quadriplegia, and hypomyelination with basal ganglia and cerebellar atrophy (H-ABC).

[0175] Example 69. A method of treating a disease or condition associated with TUBB4A, the method comprising administering to a subject who has or is at risk of developing a disease or condition associated with TUBB4A a therapeutically effective amount of an oligomer according to any one of Examples 1 to 47, a modified oligonucleotide according to any one of Examples 48 to 51, a group according to any one of Examples 52 to 57, or a pharmaceutical composition according to any one of Examples 58 to 61, thereby treating the disease or condition associated with TUBB4A.

[0176] Example 70. The method according to any one of Examples 62 to 69, wherein the application of the oligomer, the modified oligonucleotide, the group, or the pharmaceutical composition improves at least one symptom of the disease or condition associated with TUBB4A.

[0177] Example 71. The method according to any one of Examples 69 to 70, wherein administration of the modified oligonucleotide, the oligomeric compound, the group, or the pharmaceutical composition reduces or slows the progression of hypomyelination, demyelination, dysphonia, dystonia, ataxia, spasticity, cerebellar and / or basal ganglia atrophy, visual impairment, rigidity, microcephaly, focal cortical dysplasia, seizures, and early childhood death.

[0178] Example 72. The method according to any one of Examples 69 to 71, wherein the TUBB4A protein level is reduced in the subject.

[0179] Example 73. The method according to any one of Examples 69 to 72, wherein the disease or condition associated with TUBB4A is leukodystrophy associated with TUBB4A.

[0180] Example 74. The method according to Example 73, wherein the TUBB4A-associated leukodystrophy is selected from TUBB4A-leukodystrophy with onset in infancy, isolated hypomyelination with spastic quadriplegia, type 4 dystonia (DYT4), and hypomyelination with basal ganglia and cerebellar atrophy (H-ABC).

[0181] Example 75. The method according to any one of Examples 69 to 74, wherein the subject is a human.

[0182] Example 76. A method for reducing the expression of TUBB4A in cells, the method comprising contacting the cells with an oligomer according to any one of Examples 1 to 47, a modified oligonucleotide according to any one of Examples 48 to 51, a group according to any one of Examples 52 to 57, or a pharmaceutical composition according to any one of Examples 58 to 61.

[0183] Example 77. The method according to Example 76, wherein the cell is a neuron or an oligodendrocyte.

[0184] Example 78. The method according to Example 76 or Example 77, wherein the cell is a human cell.

[0185] Example 79. Use of the oligomer according to any one of Examples 1 to 47, the modified oligonucleotide according to any one of Examples 48 to 51, the group according to any one of Examples 52 to 57, or the pharmaceutical composition according to any one of Examples 58 to 61 for the treatment of diseases or conditions related to TUBB4A.

[0186] Example 80. Use of the oligomeric compound according to any one of Examples 1 to 47, the modified oligonucleotide according to any one of Examples 48 to 51, the group according to any one of Examples 52 to 57, or the pharmaceutical composition according to any one of Examples 58 to 61 in the manufacture of a medicament for treating diseases or conditions associated with TUBB4A.

[0187] Example 81. The use according to any one of Examples 79 to 80, wherein the disease or condition associated with TUBB4A is related to elevated TUBB4A levels.

[0188] Example 82. Use according to any one of Examples 79 to 81, wherein the disease or condition associated with TUBB4A is leukodystrophy or type 4 dystonia (DYT4) associated with TUBB4A.

[0189] Example 83. According to the use described in Example 82, wherein the TUBB4A-associated leukodystrophy is selected from TUBB4A-leukodystrophy with onset in infancy, isolated hypomyelination with spastic quadriplegia, and hypomyelination with basal ganglia and cerebellar atrophy (H-ABC).

[0190] Oligopolymers and Oligopolymers Some embodiments provide oligomers targeting the TUBB4A nucleic acid. In some embodiments, the TUBB4A nucleic acid has the sequence listed in SEQ ID NO: 1 (Ensembl transcript ID ENSG00000104833.12, Ensembl publication 109–February 2023), which is incorporated herein by reference in its entirety. In some embodiments, the oligomer is a single-stranded oligomeric compound. In some embodiments, the oligomer is an oligomeric duplex.

[0191] Some embodiments provide an oligomer comprising a modified oligonucleotide consisting of 12 to 80 linked nucleosides, wherein the modified oligonucleotide includes a targeting region containing at least 12 consecutive nucleosides, wherein the nucleotide sequence of the targeting region is at least 80% complementary to the nucleotide sequence of an isolong target region of TUBB4A nucleic acid, and wherein the sugar moiety of at least one nucleoside of the modified oligonucleotide is a modified sugar moiety and / or at least one internucleotide bond of the modified oligonucleotide is a modified internucleotide bond. Some embodiments provide an oligomer comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide includes a targeting region containing at least 12 consecutive nucleosides, wherein the nucleotide sequence of the targeting region is at least 80% complementary to the nucleotide sequence of an isolong target region of TUBB4A nucleic acid, and wherein the sugar moiety of at least one nucleoside of the modified oligonucleotide is a modified sugar moiety and / or at least one internucleotide bond of the modified oligonucleotide is a modified internucleotide bond. In some embodiments, the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to the isolength portion of the TUBB4A nucleic acid. In some embodiments, the TUBB4A nucleic acid has the nucleobase sequence of SEQ ID NO: 1. In any of the oligomeric compounds provided herein, the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to the isolength portion of the TUBB4A nucleic acid, wherein the TUBB4A nucleic acid has the nucleobase sequence of SEQ ID NO: 1. In some embodiments, the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to the isolength portion of SEQ ID NO: 1, from nuclei 3051 to 3070. In some embodiments, the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to the isolength portion of SEQ ID NO: 1, from nuclei 3051 to 3070.

[0192] Some embodiments provide an oligomer comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases comprising the nucleobase sequence of SEQ ID NO: 5. In some embodiments, the modified oligonucleotide has a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 5. In some embodiments, the modified oligonucleotide has a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 5. Some embodiments provide an oligomer comprising a modified oligonucleotide consisting of 15 to 25 linked nucleosides and having a nucleobase sequence comprising at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleosides comprising the nucleobase sequence of SEQ ID NO: 5. Some embodiments provide an oligomer comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleosides comprising the nucleobase sequence of SEQ ID NO: 5. In some embodiments, the modified oligonucleotide has a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 5. In some embodiments, the modified oligonucleotide has a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 5.

[0193] Some embodiments provide an oligomer comprising a modified oligonucleotide consisting of 20 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 5. Some embodiments provide an oligomer comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is composed of the nucleobase sequence of SEQ ID NO: 5. Some embodiments provide an oligomer comprising a modified oligonucleotide consisting of 20 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is composed of the nucleobase sequence of SEQ ID NO: 5. Some embodiments provide an oligomeric compound comprising a modified oligonucleotide having a nucleobase sequence comprising SEQ ID NO: 5.

[0194] In any of the oligomers provided herein, the modified oligonucleotides may be in quantities of 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 3 The oligonucleotide is composed of 0, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 22, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides. In some embodiments, the modified oligonucleotide is composed of 15-25 linked nucleosides. In some embodiments, the modified oligonucleotide is composed of 18-25 linked nucleosides. In some embodiments, the modified oligonucleotide consists of 18-22 linked nucleosides. In some embodiments, the modified oligonucleotide consists of 19-20 linked nucleosides. In some embodiments, the modified oligonucleotide consists of 20 linked nucleosides.

[0195] In any of the oligomers provided herein, at least one internucleotide bond of the modified oligonucleotide may be a phosphate thioester internucleotide bond. In some embodiments, the modified oligonucleotide has an internucleotide bond motif comprising at least one phosphate thioester internucleotide bond. In some embodiments, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 internucleotide bonds of the modified oligonucleotide are phosphate thioester internucleotide bonds. In some embodiments, the modified oligonucleotide has an internucleotide bond motif comprising 9 to 18 phosphate thioester internucleotide bonds. In some embodiments, the modified oligonucleotide has an internucleotide bond motif comprising 10 to 14 phosphate thioester internucleotide bonds. In some embodiments, the modified oligonucleotide has an internucleotide bond motif comprising 13 phosphate thioester internucleotide bonds.

[0196] In some embodiments, at least one nucleotide internucleotide bond in the modified oligonucleotide may be a phosphodiester nucleotide internucleotide bond. In some embodiments, the modified oligonucleotide has a nucleotide internucleotide bond motif comprising at least one, at least two, at least three, at least four, at least five, or at least six phosphodiester nucleotide internucleotide bonds. In some embodiments, the modified oligonucleotide has a nucleotide internucleotide bond motif comprising one, two, three, four, five, six, or one to six phosphodiester nucleotide internucleotide bonds. In some embodiments, the modified oligonucleotide has a nucleotide internucleotide bond motif comprising one phosphodiester nucleotide internucleotide bond. In some embodiments, the modified oligonucleotide has a nucleotide internucleotide bond motif comprising two phosphodiester nucleotide internucleotide bonds. In some embodiments, the modified oligonucleotide has a nucleotide internucleotide bond motif comprising six phosphodiester nucleotide internucleotide bonds.

[0197] In any of the oligomers provided herein, at least one nucleoside of the modified oligonucleotide comprises a modified sugar moiety. In some embodiments, the modified sugar moiety comprises a non-bicyclic sugar moiety, such as a 2'-MOE sugar moiety or a 2'-OMe sugar moiety. In some embodiments, the modified sugar moiety is a 2'-MOE sugar moiety.

[0198] In any of the oligomers provided herein, at least one nucleobase of the modified oligonucleotide may be a modified nucleobase. In some embodiments, the modified nucleobase is a modified cytosine, such as, for example, 5-methylcytosine. In some embodiments, each cytosine is 5-methylcytosine.

[0199] In any of the oligomers provided herein, the modified oligonucleotide may comprise a deoxygenated region consisting of 5 to 12 consecutive 2'-deoxynucleosides. In some embodiments, each nucleoside in the deoxygenated region is a 2'-β-D-deoxynucleoside. In some embodiments, the deoxygenated region consists of 6, 7, 8, 9, 10, or 6 to 10 linked nucleosides. In some embodiments, the deoxygenated region consists of 10 linked nucleosides. In some embodiments, each nucleoside immediately adjacent to the deoxygenated region comprises a modified sugar moiety. In some embodiments, the deoxygenated region is side-attached on the 5' side by a 5' outer region and on the 3' side by a 3' outer region, the 5' outer region consisting of 1 to 6 linked 5' outer region nucleosides, the 3' outer region consisting of 1 to 6 linked 3' outer region nucleosides, wherein the last 3' nucleoside of the 5' outer region comprises a modified sugar moiety, and the last 5' nucleoside of the 3' outer region comprises a modified sugar moiety. In some embodiments, each nucleotide in the 3' outer region comprises a modified sugar moiety. In some embodiments, each nucleotide in the 5' outer region comprises a modified sugar moiety. In some embodiments, each of the 5' outer region nucleotides and each of the 3' outer region nucleotides comprises a modified sugar moiety. In some embodiments, each of the 5' outer region nucleotides and each of the 3' outer region nucleotides is a 2'-MOE nucleotide. In some embodiments, the modified oligonucleotide has a 5' outer region consisting of 5 linked nucleotides, a deoxygenated region consisting of 10 linked nucleotides, and a 3' outer region consisting of 5 linked nucleotides, wherein each of the 5' outer region nucleotides and each of the 3' outer region nucleotides is a 2'-MOE nucleotide.

[0200] Compound No. 1653044 Compound number 1653044 was characterized as a 5-10-5 MOE spacer composed of 20 linked nucleosides and having (from 5' to 3') CATGACTTTAAGCTTCACAA (SEQ ID NO: 5) The nucleobase sequence in which nucleosides 1 to 5 and 16 to 20 (from 5' to 3') are each 2'-MOE nucleosides, and nucleosides 6 to 15 (from 5' to 3') are each 2'-β-D-deoxy nucleosides, wherein the internucleotide bonds between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 16 to 17 and 17 to 18 are phosphodiester internucleotide bonds, and the internucleotide bonds between nucleosides 1 to 2, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19 and 19 to 20 are thiophosphate internucleotide bonds, and wherein each cytosine is 5-methylcytosine.

[0201] Compound number 1653044 is represented by the following chemical symbols (5' to 3'): m Ces A eo T eo G eo A eo m C ds T ds T ds T ds A d s A ds G ds m C ds T ds T ds m C eo A eo m C es A es A e (SEQ ID NO: 6), where, A = adenine nucleobase, m C = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'MOE sugar portion, d = 2'-β-D-deoxyribosyl sugar moiety, s = thiophosphate nucleoside internucleotide bond, and o = phosphate diester nucleoside bond.

[0202] Compound number 1653044 is represented by the following chemical structure: (SEQ ID NO: 6) or a pharmaceutically acceptable salt thereof.

[0203] In some embodiments, compound 1653044 is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium. In some embodiments, compound 1653044 is a sodium or potassium salt.

[0204] The sodium salt of compound number 1653044 is represented by the following chemical structure: (SEQ ID NO: 6 (structure 2)).

[0205] I. Oligopolymer This document provides oligomers comprising or consisting of at least one modified oligonucleotide and optionally one or more additional related features selected from: (a) one or more additional modified or unmodified oligonucleotides, each of which can hybridize or covalently link with and / or hybridize or covalently link with the at least one modified oligonucleotide; (b) one or more conjugate groups that can be covalently attached to any oligonucleotide of such oligomers; and (c) one or more terminal groups. In some embodiments, this document provides oligomers comprising or consisting of an antisense modified oligonucleotide complementary to the TUBB4A target RNA. In some embodiments, this document provides oligomers comprising an oligoduplex comprising or consisting of an antisense oligonucleotide complementary to the TUBB4A RNA and a modified sense oligonucleotide complementary to the antisense oligonucleotide. In other words, a modified oligonucleotide contains at least one modified nucleoside (containing a modified sugar moiety and / or a modified nucleobase or lacking a nucleobase) and / or at least one modified nucleoside bond. Examples suitable for certain modified nucleosides and modified nucleoside bonds in modified oligonucleotides (antisense and / or sense) are described herein.

[0206] A. Modified nucleosides The modified nucleoside comprises a modified sugar moiety or a modified nucleobase (or lack thereof), or both a modified sugar moiety and a modified nucleobase (or lack thereof). In some embodiments, modified nucleosides comprising the following modified sugar moiety and / or the following modified nucleobases may be incorporated into the modified antisense and / or sense oligonucleotides described herein.

[0207] 1. Modified sugar portion Modified sugar moieties include modified furanyl sugar moieties, cyclic sugar substitutes, acyclic sugar substitutes, and sugar analogs. In some embodiments, the modified sugar moieties are non-bicyclic modified furanyl sugar moieties. In some embodiments, the modified sugar moieties are bicyclic or tricyclic sugar moieties. In some embodiments, the modified sugar moieties are sugar substitutes. Such sugar substitutes may contain one or more substitutions corresponding to those of other types of modified sugar moieties, such as furanyl sugar moieties.

[0208] In some embodiments, the modified sugar moiety is a non-bicyclic modified furanyl sugar moiety containing one or more substituent groups (including, but not limited to, substituents at the 2', 3', 4', and / or 5' positions). In some embodiments, the modified furanyl sugar moiety is a ribosyl sugar moiety that is not an unmodified sugar moiety (i.e., an unmodified RNA or unmodified DNA moiety). In some embodiments, the modified furanyl sugar moiety is a xylose-, lythose-, or arabinose-based sugar moiety. In some embodiments, one or more acyclic substituents of the non-bicyclic modified sugar moiety are branched.

[0209] In some embodiments, the non-bicyclic modified sugar moiety is a 2'-substituted sugar moiety and contains a substituent group at the 2'-position. Examples of suitable substituent groups for the 2'-position of the modified sugar moiety include, but are not limited to: F, OCH3 (“OMe” or “O-methyl”), and OCH2CH2OCH3 (“MOE”). In some embodiments, the 2'-substituent group is selected from: halogen, allyl, amino, azide, SH, CN, OCN, CF3, OCF3, O-C1-C. 10 Alkoxy, O-C1-C 10 Substituted alkoxy groups, O-C1-C 10 Alkyl, O-C1-C 10 Substituted alkyl, S-alkyl, N(R) m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-Alkenyl, O-alkynyl, S-alkynyl, N(R m )-Alkyne, O-alkylene-O-alkyl, Alkyne, Alkylaryl, Arylalkyl, O-Alkylaryl, O-Arylalkyl, O(CH2)2SCH3, O(CH2)2ON(R m (R) n ) or OCH2C(=O)-N(R m (R) n ), where each R m and R n It is independently of H, amino protecting group, or substituted or unsubstituted C1-C 10Alkyl, -O(CH2)2ON(CH3)2 (“DMAOE”), or 2'-O(CH2)2O(CH2)2N(CH3)2 (“DMAEOE”). Methods for synthesizing some of these 2'-substituent groups can be found, for example, in the following literature: Cook et al., US 6,531,584; and Cook et al., US 5,859,221. Certain embodiments of these 2'-substituent groups may be further substituted by one or more substituent groups independently selected from the following: hydroxyl, amino, alkoxy, carboxyl, benzyl, phenyl, nitro(NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0210] In some embodiments, the 2'-substituted sugar moiety comprises a non-bridging 2'-substituent group selected from the following: F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(R) m (R) n O(CH2)2O(CH2)2N(CH3)2 and N-substituted acetamides (OCH2C(=O)-N(R) m (R) n )), where each R m and R n Independently, it is H, an amino protecting group, or a substituted or unsubstituted C1-C. 10 alkyl.

[0211] In some embodiments, the 2'-substituted sugar moiety comprises a non-bridging 2'-substituent group selected from the following: F, NH2, N3, OCF3, OCH3, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, O(CH2)2ON(CH3)2 (“DMAOE”), O(CH2)2O(CH2)2N(CH3)2 (“DMAEOE”), and OCH2C(=O)-N(H)CH3 (“NMA”).

[0212] In some embodiments, the non-bicyclic modified nucleoside of the 2'-substituted sugar moiety comprises a non-bridging 2'-substituent group selected from the following: F, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 (“NMA”). In some embodiments, one or more non-bridging substituents of the non-bicyclic modified sugar moiety are branched.

[0213] In some embodiments, the 2'-substituted sugar moiety of the modified nucleoside comprises a 2'-substituent group selected from the following: F, OCH3, and OCH2CH2OCH3.

[0214] In some embodiments, the modified furanyl sugar moiety and the nucleoside incorporated into such modified furanyl sugar moiety are further defined by stereochemical configuration. For example, the 2'-deoxyfuranyl sugar moiety (i.e., the 2'-(H)H furanyl sugar moiety) can be in seven isomer configurations in addition to the naturally occurring β-D-deoxyribosyl configuration. Such modified furanyl sugar moieties are described, for example, in WO 2020 / 072991. The 2'-modified furanyl sugar moiety has an additional stereocenter at the 2'-position relative to the 2'-deoxyfuranyl sugar moiety; thus, such sugar moieties have a total of sixteen possible isomer configurations. Unless otherwise stated, the modified furanyl sugar moieties described herein are in the β-D-ribosyl isomer configuration.

[0215] In some embodiments, the non-bicyclic modified furanyl glycosyl moiety contains a substituent group at the 4'-position. Examples of suitable substituent groups for the 4'-position of the modified furanyl glycosyl moiety include, but are not limited to, alkoxy groups. For example (methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128.

[0216] In some embodiments, the non-bicyclic modified furanyl glycosyl moiety contains a substituent group at the 3'-position. Examples of suitable substituent groups at the 3'-position of the modified glycosyl moiety include, but are not limited to, alkoxy groups. For example , methoxy), alkyl (e.g., methyl, ethyl).

[0217] In some embodiments, the non-bicyclic modified furanyl sugar moiety contains a substituent group at the 5'-position. Examples of suitable substituent groups for the 5'-position of the modified sugar moiety include, but are not limited to, vinyl, alkoxy ( For example , methoxy) and alkyl (e.g., methyl) R or S ), ethyl).

[0218] In some embodiments, the non-bicyclic modified furanyl sugar moiety comprises more than one non-bridging sugar substituent, such as a 2'-F-5'-methyl sugar moiety, as described in Migawa et al., US 2010 / 0190837, or alternative 2'- and 5'-modified sugar moieties, as described in Rajeev et al., US 2013 / 0203836.

[0219] Some modified furanyl sugar moieties are bicyclic sugar moieties and contain substituents that bridge the two atoms of the furanyl ring to form a second ring, thereby producing a bicyclic sugar moiety. In some embodiments, the bicyclic sugar moieties contain a bridge between the 4' and 2' furanyl ring atoms. Examples of such 4' to 2' bridging sugar substituents include, but are not limited to: 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' (“LNA”), 4'-CH2-S-2', 4'-(CH2)2-O-2' (“ENA”), 4'-CH(CH3)-O-2' (when in... S In configurations referred to as "restricted ethyl" or "cEt"), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CH2OCH3)-O-2' ("restricted MOE" or "cMOE") and their analogues, 4'-C(CH3)(CH3)-O-2' and their analogues, 4'-CH2-N(OCH3)-2' and their analogues, 4'-CH2-ON(CH3)-2', 4'-CH2-C(H)(CH3)-2', 4'-CH2-C(=CH2)-2' and their analogues, 4'C(R) a R b )-N(R)-O-2'、4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2' and 4'-CH2-N(R)-O-2', wherein each R, R a and R b Independently, it is H, a protecting group, or C1-C. 12 Alkyl groups. Representative U.S. patents teaching the preparation of such bicyclic sugar moieties include, but are not limited to: Imanishi people, US 7,427,672; Swayze people, US 7,741,457, and Swayze people, US 8,022,193; Seth et al. US 8,278,283; Prakash people,US 8,278,425; Seth et al. (US 8,278,426).

[0220] In some embodiments, such 4' to 2' bridges independently comprise 1 to 4 linked groups selected from: -[C(R a (R) b )] n -、-[C(R a (R) b )] n -O-、-C(R a )=C(R b )-、-C(R a )=N-、-C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-、-S(=O) x -and N(R) a )-; in: x is 0, 1, or 2; n is 1, 2, 3 or 4; Each R a and R b Independently, it is H, protecting group, hydroxyl group, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 alkenyl, C2-C 12 Alkyne group, substituted C2-C 12 alkynyl group, C5-C 20 Aryl, substituted C5-C 20 Aryl, heterocyclic, substituted heterocyclic, heteroaryl, substituted heteroaryl, C5-C7 alicyclic, substituted C5-C7 alicyclic, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1) or sulfinyl (S(=O)-J1); and each J1 and J2 is independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 alkenyl, C2-C 12 Alkyne group, substituted C2-C 12 alkynyl group, C5-C 20 Aryl, substituted C5-C 20Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic, substituted heterocyclic, C1-C 12 Aminoalkyl, substituted C1-C 12 Aminoalkyl groups or protecting groups.

[0221] In some embodiments, the bicyclic sugar moiety comprises a bridge between the 5' and 3' furanose ring atoms. Examples of such 5' to 3' bridging sugar substituents include, but are not limited to: 5'-(CH2)2-3' (bcDNA), 5'-(CH2)3-3' (bc... 4,3 DNA), 5'-C(F)=CH-CH2-3' and 5'-CH2-CHQ-3', where Q is the attachment to the nucleoside internucleotide bond.

[0222] The additional bicyclic sugar moiety is known in the art; see, for example, Wan et al., J. Medicinal Chemistry 2016, 59, 9645-9667; Wengel et al., US 8,080,644; Ramasamy et al., US 6,525,191; Seth et al., US 7,547,684; and Seth et al., US 7,666,854.

[0223] In some embodiments, the bicyclic sugar moiety and the nucleoside incorporated into such a bicyclic sugar moiety are further defined by isomer configuration. For example, LNA nucleosides (described herein) can be in the α-L or β-D configuration. α-L-methyleneoxy(4'-CH2-O-2') or α-L-LNA bicyclic nucleotides have been incorporated into oligonucleotides exhibiting antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21 (6365-6372). Adding locked nucleic acids to siRNA has been shown to improve the stability of siRNA in serum and reduce off-target effects (Elmen, J). wait people, (2005) Nucleic Acids Research 33(1):439-447;Mook, OR. people, (2007) Mal Cane Ther 6(3):833-843; Grunweller, A. people, (2003) Nucleic Acids Research 31(12):3185-3193). In this document, the general description of bicyclic nucleosides includes two isomer configurations. Unless otherwise stated, when identifying a specific bicyclic nucleoside (…) in the exemplary embodiments described herein… For example When the LNA or cEt is in the position, they are in the β-D configuration.

[0224] In some embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (e.g., 5'-substituted sugar and 4'-2'-bridging sugar).

[0225] In some embodiments, the modified sugar moiety is a sugar substitute selected from cyclic sugar substitutes and acyclic sugar substitutes.

[0226] Cyclic sugar substitutes can be represented by formula Ia: Formula Ia in: J is H, C1-C6 alkyl, or C2-C6 alkenyl; X is O, S, C(R1R2), N(R3), C(R1)=C(R2), C(R1R2)-C(R1R2), OC(R1R2), C(R1R2)-O, SC(R1R2), C(R1R2)-S, N(R3)-C(R1R2) or C(R1R2)-N(R3); Y is C(R1R2), C(R1)=C(R2) or C(R1R2)-C(R1R2); Z is C(G1G2), Z1-Z2, or Z1-Z2-Z3, where Z1-Z2 is C(G1)=C(R1), C(R1)=C(G1), C(G1G2)-C(R1R2), C(R1R2)-C(G1G2), and Z1-Z2-Z3 is C(G1G2)-C(R1R2)-C(R1R2), C(R1R2)-C(G1G2)-C(R1R2), or C(R1R2)-C(R1R2)-C(G1G2); Q is CH or N; Each R1 and R2 is independently H, OH, C1-C6 alkyl, or N (R4); wherein if R1 is OH, then R2 is not OH; Each R3 and R4 is independently H, C1-C6 alkyl or C(=O)R5, wherein R5 is C1-C6 alkyl; Each G1 and G2 is independently H, OH, halogen, or O-[C(R6)(R7)] q -[(C=O) s -X G ] j -R8; where if G1 is OH, then G2 is not OH; Each R6 and R7 is independently H, halogen, C1-C6 alkyl, or substituted C1-C6 alkyl; Each X G It is O, S, or N (E1); R8 is H, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 ynyl, substituted C2-C6 ynyl or N(E2)(E3). E1, E2 and E3 are each independently H, C1-C6 alkyl or substituted C1-C6 alkyl; m is 0 or 1; p is 0 or 1; q is 1 to 6; s is 0 or 1; j is 0 or 1; and The condition is that if X is O, Z is C(G1G2), and Q is CH, then m is 1.

[0227] In some such embodiments, the oxygen atoms of the sugar moiety are... For example The sugar moiety may be substituted with sulfur, carbon, or nitrogen atoms. In some such embodiments, the modified sugar moiety may also contain bridging substituents and / or non-bridging substituents as described herein. For example, some sugar substitutes contain a 4'-sulfur atom and substitutions at the 2' and / or 5' positions.

[0228] In some embodiments, the cyclic sugar substitute comprises a ring having more than five atoms. For example, in some embodiments, the cyclic sugar substitute comprises a six-membered tetrahydropyran (“THP”), wherein X in formula Ia is OC(R1R2), p is 1, Q is CH, Z is C(G1G2), and m is 0. Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acids (“HNA”), atroitol nucleic acids (G1=OH; G2=H; “ANA”), and fluoroHNA. (G) 1= F; G2 = H; "FHNA", See, for example Elgi, et al. J Am Chem (2011) 133(41):16642-16649, Swayze et al., US 8,088,904; and Swayze et al., US 8,440,803); FHNA can also be referred to as F-THP or 3'-fluorotetrahydropyran or 3'-FHNA). Bx is the nucleobase moiety.

[0229] In some embodiments, the cyclic sugar substitute comprises a ring having more than five atoms and more than one heteroatom. For example, nucleosides comprising a morpholine sugar moiety and their use in oligonucleotides have been reported. As used herein, the term "morpholine" means a sugar substitute having the above formula Ia, where X is O, Y and Z are each CH2, and Q is N: In some embodiments, the morpholino may be modified, for example by adding or changing various substituent groups from the morpholino structure described above. Such sugar substitutes are referred to herein as "modified morpholino".

[0230] In some embodiments, the sugar substitute is an acyclic sugar substitute and has formula IIa, IIIa, or IVa: Formula IIa Formula IIIa Formula IVa in: X is O, S, C(R5R6), N(E1), N(E1)-C(=O); Each J1 and J2 is independently H or C1-C6 alkyl; n is 0, 1, or 2; m is 0, 1, or 2; o is 0 or 1; s is 0 or 1; R1 can be H, OH, halogen, C1-C6 alkyl, C1-C6 alkoxy, C2-C6 alkenyl, C2-C6 alkynyl, or (CH2). q R7; R2, R3, and R4 are each independently H, OH, halogen, C1-C6 alkyl, C1-C6 alkoxy, C2-C6 alkenyl, C2-C6 alkynyl, S-CH3, N(CH3)(CH3), OCH2CH2OCH3, O-alkylamino, or (CH2). q R7; E1 is H, C1-C6 alkyl, or substituted C1-C6 alkyl; R5 and R6 are independently H, OH, C1-C6 alkyl or N (R7); wherein if R5 is OH, then R6 is not OH; R7 is H, C1-C6 alkyl, or C(=O)R9, wherein R9 is C1-C6 alkyl; R8 is OH, halogen, methoxy, ethoxy, azide, C2-C6 alkenyl or C2-C6 alkynyl, and q is 1, 2 or 3.

[0231] In some embodiments, the acyclic sugar substitute is the “unlocked” sugar structure of the UNA (unlocked nucleic acid) nucleotide. Representative U.S. publications teaching the preparation of UNA include, but are not limited to, U.S. Patent Publication No. 2011 / 0313020.

[0232] In some embodiments, the acyclic sugar substitute is glycerol, as found in GNA (ethylene glycol nucleic acid) nucleosides, having formula IIa, where n is 1, m and o are 0, s is 1, and J2, R2, and R3 are each H; or butyl, as found in acyclic butyl nucleic acids, having formula IIa, where n is 2, m and o are 0, s is 1, and J2, R2, and R3 are each H. In some embodiments, the acyclic sugar substitute is also referred to as a “C3 spacer” and has formula IIa, where n and o are 1; m and s are 0, and J1, J2, R1, and R3 are each H.

[0233] Other acyclic sugar substitutes include those described in Manoharan et al., US 10,913,767; US Patent Publication US2021 / 0238595; and PCT Publication WO 2023 / 109940.

[0234] In some embodiments, the modified oligonucleotide comprises one or more glycomimetic compounds, wherein a group other than the "furanosyl sugar moiety" or "sugar substitute" forms the nucleoside moiety corresponding to the β-D-ribosyl sugar in RNA. In some embodiments, the glycomimetic compound is part of the backbone of the peptide nucleic acid, while the remainder of the backbone is a nucleoside internucleotide bond. Representative U.S. patents teaching the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082; 5,714,331; and 5,719,262.

[0235] 2. Modified nucleobases In some embodiments, the modified oligonucleotide comprises one or more nucleosides containing unmodified nucleosides. In some embodiments, the modified oligonucleotide comprises one or more nucleosides containing modified nucleosides. In some embodiments, the modified oligonucleotide comprises one or more nucleosides that do not contain nucleosides, referred to as debased nucleosides. In some embodiments, the modified oligonucleotide comprises one or more inosine nucleosides (i.e., nucleosides containing hypoxanthine nucleosides). An "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). A modified nucleobase is a group of atoms other than the unmodified A, T, C, U, or G that can pair with at least one other nucleobase. 5-Methylcytosine is an example of a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleosides.

[0236] In some embodiments, the modified adenine has structure (I): I Where: R 1A It does not exist or is H; R 2A It is H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 thioalkyl, substituted C1-C6 thioalkyl, C1-C6 alkoxy, or substituted C1-C6 alkoxy; R 6A It is H, N(R) a (R) b ), oxo, acetyl, formyl, or O-phenyl; Y 7A It is N and R 7A It is either absent or a C1-C6 alkyl group; or Y 7A It is C and R 7A It is H, C1-C6 alkyl or CN(R) a (R) b );Y 8A It is N and R 8A Does not exist, or Y 8A It is C and R 8A It is H, halogen, OH, C1-C6 alkyl, or substituted C1-C6 alkyl; R a and R b Independently, it is H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, acetyl, formyl, or together forming a 5-7 membered heterocycle; excluding Y. 7A It is N and R 7A Does not exist; Y 8A It is C, R 8A It is H, R 2A It is H, and R 6A It is NH2 (unmodified adenine).

[0237] In some embodiments, unmodified guanine has structure (II): II Where: R 2G It is N(R) a (R) b ); R 6G It is oxygenated and R 1G Is it H, or R? 6G It is an O-C1-C6 alkyl or an S-C1-C6 alkyl and R 1G Does not exist; R 7G It is N and R 7g It is either absent or a C1-C6 alkyl group; or Y 7GIt is C and R 7G It is H, C1-C6 alkyl or CN(R) a (R) b );Y 8G It is N and R 8G Does not exist, or Y 8G It is C and R 8G Selected from H, halogens, OH, C1-C6 alkyl groups or substituted C1-C6 alkyl groups; R a and R b Independently, it is H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, acetyl, formyl, or together forming a 5-7 membered heterocycle; excluding Y. 7G It is N; Y 8G It is C, R 8G It is H, R 2G It is NH2, and R 6G =O (unmodified guanosine).

[0238] In some embodiments, the modified thymine or the modified uracil has structure (III): III Where: each X is independently O or S and R 5U It is H, OH, halogen, O-Cl-C 12 Alkyl, O-C1-C 12 Substituted alkyl groups, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C1-C 12 Alkenyl, substituted C1-C 12 Alkenyl; where if each X is O, then R 5U It is neither H nor CH3 (which are unmodified uracil and unmodified thymine, respectively).

[0239] In some embodiments, the modified cytosine has structure (IV): IV Where: X is O or S, R 4C It is N(R) a (R) b ); R 5C It is H, OH, halogen, O-Cl-C 12 Alkyl, O-C1-C 12 Substituted alkyl groups, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C1-C 12Alkenyl, substituted C1-C 12 alkenyl; R a and R b Independently, it is H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, acetyl, formyl, or together forming a 5-7 membered heterocycle; excluding cases where X is O, R 4C It is NH2 and R 5C It is H (unmodified cytosine). As used herein, "5-methylcytosine nucleobase" is modified cytosine, where X is O and R is R. 4C It is NH2, and R 5C It is a methyl group.

[0240] Hypoxanthine has a structure (V): V Hypoxanthine is considered a modified adenine, in which Y 7A It is N and R 7A Does not exist; Y 8A It is C, R 8A It is H, R 1A It is H, R 2A It is H, and R 6A It is oxygenation.

[0241] In some embodiments, the modified nucleobase is selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6, and O-6-substituted purines. In some embodiments, the modified nucleobases are selected from: 5-methylcytosine, 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymidine and 2-thiocytosine, 5-propynyl (-C≡C-CH3)uracil, 5-propynylcytosine, 6-azauracil, 6-azacytosine, 6-azathymidine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halogenated, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy. 8-aza and other 8-substituted purines, 5-halogenated (especially 5-bromine), 5-trifluoromethyl, 5-halogenated uracil and 5-halogenated cytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deadenine, 7-deadenine, 3-deadenine, 3-deadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl4-N-benzoylcytosine, 5-methyl4-N-benzoyluracil, universal bases, hydrophobic bases, heterojunction bases, size-enlarged bases and fluorinated bases. Other modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenthiazin-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp). Modified nucleobases may also include nucleobases in which purine or pyrimidine bases are replaced by other heterocycles (e.g., 7-deadenine, 7-deadenine, 2-aminopyridine, and 2-pyridone). Other nucleobases include those disclosed in Englisch et al., Angewandte Chemie International Edition, 1991, 30, 613; Sanghvi, YS, Chapter 15. Antisense Research and Applications Crooke, ST. and Lebleu, B., eds., CRC Press, 1993, 273-288; and published in Chapters 6 and 15. Antisense Drug Technology Crooke ST., ed., CRC Press, 2008, pp. 163-166 and 442-443.

[0242] Publications teaching the preparation of certain modified nucleobases and other modified nucleobases include, but are not limited to: Rogers people, US 5,134,066; Benner people, US 5,432,272; Matteucci people, US 5,502,177; Froehler people, US 5,594,121; and Cook et al. US 5,681,941.

[0243] In some embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase selected from modified adenine (A) having a structure represented by structure I, modified guanine (G) having a structure represented by structure II, modified thymine (T) or modified uracil (U) having a structure represented by structure III, and modified cytosine (C) having a structure represented by structure IV.

[0244] In some embodiments, each nucleobase of the modified oligonucleotide is selected from unmodified A, unmodified G, unmodified C, unmodified T, unmodified U, and 5-methylcytosine (C). m C).

[0245] In some embodiments, the modified oligonucleotide does not contain any modified nucleobases, and each nucleobase of the modified oligonucleotide is selected from unmodified A, unmodified G, unmodified C, unmodified T, and unmodified U.

[0246] 3. Modified nucleoside interbonds In some embodiments, the oligomers provided herein comprise or consist of modified oligonucleotides containing at least one modified internucleotide bond. Naturally occurring internucleotide bonds in RNA and DNA are 3' to 5' phosphodiester bonds. In this document, unless otherwise stated, all internucleotide bonds between furanyl sugar moieties are 3' to 5' internucleotide bonds. In some embodiments, the nucleosides of the modified oligonucleotide may be linked together using one or more modified internucleotide bonds. Two main classes of internucleotide linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleotide bonds include, but are not limited to, phosphodiester, phosphotriester, methylphosphonate, aminophosphate, thiophosphate (“P=S”), and dithiophosphate (“HS-P=S”), which contain a phosphodiester bond (“P=O”) (also referred to as an unmodified or naturally occurring bond). Representative phosphorus-free nucleoside linker groups include, but are not limited to: methylene methyl imino (-CH2-N(CH3)-O-CH2-), thiodiester, thiocarbamate (-OC(=O)(NH)-S-), siloxane (-O-SiH2-O-), and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Compared to naturally occurring phosphodiester nucleoside links, modified nucleoside links can be used to alter, and typically increase, the nuclease resistance of oligonucleotides.

[0247] In some embodiments, the modified nucleoside interbond is any of those described in WO 2021 / 030778, which is incorporated herein by reference. In some embodiments, the modified nucleoside interbond has the following formula: Each of these nucleoside bonds in the modified oligonucleotide is independent: X is either O or S; R1 is H, a C1-C6 alkyl group, or a substituted C1-C6 alkyl group; and T is SO2R2, C(=O)R3, or P(=O)R4R5, where: R2 is selected from aryl, substituted aryl, heterocycle, substituted heterocycle, aromatic heterocycle, substituted aromatic heterocycle, diazole, substituted diazole, C1-C6 alkoxy, C1-C6 alkyl, C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkyl, substituted C1-C6 alkenyl, substituted C1-C6 alkynyl, and conjugate groups; R3 is selected from aryl, substituted aryl, CH3, N(CH3)2, OCH3 and conjugate groups; R4 is selected from OCH3, OH, C1-C6 alkyl, substituted C1-C6 alkyl, and conjugate groups; and R5 is selected from OCH3, OH, C1-C6 alkyl, and substituted C1-C6 alkyl.

[0248] In some embodiments, the modified nucleoside interbond comprises a methanesulfonylaminophosphate linker having the following formula: In some embodiments, the internucleotide bond has at least one chiral center. In such embodiments, the chiral atom may be prepared as a racemic mixture or as separate enantiomers. Representative internucleotide bonds with chiral centers include, but are not limited to, alkylphosphonates, methanesulfonylaminophosphates, and thiophosphates.

[0249] The methanesulfonyl phosphate nucleoside internucleotide bond contains a chiral center. In some embodiments, the modified oligonucleotide contains ( R p) and / or ( S p) Methanesulfonyl aminophosphate, which are shown in the following formulas, where “Bx” represents a nucleobase: .

[0250] The thiophosphate nucleoside internucleotide bond contains a chiral center. In some embodiments, it includes ( R p) and / or ( S p) The modified oligonucleotides of thiophosphates each contain one or more of the following formulas, where "Bx" represents a nucleobase: Modified oligonucleotides containing nucleotide interseptal bonds with chiral centers can be prepared as groups of modified oligonucleotides containing stereorandom nucleotide interseptal bonds, or as groups of modified oligonucleotides containing such nucleotide interseptal bonds exhibiting a specific stereochemical configuration. In some embodiments, the group of modified oligonucleotides contains phosphate thioester nucleotide interseptal bonds, wherein all of the phosphate thioester nucleotide interseptal bonds are stereorandom. In some embodiments, the group of modified oligonucleotides contains methanesulfonyl phosphate nucleotide interseptal bonds, wherein all of the methanesulfonyl phosphate nucleotide interseptal bonds are stereorandom. Such modified oligonucleotides can be produced using a randomly selected synthetic method that induces a stereochemical configuration for each nucleotide interseptal bond with a chiral center. Nevertheless, each individual nucleotide interseptal bond with a chiral center in each individual oligonucleotide molecule has a defined stereochemical configuration. In some embodiments, the modified oligonucleotide clusters are enriched with modified oligonucleotides comprising one or more specific thiophosphate and / or methanesulfonylaminophosphate nucleoside bonds, each independently in a specific, independently selected stereochemical configuration (e.g., Rp or Sp). In some embodiments, the specific configuration of the specific thiophosphate and / or methanesulfonylaminophosphate bond is present in at least 65%, 70%, 80%, 90%, or 99% of the molecules in the cluster. In some embodiments, the specific configuration of the specific thiophosphate and / or methanesulfonylaminophosphate bond is present in at least 70% of the molecules in the cluster. In some embodiments, the specific configuration of the specific thiophosphate and / or methanesulfonylaminophosphate bond is present in at least 80% of the molecules in the cluster. In some embodiments, the specific configuration of the specific thiophosphate and / or methanesulfonylaminophosphate bond is present in at least 90% of the molecules in the cluster. In some embodiments, specific configurations of particular thiophosphate bonds and / or methanesulfonyl phosphate bonds are present in at least 99% of the molecules in the group. Such groups of chiral-enriched modified oligonucleotides can be produced using synthetic methods known in the art. For example The methods described in the following literature: Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res . 42, 13456 (2014) and WO 2017 / 015555.

[0251] In some embodiments, the modified oligonucleotide clusters are enriched with at least one modified oligonucleotide having a (Sp) conformation of a thiophosphate and / or a methanesulfonamide phosphate. In some embodiments, the modified oligonucleotide clusters are enriched with at least one modified oligonucleotide having a (Rp) conformation of a thiophosphate and / or a methanesulfonamide phosphate.

[0252] Unless otherwise stated, the internucleotide bonds of the chiral centers of the modified oligonucleotides described herein may be stereorandom or have a specific stereochemical configuration.

[0253] Certain nucleoside interbonds with reduced charge (referred to as "neutral nucleoside interbonds") have been described. Such neutral nucleoside interbonds include, but are not limited to: phosphate triesters, methylphosphonates, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formaldehyde (3'-O-CH2-O-5'), methoxypropyl (MOP), and thioformaldehyde (3'-S-CH2-O-5'). Other neutral nucleoside interbonds include nonionic bonds, comprising a mixture of N, O, S, and CH2 components.

[0254] In some embodiments, the modified oligonucleotide comprises one or more inverted nucleosides, wherein the sugar moiety is linked via 3' to 3' and / or 5' to 5', as follows: , Each Bx represents any nucleobase independently.

[0255] In some embodiments, the reverse nucleoside is at the terminal end (i.e., the last nucleoside at one end of the oligonucleotide), so there will be only one of the aforementioned internucleotide bonds. In some such embodiments, additional features (such as conjugation groups) may be attached to the reverse nucleoside. Such terminal reverse nucleosides may be attached to either end or both ends of the oligonucleotide.

[0256] In some embodiments, the inverted nucleoside lacks a nucleobase (it is a debaseted nucleoside). In some such embodiments, additional features (e.g., conjugation groups) are attached to the inverted debaseted nucleoside. The terminal inverted nucleoside may be attached to either end or both ends of the oligonucleotide.

[0257] In some embodiments, the nucleosides are linked at 2' to 5' instead of 3' to 5'. Such a linkage between two nucleosides is shown below.

[0258] , Each Bx represents any nucleobase.

[0259] B. motif In some embodiments, the modified oligonucleotide comprises one or more modified nucleosides comprising a modified sugar moiety. In some embodiments, the modified oligonucleotide comprises one or more modified nucleosides comprising a modified nucleotide. In some embodiments, the modified oligonucleotide comprises one or more modified nucleotide interbonds. In some embodiments, the modified, unmodified, and differently modified sugar moiety, nucleotide, and / or nucleotide interbond of the modified oligonucleotide defines a pattern or motif. In some embodiments, the patterns of the sugar moiety, nucleotide, and nucleotide interbond are each independent of each other. Therefore, the modified oligonucleotide can be described by its sugar motif, nucleotide motif, and / or nucleotide interbond motif (as used herein, the nucleotide motif describes modifications to the nucleotide sequence independent of the nucleotide sequence).

[0260] 1. Glycosylation In some embodiments, the modified oligonucleotide comprises one or more types of modified sugars and / or unmodified sugar motifs arranged along the oligonucleotide or its regions in a defined pattern or glycomolecular motif. In some cases, such glycomolecular motifs include, but are not limited to, any of the sugar modifications discussed herein.

[0261] In some embodiments, at least one nucleoside of the antisense oligonucleotide and / or the sense oligonucleotide comprises a modified sugar moiety. In some embodiments, at least one nucleoside of the antisense oligonucleotide and / or the sense oligonucleotide comprises a modified furanyl glycoside or a sugar substitute. In some embodiments, the sugar moiety of the antisense oligonucleotide is modified, wherein the modified sugar moiety is selected from 2'-F, 2'-MOE, 2'-OMe, 2'-NMA, 2'-deoxy, and FHNA. In some embodiments, the sugar moiety of the sense oligonucleotide is modified, wherein the modified sugar moiety is selected from 2'-F, 2'-MOE, 2'-OMe, and 2'-deoxy.

[0262] In some embodiments, the modified oligonucleotide comprises or is composed of a region having a fully modified glycomolecular motif. In such embodiments, each nucleotide of the fully modified region of the modified oligonucleotide comprises a modified sugar motif. In some embodiments, each nucleotide of the entire modified oligonucleotide comprises a modified sugar motif, and this oligonucleotide is referred to as a fully modified oligonucleotide. In some embodiments, each nucleotide of a uniformly modified oligonucleotide is a 2'-substituted nucleotide containing the same 2'-substituent. In some embodiments, every other nucleotide of a fully modified oligonucleotide contains the same 2'-substituent, thereby producing alternating 2'-substituents.

[0263] In some embodiments, the modified oligonucleotide includes a deoxygenated region. In some embodiments, each nucleotide in the deoxygenated region is a deoxynucleoside. In some embodiments, each nucleotide in the deoxygenated region is a 2'-β-D-deoxynucleoside. In some embodiments, the deoxygenated region consists of 5 to 12 or 7 to 12 linked nucleotides. In some embodiments, the deoxygenated region consists of 6, 7, 8, 9, 10, or 6 to 10 linked nucleotides. In some embodiments, at least one nucleotide in the deoxygenated region contains a modified sugar moiety. In some embodiments, exactly one nucleotide in the deoxygenated region contains a modified sugar moiety. In some embodiments, two or three nucleotides in the deoxygenated region contain modified sugar moieties.

[0264] In some embodiments, the deoxygenated region is connected on the 5' side by a 5' outer region and on the 3' side by a 3' outer region, the 5' outer region being composed of connected 5' outer region nucleosides, and the 3' outer region being composed of connected 3' outer region nucleosides; wherein the most 3' nucleoside of the 5' outer region is a modified nucleoside, and the most 5' nucleoside of the 3' outer region is a modified nucleoside. At least one nucleoside in the 5' outer region contains a modified sugar moiety, and at least one nucleoside in the 3' outer region contains a modified sugar moiety. These three regions (5' outer region, deoxygenated region, and 3' outer region) form a continuous sequence of nucleosides. In some embodiments, the sugar moiety of the most 3' nucleoside in the 5' outer region and the sugar moiety of the most 5' nucleoside in the 3' outer region are each different from the sugar moiety of the corresponding adjacent nucleoside in the deoxygenated region, thereby defining the boundary between the 5' outer region, the deoxygenated region, and the 3' outer region. In some embodiments, each nucleoside in the 5' outer region and each nucleoside in the 3' outer region contains a modified sugar moiety. In some embodiments, the nucleotides within the 5' outer region contain the same sugar modification. In some embodiments, the nucleotides within the 5' outer region contain two or more different sugar modifications. In some embodiments, the nucleotides within the 3' outer region contain the same sugar modification. In some embodiments, the nucleotides within the 3' outer region contain two or more different sugar modifications. In some embodiments, each nucleotide in the 3' outer region and each nucleotide in the 5' outer region contains a modified sugar moiety.

[0265] In some embodiments, the 5' outer region and 3' outer region of the modified oligonucleotide each independently contain 1, 2, 3, 4, 5, 6, 7, 8, or 1 to 8 nucleosides. In some embodiments, the 5' outer region contains 1 to 7 nucleosides. In some embodiments, the 5' outer region contains 1 to 6 nucleosides. In some embodiments, the 5' outer region contains 1, 2, 3, 4, 5, 6, 7, or 8 nucleosides. In some embodiments, the 5' outer region contains 4, 5, or 6 nucleosides. In some embodiments, the 3' outer region contains 1 to 7 nucleosides. In some embodiments, the 3' outer region contains 1 to 6 nucleosides. In some embodiments, the 3' outer region contains 1, 2, 3, 4, 5, 6, 7, or 8 nucleosides. In some embodiments, the 3' outer region contains 4, 5, or 6 nucleosides.

[0266] In some embodiments, each nucleotide in the 5' outer region and each nucleotide in the 3' outer region comprises a 2'-MOE sugar moiety, and each nucleotide in the deoxy region comprises a 2'-β-D-deoxyribosyl sugar moiety. In some embodiments, the modified oligonucleotide comprises a 5' outer region consisting of 5 linked nucleotides, a deoxy region consisting of 10 linked nucleotides, and a 3' outer region consisting of 5 linked nucleotides, wherein each of the 5' outer region nucleotides and each of the 3' outer region nucleotides comprises a 2'-MOE sugar moiety, and each nucleotide in the gap comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0267] In some embodiments, the modified oligonucleotide has a glycosyl motif (5' to 3') of the order eeeeeeddddddddddeeeee; wherein each "d" represents a 2'-β-D-deoxyribosyl sugar motif and each "e" represents a 2'-MOE sugar motif.

[0268] 2. Nucleobase sequence In some embodiments, the modified oligonucleotide comprises modified and / or unmodified nucleosides arranged in a defined pattern or motif along the oligonucleotide or its region. In some embodiments, at least one nucleobase is modified. In some embodiments, each nucleobase is modified. In some embodiments, none of the nucleosides are modified. In some embodiments, each purine or each pyrimidine is modified. In some embodiments, each adenine is modified. In some embodiments, each guanine is modified. In some embodiments, each thymine is modified. In some embodiments, each cytosine is modified. In some embodiments, some or all of the cytosine nucleosides in the modified oligonucleotide are 5-methylcytosine. In some embodiments, all of the cytosine nucleosides are 5-methylcytosine, and all other nucleosides in the modified oligonucleotide are unmodified. In some embodiments, each nucleobase is independently selected from 5-methylcytosine, unmodified cytosine, unmodified thymine, unmodified uracil, unmodified adenine, unmodified guanine, and hypoxanthine. In some embodiments, each nucleobase is selected from 5-methylcytosine, unmodified cytosine, unmodified thymine, unmodified adenine, and unmodified guanine. In some embodiments, each nucleobase is independently selected from unmodified cytosine, unmodified thymine, unmodified uracil, unmodified adenine, and unmodified guanine. In some embodiments, each nucleobase is independently selected from unmodified cytosine, unmodified thymine, unmodified adenine, and unmodified guanine.

[0269] In some embodiments, the modified oligonucleotide comprises a block of modified nucleobases. In some such embodiments, the block is located at the 3' end of the oligonucleotide. In some embodiments, the block is located within three nucleosides at the 3' end of the oligonucleotide. In some embodiments, the block is located at the 5' end of the oligonucleotide. In some embodiments, the block is located within three nucleosides at the 5' end of the oligonucleotide.

[0270] In some embodiments, the oligonucleotide having a spacer motif comprises a nucleoside containing a modified nucleobase. In some such embodiments, a nucleoside containing a modified nucleobase is located in the central interstitial space of the oligonucleotide having the spacer motif. In some such embodiments, the sugar moiety of the nucleoside is a 2'-deoxyribosyl sugar moiety. In some embodiments, the modified nucleobase is selected from 2-thiopyrimidine and 5-propynylpyrimidine.

[0271] 3. Nucleoside interbond motif In some embodiments, the oligonucleotide comprises modified and / or unmodified internucleotide bonds arranged in a defined pattern or motif along the oligonucleotide or its region. In some embodiments, at least one internucleotide linking group is a phosphodiester internucleotide bond (P=O). In some embodiments, at least one internucleotide linking group of the modified oligonucleotide is a thiophosphate internucleotide bond (P=S). In some embodiments, at least one internucleotide linking group of the modified oligonucleotide is a methanesulfonyl phosphate internucleotide bond. In some embodiments, each internucleotide bond of the modified oligonucleotide is independently selected from thiophosphate internucleotide bonds, phosphodiester internucleotide bonds, and methanesulfonyl phosphate internucleotide bonds. In some embodiments, each internucleotide bond of the modified oligonucleotide is independently selected from thiophosphate internucleotide bonds and phosphodiester internucleotide bonds. In some embodiments, each thiophosphate internucleotide bond is independently selected from stereorandom thiophosphate, (… S p) Thiophosphates and ( R p) Thiophosphates. In some embodiments, each methanesulfonyl phosphate nucleoside internucleotide bond is independently selected from stereorandom methanesulfonyl phosphates, ( S p) methanesulfonyl aminophosphate and ( R p) Methanesulfonylaminophosphate.

[0272] In some embodiments, the glycosylation motif of the modified oligonucleotide is a spacer, and all internucleotide bonds within the gap are modified. In some such embodiments, some or all of the internucleotide bonds in the wings are unmodified phosphodiester internucleotide bonds. In some embodiments, the terminal internucleotide bonds are modified. In some embodiments, the glycosylation motif of the modified oligonucleotide is a spacer, and the internucleotide bond motif contains at least one phosphodiester internucleotide bond in at least one wing, wherein the at least one phosphodiester bond is not a terminal internucleotide bond, and the remaining internucleotide bonds are phosphate thioester internucleotide bonds. In some such embodiments, all phosphate thioester internucleotide bonds are stereorandom. In some embodiments, all phosphate thioester bonds in the wing region are (Sp) phosphate thioesters, and the gap contains at least one Sp, Sp, Rp motif. In some embodiments, the modified oligonucleotide cluster enrichment includes modified oligonucleotides containing such internucleotide bond motifs.

[0273] In some embodiments, the modified oligonucleotide contains a nucleoside internucleotide motif (5' to 3') of sooooosssssssssssooss, where each "s" represents a thiophosphate nucleoside internucleotide and each "o" represents a phosphodiester nucleoside internucleotide.

[0274] C. length The length of oligonucleotides can be increased or decreased without eliminating their activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), the ability of a series of oligonucleotides ranging from 13 to 25 nucleotides in length to induce target RNA cleavage in an oocyte injection model was tested. Oligonucleotides of 25 nucleotides in length with 8 or 11 mismatched bases near the end of the oligonucleotide were able to direct specific cleavage of the target RNA, although to a lesser extent than oligonucleotides without mismatches. Similarly, target-specific cleavage was achieved using 13 nucleotide oligonucleotides, including those with 1 or 3 mismatches.

[0275] In some embodiments, the oligonucleotide (including modified oligonucleotides) may have any of a variety of length ranges. In some embodiments, the oligonucleotide consists of X to Y linked nucleosides, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In some such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, provided that X ≤ Y. For example, in some embodiments, the oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 Up to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16-29, 16-30, 17-18, 17-19, 17-20, 17-21, 17-22, 17-23, 17-24, 17-25, 17-26, 17-27, 17-28, 17-29, 17-30, 18-19, 18-20, 18-21, 18-22, 18-23, 18-24, 18-25, 18-26, 18-27, 18-28, 18-2918 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 27, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25 Composed of 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides.

[0276] In some embodiments, the modified oligonucleotide comprises 16 linked nucleosides with no more than 1 to 3 mismatches with the target nucleic acid. In some embodiments, the modified oligonucleotide comprises 17 linked nucleosides with no more than 1 to 3 mismatches with the target nucleic acid. In some embodiments, the modified oligonucleotide comprises 18 linked nucleosides with no more than 1 to 3 mismatches with the target nucleic acid. In some embodiments, the modified oligonucleotide comprises 19 linked nucleosides with no more than 1 to 3 mismatches with the target nucleic acid. In some embodiments, the modified oligonucleotide comprises 20 linked nucleosides with no more than 1 to 3 mismatches with the target nucleic acid. In some embodiments, the modified oligonucleotide comprises 21 linked nucleosides with no more than 1 to 3 mismatches with the target nucleic acid. In some embodiments, the modified oligonucleotide comprises 22 linked nucleosides with no more than 1 to 3 mismatches with the target nucleic acid. In some embodiments, the modified oligonucleotide comprises 23 linked nucleosides with no more than 1 to 3 mismatches with the target nucleic acid.

[0277] In some embodiments, the modified oligonucleotide consists of 12 to 30 linked nucleosides. In some embodiments, the modified oligonucleotide consists of 16 to 25 linked nucleosides. In some embodiments, the modified oligonucleotide consists of 18 to 25 linked nucleosides. In some embodiments, the modified oligonucleotide consists of 18 to 22 linked nucleosides. In some embodiments, the modified oligonucleotide consists of 19 to 20 linked nucleosides. In some embodiments, the modified oligonucleotide consists of 16 linked nucleosides. In some embodiments, the modified oligonucleotide consists of 17 linked nucleosides. In some embodiments, the modified oligonucleotide consists of 18 linked nucleosides. In some embodiments, the modified oligonucleotide consists of 19 linked nucleosides. In some embodiments, the modified oligonucleotide consists of 20 linked nucleosides.

[0278] D. Modified oligomers The oligomers provided herein comprise one or more modifications introduced into the oligonucleotide (e.g., modified sugar moieties, modified nucleotides, modified internucleotide bonds, and / or combinations thereof). In some embodiments, the modified oligonucleotides are characterized by the modified motif and the total length. In some embodiments, such parameters are independent of each other. Therefore, unless otherwise stated, each internucleotide bond of an oligonucleotide having one or more modified sugar moieties and / or sugar motifs is independently modified or unmodified, and may follow or not follow a sugar modification pattern. For example, internucleotide bonds within regions containing certain sugar-modified oligonucleotides may be the same or different from each other, and may be the same or different from internucleotide bonds in regions containing oligonucleotides with different sugar modifications. Similarly, regardless of the sugar modification pattern and internucleotide bonds, such modified oligonucleotides may contain one or more modified nucleotides. Unless specifically stated otherwise, all modifications are independent of the nucleotide sequence.

[0279] E. Group of modified oligonucleotides A group of modified oligonucleotides (where all modified oligonucleotides in the group have the same molecular formula) can be a stereorandom group or a chiral enriched group. In a stereorandom group, all chiral centers of all oligonucleotides in the modified group are stereorandom. In a chiral enriched group, at least one specific chiral center in the modified oligonucleotides of the group is not stereorandom. In some embodiments, the modified oligonucleotides in the chiral enriched group are enriched for the β-D-ribosyl sugar moiety, and all thiophosphate nucleoside internucleotides are stereorandom. In some embodiments, the modified oligonucleotides in the chiral enriched group are enriched for both the β-D-ribosyl sugar moiety and at least one specific thiophosphate nucleoside internucleotide and / or a methanesulfonyl phosphate nucleoside internucleotide with a specific stereochemical configuration.

[0280] F. Nucleobase sequence In some embodiments, the oligonucleotide (unmodified or modified) is further described by its nucleotide sequence. In some embodiments, the oligonucleotide (or a portion thereof) has a nucleotide sequence complementary to the second linked nucleoside chain (e.g., another oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid). In some embodiments, a region of the oligonucleotide has a nucleotide sequence complementary to the second linked nucleoside chain or its region. In some embodiments, the nucleotide sequence of the region or the entire length of the oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second linked nucleoside chain or its region.

[0281] II. Oligomeric distreptides Some embodiments relate to oligomers comprising oligomeric duplexes. In some embodiments, the oligomers provided herein comprise a modified oligonucleotide having a target region nucleobase sequence complementary to a sequence in a TUBB4A target nucleic acid, and pairing with a second oligonucleotide to form an oligomeric duplex. In some embodiments, the oligomeric duplex comprises a first modified oligonucleotide having a target region complementary to a target region of a TUBB4A target nucleic acid, and a second oligonucleotide having a duplexed region complementary to the first modified oligonucleotide or its region. In some embodiments, the second oligonucleotide is a modified oligonucleotide.

[0282] In some embodiments, the oligoduplex comprises a first modified oligonucleotide having a targeting region complementary to the target region of the TUBB4A target nucleic acid, and a second modified oligonucleotide having a double-stranded region complementary to the first modified oligonucleotide or its region. In some embodiments, the oligoduplex is part of an oligomerizing agent comprising or consisting of: (1) the first modified oligonucleotide, (2) the second oligonucleotide, and (3) optional terminal groups and / or conjugation groups. Any one or both modified oligonucleotides of the oligoduplex may be linked to a conjugation group. Any one or both modified oligonucleotides of the oligoduplex may contain terminal groups. Each modified oligonucleotide of the oligoduplex may include non-complementary or unpaired protruding nucleosides. In some embodiments, the two modified oligonucleotides have at least one mismatch relative to each other.

[0283] In some embodiments, the oligoduplex comprises: a first modified oligonucleotide containing a targeting region comprising at least 12 oligonucleotide subunits, wherein the nucleotide sequence of the targeting region is at least 80% complementary to the nucleotide sequence of the target region of the TUBB4A nucleic acid; and a second modified oligonucleotide containing a double-stranded region comprising at least 12 oligonucleotide subunits, wherein the nucleotide sequence of the double-stranded region of the second modified oligonucleotide is complementary to the nucleotide sequence of the double-stranded region of the first modified oligonucleotide. For example The nucleobase sequence of the first modified oligonucleotide (target region) is at least 80% complementary. In some embodiments, the target region of the first modified oligonucleotide contains the same number of subunits as the target region of the TUBB4A nucleic acid; that is, there are no gaps or bulges. In some embodiments, the double-stranded region of the second modified oligonucleotide contains the same number of subunits as the double-stranded region of the first modified oligonucleotide. In some embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In some embodiments, the nucleobase sequence of the double-stranded region of the second modified oligonucleotide is of equal length to the region of the first modified oligonucleotide (target region). For example The nucleobase sequence of the target region is at least 90%, at least 95%, at least 98%, or 100% complementary. In some embodiments, the second modified oligonucleotide is a sense oligonucleotide. In some embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In some embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide.

[0284] In any of the oligoduplexes described herein, at least one nucleotide of the first modified oligonucleotide and / or the second modified oligonucleotide comprises a modified sugar moiety. Examples of suitable modified sugar moieties include, but are not limited to, modified furanyl glycan moieties, such as, for example, non-bicyclic modified sugar moieties, such as 2'-MOE sugar moieties, 2'-F sugar moieties, 2'-OMe sugar moieties, or 2'-NMA sugar moieties; or bicyclic sugar moieties, such as furanyl glycan moieties comprising a 4'-2' bridge selected from -CH2-O- and -CH(CH3)-O-. In some embodiments, at least one nucleotide of the first modified oligonucleotide and / or at least one nucleotide of the second modified oligonucleotide comprises an unmodified DNA sugar moiety. In some embodiments, at least 80%, at least 90%, or 100% of the nucleotide sugar moiety of the first modified oligonucleotide and / or at least 80%, at least 90%, or 100% of the nucleotide sugar moiety of the second modified oligonucleotide are independently selected from the 2'-F sugar moiety, the 2'-MOE sugar moiety, the 2'-OMe sugar moiety, and the 2'-NMA sugar moiety. In some embodiments, at least 80%, at least 90%, or 100% of the nucleotide sugar moiety of the first modified oligonucleotide and / or at least 80%, at least 90%, or 100% of the nucleotide sugar moiety of the second modified oligonucleotide are independently selected from the 2'-F sugar moiety, the 2'-MOE sugar moiety, the 2'-OMe sugar moiety, the 2'-NMA sugar moiety, and an unmodified DNA sugar moiety. In some embodiments, at least 80%, at least 90%, or 100% of the nucleotide sugar moiety of the first modified oligonucleotide and at least 80%, at least 90%, or 100% of the nucleotide sugar moiety of the second modified oligonucleotide are independently selected from 2'-F sugar moiety, 2'-MOE sugar moiety, 2'-OMe sugar moiety, 2'-NMA sugar moiety and unmodified DNA sugar moiety.

[0285] In some embodiments, in the oligoduplexes provided herein, at least one nucleoside of the first modified oligonucleotide and / or at least one nucleoside of the second modified oligonucleotide comprises a sugar substitute. Examples of suitable sugar substitutes include, but are not limited to: cyclic sugar substitutes, such as morpholino, hexadiol nucleic acid (HNA), fluorohexadiol nucleic acid (FHNA); and acyclic sugar substitutes, such as glycol nucleic acid (GNA) and unlocked nucleic acid (UNA). In some embodiments, at least one nucleoside of the first modified oligonucleotide comprises a cyclic sugar substitute, which is FHNA. In some embodiments, at least 80%, at least 90%, or 100% of the sugar moiety of the first modified oligonucleotide and / or the second modified oligonucleotide is independently selected from the 2'-F sugar moiety, the 2'-MOE sugar moiety, the 2'-OMe sugar moiety, the 2'-NMA sugar moiety, the unmodified DNA sugar moiety, and FHNA. In some embodiments, at least 80%, at least 90%, or 100% of the nucleotide sugar moieties of the first modified oligonucleotide and the second modified oligonucleotide are independently selected from 2'-F sugar moieties, 2'-MOE sugar moieties, 2'-OMe sugar moieties, 2'-NMA sugar moieties, unmodified DNA sugar moieties, and FHNA.

[0286] III. Oligopolymer In some embodiments, this document provides an oligomer comprising one or more modified oligonucleotides and optionally one or more conjugation groups and / or terminal groups. In some embodiments, the oligomer comprises one or more modified oligonucleotides and one or more conjugation groups. In some embodiments, the oligomer comprises one or more modified oligonucleotides and one or more terminal groups. The conjugation group comprises or consists of a conjugation moiety and a conjugation linker connecting the conjugation moiety to the oligonucleotide. The conjugation group or terminal group may be attached to the 3' end and / or the 5' end of the oligonucleotide and / or at any internal position of the oligonucleotide. In some embodiments, the conjugation group is attached to the 2' position of the nucleoside of the modified oligonucleotide. In some embodiments, the conjugation group is attached via a modified sugar moiety or a modified nucleoside internucleotide bond. In some embodiments, the oligomer comprises a modified oligonucleotide, a cell-targeting moiety, and a conjugation linker.

[0287] A. Conjugate group The conjugation group comprises a conjugation moiety and a conjugation linker. In some embodiments, the oligonucleotide is covalently attached to one or more conjugation groups. In some embodiments, the conjugation moiety modifies one or more properties of the attached oligonucleotide compared to the same oligonucleotide lacking the conjugation moiety, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. In some embodiments, the conjugation moiety imparts novel properties to the attached oligonucleotide.

[0288] In some embodiments, the conjugation group comprises a small molecule pharmaceutical substance (e.g., an active pharmaceutical ingredient), an aliphatic chain, a lipid, a peptide, a protein, a hydrocarbon, a polyamine, a polyamide, a polyether, a thioether, an aptamer, an antibody, an antibody fragment, a VHH camel antibody fragment, a VNAR shark antibody fragment, a vitamin, a fatty acid, a carbohydrate, an intercalator, a reporter molecule, or an alkyl moiety, such as C22 alkyl, C20 alkyl, C17 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, or C5 alkyl, wherein the alkyl chain optionally has one or more unsaturated bonds. In some embodiments, the conjugation group comprises a 6-palmitoylaminohexyl moiety or a 2-(hydroxymethyl)-6-palmitoylaminohexyl moiety. In some embodiments, the conjugation group comprises a cell-targeting moiety.

[0289] In some embodiments, the conjugation of one or more carbohydrate moieties to the modified oligonucleotide can alter one or more properties of the modified oligonucleotide. In some embodiments, the carbohydrate moieties are attached to the modified subunits of the modified oligonucleotide. For example, the ribose of one or more ribonucleotide subunits of the modified oligonucleotide can be replaced by another moieties (e.g., a non-carbohydrate (preferably cyclic) carrier with a carbohydrate ligand attached). The ribonucleotide subunits in which the ribose has been so replaced are referred herein as ribose-substituted modified subunits (RRMS), which are the modified sugar moieties. The cyclic carrier can be a carbocyclic system, i.e., one or more ring atoms can be heteroatoms, such as nitrogen, oxygen, or sulfur. The cyclic carrier can be a monocyclic system or can contain two or more rings, such as fused rings. The cyclic carrier can be a fully saturated cyclic system, or it can contain one or more double bonds.

[0290] In some embodiments, the conjugation group imparts new properties to the attached oligonucleotide. For example It can detect fluorophores or reporter groups of oligonucleotides. Some conjugation groups and conjugation moieties have been previously described, such as the cholesterol moiety (Letsinger et al., ...). Proc. Natl. Acad. Sci. USA,1989, 86, 6553-6556), bile acids (Manoharan et al., Bioorg. Med. Chem. Lett ., 199 4 , 4 , 1053-1060), sulfides ,For example Hexyl-S-triphenylmethylthiol (Manoharan et al., Ann. NY Acad. Sci ., 1992, 660 , 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3 , 2765- 277 0), thiocholesterol (Oberhauser et al., Nucl. Acids Res ., 1992, 20 (533-538), aliphatic chains, For example Dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10 , 1111-1118; Kabanov et al., FEBS Lett ., 1990, 259 , 327-330; Svinarchuk et al., Biochimie , 1993, 75 , 49-54), phospholipids, such as di-hexadecyl-racemic-glycerol or triethylammonium 1,2-di-O-hexadecyl-racemic-glycerol-3-H-phosphonate (Manoharan et al., Tetrahedron Lett ., 1995, 36 , 3651-3654; Shea et al., Nucl. Acids Res ., 1990, 18 , 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides , 1995, 14 (969-973) or the adamantane palmitoyl acetate moiety (Mishra et al., Biochim. Biophys. Acta , 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholate moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277 , 923-937), tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids , 2015, 4 , e220; and Nishina et al., Molecular Therapy 2008, 16 , 734-740), or GalNAc cluster ( For example (WO2014 / 179620).

[0291] In some embodiments, the conjugation group is a lipid having the following structure: .

[0292] Methods for preparing conjugated oligonucleotides are known in the art and / or described herein. For example, in a non-limiting solid-phase method for the large-scale synthesis of conjugated oligonucleotides, a monomethoxytriphenylmethyl (MMT)-protected 5' or (3')-amino-modified oligonucleotide intermediate is generated using an aminophosphate monomer coupling method and detrimethylated as described in US Patent No. 10,450,342. The 5' (or 3') MMT-protected amino group can be linked to the oligonucleotide via a linker group such as an alkyl phosphate group, and the MMT group can be removed from the oligonucleotide via solution-phase detrimethylation at specific temperatures and pH. In some embodiments, the detrimethylated oligonucleotide is then reacted with a conjugating group (e.g., GalNAc3) to generate the conjugated oligonucleotide.

[0293] 1. Conjugate portion The conjugated portion includes, but is not limited to, intercalating agents, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin portions, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, bile acid portions, folic acid, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinones, adamantane, acridine, fluorescein, rhodamine, coumarin, fluorophores, and dyes.

[0294] In some embodiments, the conjugate moiety comprises a small molecule pharmaceutical substance, such as aspirin, warfarin, phenylbutazone, ibuprofen, sulprofen, fenbufen, ketoprofen, etc. S )-(+)-Praprofen, carbofen, tansyl sarcosinate, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, leucovorin, benzothiazide, chlorothiazide, diazepam, indomethacin, barbiturates, cephalosporins, sulfonamides, antidiabetic drugs, antibacterial agents or antibiotics.

[0295] In some embodiments, the conjugate portion is selected from any of the following: C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.

[0296] In some embodiments, the conjugate portion is selected from any of the following: C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, wherein the alkyl chain has one or more unsaturated bonds.

[0297] 2. Conjugate joint In some embodiments, the oligomer comprises (modified or unmodified) an oligonucleotide and a conjugation group, wherein the conjugation group comprises or consists of a conjugation moiety and a conjugation linker. The conjugation moiety is attached to the oligonucleotide via the conjugation linker. In some embodiments, the conjugation linker is a single chemical bond (i.e., the conjugation moiety is directly attached to the oligonucleotide via a single bond). In some embodiments, the conjugation linker comprises one or more atoms. In some embodiments, the conjugation linker comprises an oligomer of a chain structure, such as a hydrocarbon chain, or a repeating unit, such as an ethylene glycol, nucleoside, or amino acid unit. In some embodiments, the oligonucleotide is a modified oligonucleotide.

[0298] In some embodiments, the conjugation connector comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxyamino groups. In some such embodiments, the conjugation connector comprises groups selected from alkyl, amino, oxo, amide, and ether groups. In some embodiments, the conjugation connector comprises groups selected from alkyl and amide groups. In some embodiments, the conjugation connector comprises groups selected from alkyl and ether groups. In some embodiments, the conjugation connector comprises at least one phosphorus moiety. In some embodiments, the conjugation connector comprises at least one phosphate group. In some embodiments, the conjugation connector comprises at least one neutral linker group.

[0299] In some embodiments, the conjugate connector (including the conjugate connector described above) is a bifunctional connection portion. For exampleBifunctional linkers are known in the art for attaching conjugate moieties to compounds, such as the oligonucleotides provided herein. Generally, a bifunctional linker comprises at least two functional groups. One functional group is selected to bind to a specific site on the compound, while the other functional group is selected to bind to the conjugate group. Examples of functional groups used in bifunctional linkers include, but are not limited to, electrophilic reagents for reacting with nucleophilic groups and nucleophilic reagents for reacting with electrophilic groups. In some embodiments, the bifunctional linker comprises one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl groups.

[0300] Examples of conjugation linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxanoic acid (ADO), 4-(N-maleimidemethyl)cyclohexane-1-carboxylic acid succinimide (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugation linkers include, but are not limited to, substituted or unsubstituted C1-C... 10 Alkyl, substituted or unsubstituted C2-C 10 alkenyl or substituted or unsubstituted C2-C 10 The alkynyl group, wherein a non-limiting list of preferred substituents includes hydroxyl, amino, alkoxy, carboxyl, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl. In some embodiments, the conjugate linker comprises pyrrolidine.

[0301] In some embodiments, the conjugate linker comprises 1-10 linker-nucleosides. In some embodiments, the conjugate linker comprises 2-5 linker-nucleosides. In some embodiments, the conjugate linker comprises exactly 3 linker-nucleosides. In some embodiments, the conjugate linker comprises a TCA motif. In some embodiments, such linker-nucleosides are modified nucleosides. In some embodiments, such linker-nucleosides comprise a modified sugar moiety. In some embodiments, the linker-nucleosides are unmodified. In some embodiments, the linker-nucleosides comprise an optionally protected heterocyclic base selected from purines, substituted purines, pyrimidines, or substituted pyrimidines. In some embodiments, the cleavable portion is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. Typically, the linker nucleoside needs to be cleaved from the oligomer after it reaches the target tissue. Therefore, linker nucleosides are usually linked to each other by cleavable bonds and to the remainder of the oligomer. In some embodiments, such cleavable bonds are phosphodiester bonds.

[0302] In this document, linker-nucleosides are not considered part of an oligonucleotide. Therefore, in embodiments where the oligomer compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and / or a specified percentage of complementarity with a reference nucleic acid, and where the oligomer compound also comprises a conjugate group containing a linker linker (which contains a linker-nucleoside), those linker-nucleosides are not counted in the length of the oligonucleotide and are not used to determine the percentage of complementarity between the oligonucleotide and the reference nucleic acid. For example, the oligomer compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides; and (2) a conjugate group containing 1-10 linker-nucleosides consecutive to the nucleosides of the modified oligonucleotide. The total number of consecutively linked nucleosides in such an oligomer compound exceeds 30. Alternatively, the oligomer compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and without a conjugate group. The total number of consecutively linked nucleosides in such an oligomer compound does not exceed 30. Unless otherwise stated, the linker linker contains no more than 10 linker-nucleosides. In some embodiments, the conjugate linker contains no more than 5 linker-nucleosides. In some embodiments, the conjugate linker contains no more than 3 linker-nucleosides. In some embodiments, the conjugate linker contains no more than 2 linker-nucleosides. In some embodiments, the conjugate linker contains no more than 1 linker-nucleoside.

[0303] In some embodiments, it is necessary to cleave the conjugated group from the oligonucleotide. For example, in some cases, oligomers containing a specific conjugated moiety are better absorbed by a particular cell type, but once the oligomer has been absorbed, the conjugated group needs to be cleaved to release the unconjugated or parental oligonucleotide. Therefore, some conjugated linkers may contain one or more cleavable moieties. In some embodiments, the cleavable moieties are cleavable bonds. In some embodiments, the cleavable moieties are atomic groups containing at least one cleavable bond. In some embodiments, the cleavable moieties contain atomic groups having one, two, three, four, or more than four cleavable bonds. In some embodiments, the cleavable moieties are selectively cleaved within a cell or subcellular compartment (such as a lysosome). In some embodiments, the cleavable moieties are selectively cleaved by endogenous enzymes (such as nucleases).

[0304] In some embodiments, the cleavable bond is selected from one or two esters of amides, esters, ethers, phosphate diesters, phosphate esters, carbamates, or disulfides. In some embodiments, the cleavable bond is one or two esters of phosphate diesters. In some embodiments, the cleavable portion comprises a phosphate ester or a phosphate diester. In some embodiments, the cleavable portion is a phosphate bond between an oligonucleotide and a conjugate portion or conjugate group.

[0305] In some embodiments, the cleavable portion comprises or consists of one or more linker-nucleosides. In some such embodiments, the one or more linker-nucleosides are linked to each other by cleavable bonds and / or to the remainder of the oligomeric compound. In some embodiments, such cleavable bonds are unmodified phosphodiester bonds. In some embodiments, the cleavable portion is a 2'-deoxynucleoside attached to the 3' or 5'-terminal nucleoside of the oligonucleotide via a phosphate nucleoside internucleotide bond and covalently attached to the conjugate linker or the remainder of the conjugate portion via a phosphate ester or thiophosphate bond. In some such embodiments, the cleavable portion is 2'-deoxyadenosine.

[0306] 3. Cell-targeting component In some embodiments, the conjugation group comprises a cell-targeting portion. In some embodiments, the conjugation portion comprises or is composed of a cell-targeting portion. In some embodiments, the cell-targeting portion is capable of interacting with cell surface receptors on cells. In some embodiments, the cell-targeting portion is capable of interacting with cell surface portions on cells. In some embodiments, the cell-targeting portion is capable of binding to cell surface receptors on cells. In some embodiments, the cell-targeting portion is capable of binding to cell surface portions on cells. In some embodiments, when the cell-targeting portion interacts with and / or binds to cell surface receptors and / or cell surface portions, the oligomer containing the cell-targeting portion can be internalized by the cell. In some embodiments, the cell surface receptor is not universally expressed (e.g., the cell surface receptor is undetectable in at least one tissue of a human subject), and the cell-targeting portion selectively delivers the oligomer, modified oligonucleotide, or oligoduplex to the tissue or cell of interest. As a non-limiting example, the tissue of interest may be brain tissue. As a non-limiting example, the cell of interest may be any one or more of neurons and oligodendrocytes.

[0307] In some embodiments, the cell-targeting portion targets neurons. In some embodiments, the cell-targeting portion targets neurotransmitter receptors. In some embodiments, the cell-targeting portion targets neurotransmitter transporters. In some embodiments, the cell-targeting portion targets GABA transporters. See, for example, WO 2011 / 131693, WO 2014 / 064257.

[0308] In some embodiments, the cell-targeting portion has an affinity for the type 1 transferrin receptor (TfR1) (also referred to herein as TfR1 and CD71). In some embodiments, the cell-targeting portion comprises an anti-TfR1 antibody or a fragment thereof. In some embodiments, the cell-targeting portion comprises a protein or peptide capable of binding to TfR1. In some embodiments, the cell-targeting portion comprises an aptamer capable of binding to TfR1. In some embodiments, the anti-TfR1 antibody or a fragment thereof may be any antibody or fragment thereof known in the art, including but not limited to antibodies or fragments thereof described in the following documents: WO 1991 / 004753; WO 2013 / 103800; WO 2014 / 144060; WO 2016 / 081643; WO 2016 / 179257; WO 2016 / 207240; WO 2017 / 221883; WO 2018 / 129384; WO 2018 / 124121; WO 2019 / 151539; WO 2020 / 132584; WO 2020 / 028864; US 7,208,174; US 9,034,329; and US 10,550,188. In some embodiments, the fragment of the anti-TfR1 antibody is F(ab')2, Fab, Fab', Fv, or scFv.

[0309] In some embodiments, the conjugation group comprises a non-antibody protein or peptide capable of binding TfR1. In some embodiments, the protein or peptide capable of binding TfR1 can be any protein or peptide known in the art, including but not limited to those described in the following publications: WO 2019 / 140050; WO 2020 / 037150; WO 2020 / 124032; WO2022 / 026555; WO 2023 / 027125; WO 2023 / 022234; and US 10,138,483. In some embodiments, the peptide is a cyclic peptide, as described in WO 2021 / 167107. In some embodiments, the peptide is a bicyclic peptide referred to as a “bicyclic ligand” selected from those described in WO 2022 / 101633 and WO 2023 / 056388, each of which is incorporated herein by reference.

[0310] In some embodiments, the conjugation group comprises an aptamer capable of binding TfR1. In some embodiments, the aptamer capable of binding TfR1 can be any aptamer known in the art, including but not limited to the aptamers described in the following documents: WO2013 / 163303; WO 2019 / 033051; and WO 2020 / 245198.

[0311] B. certain terminal groups In some embodiments, the oligomer comprises one or more modified oligonucleotides and one or more terminal groups. Examples of terminal groups include, but are not limited to: conjugation groups, capping groups, phosphate moieties, stabilized phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more independently modified or unmodified nucleosides, wherein one or more groups are attached to either or both ends of the oligonucleotide. In some embodiments, one or more terminal groups are attached to either or both ends of the oligonucleotide. In some embodiments, one or more terminal groups are attached at the 3' end and / or the 5' end of the oligonucleotide. In some embodiments, one or more terminal groups are attached at the 3' end of the oligonucleotide. In some embodiments, one or more terminal groups are attached at the 5' end of the oligonucleotide. In some embodiments, one or more terminal groups are attached at the 3' end of the oligonucleotide and one or more terminal groups are attached at the 5' end of the oligonucleotide. In some embodiments, terminal groups are attached at the 3' end and / or the 5' end of the oligonucleotide. In some embodiments, terminal groups are attached at the 3' end of the oligonucleotide. In some embodiments, the terminal group is attached at the 5' end of the oligonucleotide. In some embodiments, the terminal group is attached at the 3' end of the oligonucleotide and at the 5' end of the oligonucleotide.

[0312] In some such embodiments, the oligomer comprises a modified oligonucleotide linked to a terminal group comprising a stabilized 5'-phosphate. In some embodiments, in the oligomeric duplexes provided herein, the terminal group comprising the stabilized phosphate moiety is attached at the 5' end of the modified oligonucleotide. Under biological conditions, the stabilized phosphate moiety results in stabilization of the 5'-phosphate moiety of the 5'-terminal nucleoside of the modified oligonucleotide relative to the stability of the unmodified 5'-phosphate of the unmodified nucleoside. Under biological conditions, the stabilized phosphate group results in stabilization of the 5'-phosphate moiety of the 5'-terminal nucleoside of the oligonucleotide relative to the stability of the unmodified 5'-phosphate of the unmodified nucleoside. Such stabilization of the 5'-phosphate group includes, but is not limited to, resistance to removal by phosphatases. In some embodiments, the stabilized phosphate group comprises cyclopropylphosphonate or (E)-vinylphosphonate. Stabilized 5'-phosphate includes, but is not limited to, 5'-phosphonates, including, but not limited to, 5'-vinylphosphonate, 5'-methylphosphonate, and 5'-cyclopropylphosphonate.

[0313] IV. antisense activity In some embodiments, the oligomer comprises an antisense oligonucleotide capable of hybridizing with a target nucleic acid to produce at least one antisense activity; such oligomers are antisense agents. In some embodiments, the antisense oligonucleotide selectively affects one or more target nucleic acids. Such antisense oligonucleotides comprise a nucleobase sequence capable of hybridizing with one or more target nucleic acids to produce one or more desired antisense activities, and do not hybridize with one or more non-target nucleic acids, or do not hybridize with one or more non-target nucleic acids in a manner that produces significant undesired antisense activity.

[0314] In some embodiments, hybridization of the antisense agent with the target nucleic acid results in the recruitment of proteins that cleave the target nucleic acid (e.g., RNase H or AGO proteins). For example, certain antisense compounds induce RNase H-mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in this RNA:DNA duplex does not need to be unmodified DNA. In some embodiments, antisense compounds that are sufficiently “DNA-like” to elicit RNase H activity are described herein. In some embodiments, one or more non-DNA-like nucleotides in the gap of the spacer oligonucleotide are tolerant.

[0315] In certain antisense activities, antisense oligonucleotides are loaded into an RNA-induced silencing complex (RISC), ultimately leading to the cleavage of the target nucleic acid. For example, some antisense oligonucleotides produce AGO proteins that cleave the target nucleic acid. The antisense oligonucleotides loaded into the RISC are RNAi compounds. RNAi compounds can be double-stranded (siRNA or dsRNAi) or single-stranded (ssRNA). In some embodiments, RNAi agents are capable of RISC-mediated regulation of target nucleic acids in cells. In some embodiments, when antisense oligonucleotides are in standard... in vitro In cellular assays, these compounds are considered to have antisense activity when they reduce or inhibit the amount or activity of target nucleic acids by at least 50%. In some embodiments, such RNAi agents are used in standard... in vitro The assay reduces or inhibits the amount or activity of the target nucleic acid by 25% or more. As used herein, “standard” in vitro "Measurement" refers to the measurements described in Examples 2 and 3. in vitro Assay and its reasonable variations. In some embodiments, the RNAi agent selectively affects one or more target nucleic acids. Such RNAi agents comprise modified oligonucleotides having a nucleobase sequence capable of hybridizing with one or more target nucleic acids, thereby producing one or more desired antisense activities. In some embodiments, the RNAi agent comprises modified oligonucleotides that do not hybridize with one or more non-target nucleic acids or do not hybridize with one or more non-target nucleic acids in a manner that produces significant undesirable antisense activity.

[0316] In some embodiments, hybridization of the antisense oligonucleotide with the target nucleic acid does not result in the recruitment of proteins that cleave the target nucleic acid. In some embodiments, hybridization of the antisense compound with the target nucleic acid causes alterations in the splicing of the target nucleic acid. In some embodiments, hybridization of the antisense oligonucleotide with the target nucleic acid inhibits binding interactions between the target nucleic acid and proteins or other nucleic acids. In some embodiments, hybridization of the antisense oligonucleotide with the target nucleic acid alters the translation of the target nucleic acid.

[0317] Antisense activity can be observed directly or indirectly. In some embodiments, the observation or detection of antisense activity involves the observation or detection of changes in the amount of the target nucleic acid or the protein encoded by the target nucleic acid, changes in the ratio of splice variants of the nucleic acid or protein, and / or phenotypic changes in cells or subjects.

[0318] IV. certain target nucleic acids In some embodiments, the oligomer comprises or is composed of a modified oligonucleotide containing a target region complementary to the nucleobase sequence of a target region of equal length to the target nucleic acid. In some embodiments, the target nucleic acid is an endogenous RNA molecule. In some embodiments, the target nucleic acid encodes a protein. In some such embodiments, the target nucleic acid is selected from mature mRNA and precursor mRNA, including intron regions, exon regions, and untranslated regions. In some embodiments, the target RNA is mature mRNA. In some embodiments, the target nucleic acid is premRNA. In some embodiments, the target region is entirely within an intron. In some embodiments, the target region spans an intron / exon junction. In some embodiments, at least 50% of the target region is within an intron. In some embodiments, the target nucleic acid is non-coding RNA. In some embodiments, the target non-coding RNA is selected from long non-coding RNA, short non-coding RNA, and intronic RNA molecules.

[0319] A. Complementarity / mismatch with target nucleic acids and duplex complementarity In some embodiments, the modified oligonucleotide is complementary to the nucleotide sequence of the target region of the target nucleic acid over the entire length of the modified oligonucleotide. In some embodiments, the modified oligonucleotide is at least 99%, at least 95%, at least 90%, at least 85%, or at least 80% complementary to the target region of the target nucleic acid. In some embodiments, the modified oligonucleotide is at least 80% complementary to the target region of the target nucleic acid over the entire length of the modified oligonucleotide and includes a region that is 100% or completely complementary to the target region of the target nucleic acid. In some embodiments, the length of the completely complementary target region is 6 to 20, 10 to 18, or 18 to 20 nucleotides. Mismatched bases can be introduced without eliminating activity. For example, Gautschi et al. (J. Natl. CancerInst. 93:463-471, March 2001) demonstrated an oligonucleotide that was 100% complementary to bcl-2 mRNA and had 3 mismatches with bcl-xL mRNA. In vitro and In the body It reduces the expression of both bcl-2 and bcl-xL. Furthermore, this oligonucleotide... In the body They exhibited potent antitumor activity. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested the ability of a series of tandem 14-nucleotide oligonucleotides, as well as 28-nucleotide and 42-nucleotide oligonucleotides consisting of sequences of two or three tandem oligonucleotides, respectively, to inhibit the translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14-nucleotide oligonucleotides was able to inhibit translation independently, although at a milder level than the 28- or 42-nucleotide oligonucleotides.

[0320] In some embodiments, the modified oligonucleotide comprises one or more nucleobases that mismatch with the target region of the target nucleic acid. In some embodiments, antisense activity against the target is reduced due to this mismatch, but activity against non-targets is reduced more significantly. Therefore, in some embodiments, the selectivity of the oligonucleotide is improved. In some embodiments, the modified oligonucleotide is at least 80% complementary to the target region of the target nucleic acid over its entire length and comprises no more than one to three mismatches with the target nucleic acid. In some embodiments, the modified oligonucleotide comprises a target region that is at least 80% complementary to the target region of the target nucleic acid over its entire length, and that target region comprises no more than one to three mismatches with the target region.

[0321] In some embodiments, the mismatch is specifically located within an oligonucleotide having a spacer motif. In some embodiments, the mismatch is located at position 1, 2, 3, 4, 5, 6, 7, or 8 at the 5' end of the interstitial region. In some embodiments, the mismatch is located at position 9, 8, 7, 6, 5, 4, 3, 2, or 1 at the 3' end of the interstitial region. In some embodiments, the mismatch is located at position 1, 2, 3, or 4 at the 5' end of the wing region. In some embodiments, the mismatch is located at position 4, 3, 2, or 1 at the 3' end of the wing region.

[0322] B. TUBB4A In some embodiments, the oligomer comprises or is composed of a modified oligonucleotide containing a targeting region complementary to an isolength target region of a target nucleic acid, wherein the target nucleic acid is TUBB4A. In some embodiments, the TUBB4A nucleic acid has the sequence listed in SEQ ID NO: 1 (cDNA of Ensembl transcript IF ENSG00000104833.12, Ensembl Release 109 – February 2023). In some embodiments, contacting cells with an oligomer comprising a modified oligonucleotide reduces the amount of TUBB4A RNA and, in some embodiments, reduces the amount of TUBB4A protein, wherein the modified oligonucleotide contains a targeting region complementary to the isolength target region of SEQ ID NO: 1; in some embodiments, the oligomer is composed of a modified oligonucleotide. In some embodiments, the oligomer compound is composed of a modified oligonucleotide and a conjugation group. In some embodiments, the oligomer is composed of a modified oligonucleotide and one or more terminal groups. In some embodiments, the oligomer consists of a modified oligonucleotide, a conjugation group, and one or more terminal groups.

[0323] In some embodiments, the modified oligonucleotide is an antisense oligonucleotide. In some embodiments, the oligomer is composed of an antisense oligonucleotide. In some embodiments, the oligomer is composed of an antisense oligonucleotide and a conjugation group. In some embodiments, the oligomer is composed of an antisense oligonucleotide and one or more terminal groups. In some embodiments, the oligomer is composed of an antisense oligonucleotide, a conjugation group, and one or more terminal groups. In some embodiments, the oligomer comprises an antisense oligonucleotide containing a targeting region complementary to the target region of the TUBB4A nucleic acid. In some embodiments, the oligomer comprises an antisense oligonucleotide having a targeting region complementary to the target region of the TUBB4A nucleic acid and a sense oligonucleotide having a double-stranded region complementary to the antisense oligonucleotide or its region.

[0324] In some embodiments, the modified oligonucleotide described herein is complementary to the target region of the TUBB4A nucleic acid along the entire length of the modified oligonucleotide. In some embodiments, the modified oligonucleotide is at least 99%, at least 95%, at least 90%, at least 85%, or at least 80% complementary to an equal-length portion of the TUBB4A nucleic acid. In some embodiments, the modified oligonucleotide is at least 80% complementary to the target region of the TUBB4A nucleic acid along the entire length of the modified oligonucleotide and includes a target region that is 100% or completely complementary to the target region of the TUBB4A nucleic acid.

[0325] In some embodiments, the target region of the modified oligonucleotide has a length of 6 to 20, 10 to 18, 14 to 18, 16 to 20, or 18 to 20 nucleotides. In some embodiments, the target region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 consecutive nucleotides. In some embodiments, the target region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 consecutive nucleotides. In some embodiments, the target region constitutes at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the nucleoside subunits of the modified oligonucleotide. In some embodiments, the target region constitutes all nucleoside subunits of the modified oligonucleotide. In some embodiments, the target region of the modified oligonucleotide is at least 99%, at least 95%, at least 90%, at least 85%, or at least 80% complementary to the target region of the TUBB4A nucleic acid. In some embodiments, the target region of the modified oligonucleotide is 100% complementary to the target region of the TUBB4A nucleic acid.

[0326] In some embodiments, the target nucleic acid is an endogenous TUBB4A RNA molecule. In some embodiments, the TUBB4A nucleic acid encodes the TUBB4A protein. In some embodiments, the TUBB4A nucleic acid is a precursor of the nucleic acid encoding the TUBB4A protein. In some such embodiments, the TUBB4A nucleic acid is selected from mature mRNA and precursor mRNA, including introns, exons, and untranslated regions. In some embodiments, the TUBB4A RN is mature mRNA. In some embodiments, the TUBB4A nucleic acid is precursor mRNA.

[0327] In some embodiments, contacting cells with an oligomer complementary to SEQ ID NO: 1 as described herein reduces the amount of TUBB4A RNA in the cells. In some embodiments, contacting cells with an oligomer complementary to SEQ ID NO: 1 as described herein reduces the amount of TUBB4A protein in the cells. In some embodiments, the cells are... In vitro. In some embodiments, contacting cells in a subject with an oligomer complementary to SEQ ID NO: 1 described herein improves one or more symptoms of a TUBB4A-related neurodegenerative disease or condition. In some embodiments, the TUBB4A-related neurodegenerative disease or condition is TUBB4A-associated leukodystrophy. In some embodiments, the symptoms are any one of the following: hypomyelination, demyelination, dysarthria, dystonia, ataxia, spasticity, cerebellar and / or basal ganglia atrophy, visual impairment, rigidity, microcephaly, focal cortical dysplasia, seizures, and early childhood death.

[0328] In some embodiments, the oligomers described herein that are complementary to SEQ ID NO: 1 are able to be used in standard cell assays. in vitro The detectable amount of TUBB4A RNA is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In some embodiments, the oligomers complementary to SEQ ID NO: 1 described herein are capable of reducing the detectable amount of TUBB4A RNA. in vitro The detectable amount of TUBB4A protein is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In some embodiments, the oligomeric compound complementary to SEQ ID NO: 1 described herein is capable of reducing the detectable amount of TUBB4A RNA in the subject's CSF by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In some embodiments, the oligomeric compound complementary to SEQ ID NO: 1 described herein is capable of reducing the detectable amount of TUBB4A protein in the subject's CSF by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.

[0329] C. Certain target nucleic acids in certain tissues In some embodiments, the oligomer comprises or is composed of a modified oligonucleotide containing a targeting region complementary to an iso-length target region of the TUBB4A nucleic acid, wherein the TUBB4A nucleic acid is expressed in pharmacology-relevant tissues. In some embodiments, pharmacology-relevant cells are cells expressing TUBB4A. In some embodiments, pharmacology-relevant tissues are cells and tissues constituting the central nervous system. Such tissues include the putamen, white matter, cerebellum, brainstem, spinal cord, cortex, and basal ganglia. Such cells include neurons and oligodendrocytes.

[0330] V. Some methods and uses Some embodiments provided herein relate to methods for reducing or inhibiting TUBB4A expression or activity by applying an oligomeric compound, oligoduplex, or antisense agent (any of which comprises a modified oligonucleotide having a nucleobase sequence complementary to the TUBB4A nucleic acid), which may be used to treat, prevent, or improve diseases or conditions associated with TUBB4A overexpression in a subject. In some embodiments, the disease or condition is a TUBB4A-related neurodegenerative disease or condition. In some embodiments, the disease or condition is associated with TUBB4A. In some embodiments, the TUBB4A-related disease or condition is TUBB4A-associated leukodystrophy or type 4 dystonia (DYT4). In some embodiments, TUBB4A-associated leukodystrophy is selected from TUBB4A-leukodystrophy with onset in infancy, solitary hypomyelination with spastic quadriplegia, and hypomyelination with basal ganglia and cerebellar atrophy (H-ABC).

[0331] In some embodiments, the method includes administering to a subject an oligonucleotide comprising or composed of a modified oligonucleotide having a target region having a nucleobase sequence complementary to an isolong target region of the TUBB4A nucleic acid. In some embodiments, the subject has or is at risk of developing a TUBB4A-related neurodegenerative disease or condition. In some embodiments, the subject has or is at risk of developing TUBB4A-associated leukodystrophy or DYT4.

[0332] In some embodiments, a method of treating a TUBB4A-related neurodegenerative disease or condition includes administering to a subject a therapeutically effective amount of an oligomer comprising a modified oligonucleotide having a target region having a nucleobase sequence complementary to an iso-length target region of the TUBB4A nucleic acid, thereby treating the subject. In some embodiments, the subject has or is at risk of developing a TUBB4A-related neurodegenerative disease or condition. In some embodiments, the disease or condition is associated with elevated TUBB4A levels in the subject. In some embodiments, the subject has or is at risk of developing TUBB4A-associated leukodystrophy or DYT4A. In some embodiments, TUBB4A-associated leukodystrophy is selected from TUBB4A-leukodystrophy with onset in infancy, solitary hypomyelination with spastic quadriplegia, and hypomyelination with basal ganglia and cerebellar atrophy (H-ABC). In some embodiments, at least one symptom of a TUBB4A-related neurodegenerative disease or condition is improved. Exemplary symptoms include, but are not limited to, hypomyelination, demyelination, dysarthria, dystonia, gait ataxia, spasticity, cerebellar and / or basal ganglia atrophy, visual impairment, rigidity, microcephaly, focal cortical dysplasia, seizures, and early childhood death.

[0333] In some embodiments, methods for reducing the expression of TUBB4A nucleic acid (e.g., RNA) or reducing the expression of TUBB4A protein in cells include administering to a subject an oligomer containing a modified oligonucleotide having a target region having a nucleobase sequence complementary to an isolong target region of TUBB4A nucleic acid. In some embodiments, the oligomer is administered to inhibit TUBB4A expression in the subject's brain or spinal cord. In some embodiments, the subject has a TUBB4A-related neurological disorder or condition. In some embodiments, the subject has or is at risk of developing TUBB4A-related leukodystrophy or DYT4.

[0334] In some embodiments, the method of inhibiting the expression of TUBB4A nucleic acid in cells includes contacting the cells with an oligomer comprising a modified oligonucleotide having a target region having a nucleobase sequence complementary to an isolong target region of TUBB4A nucleic acid, thereby inhibiting the expression of TUBB4A nucleic acid in the cells. In some embodiments, the cells are human cells. In some embodiments, the cells are brain cells. In some embodiments, the cells are neurons or oligodendrocytes. In some embodiments, the cells are obtained from a subject, such as a subject who has or is at risk of developing a TUBB4A-related disease or condition. In some embodiments, the cells are located in a subject who has a TUBB4A-related disease or condition. In some embodiments, the cells are located in a subject who has or is at risk of developing TUBB4A-associated leukodystrophy or DYT4.

[0335] Some embodiments involve oligomers comprising modified oligonucleotides having a targeting region having a nucleobase sequence complementary to an isolong target region of TUBB4A nucleic acid, the oligomer for treating diseases or conditions associated with elevated TUBB4A signaling or TUBB4A overexpression. In some embodiments, the disease or condition is TUBB4A-associated leukodystrophy or DYT4. In some embodiments, the oligomer is used to improve symptoms of TUBB4A-associated leukodystrophy or DYT4-related diseases or conditions. In some embodiments, symptoms are selected from hypomyelination, demyelination, dysarthria, dystonia, ataxia, spasticity, cerebellar and / or basal ganglia atrophy, visual impairment, rigidity, microcephaly, focal cortical dysplasia, seizures, and early childhood death. In some embodiments, the oligomer is used to reduce TUBB4A expression in a subject.

[0336] Some embodiments involve oligomers comprising modified oligonucleotides having a targeting region having a nucleobase sequence complementary to an isolong target region of TUBB4A nucleic acid, the oligomer being used to manufacture or prepare a medicament for treating diseases or conditions associated with TUBB4A. In some embodiments, the disease or condition is leukodystrophy or DYT4 associated with TUBB4A. In some embodiments, the oligomer is used to manufacture or prepare a medicament for improving symptoms or markers associated with TUBB4A. In some embodiments, symptoms or markers are selected from hypomyelination, demyelination, dysarthria, dystonia, ataxia, spasticity, cerebellar and / or basal ganglia atrophy, visual impairment, rigidity, microcephaly, focal cortical dysplasia, seizures, and early childhood death. In some embodiments, the oligomer is used to manufacture or prepare a medicament for reducing TUBB4A expression in a subject.

[0337] In any of the methods or uses described herein, the oligomer (e.g., an oligomer comprising a modified oligonucleotide, an antisense oligonucleotide, or an oligoduplex) may be any of those described herein.

[0338] VI. Certain pharmaceutical compositions In some embodiments, this document describes pharmaceutical compositions comprising one or more oligomers. In some embodiments, the one or more oligomers comprise or consist of modified oligonucleotides. In some embodiments, one or more oligomeric compounds, oligoduplexes, or antisense agents each comprise or consist of modified oligonucleotides. In some embodiments, the one or more oligomers comprise or consist of antisense oligonucleotides. In some embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent. In some embodiments, the pharmaceutical composition comprises a sterile saline solution and or consists of an oligomer. In some embodiments, the sterile saline solution is pharmaceutical grade saline. In some embodiments, the pharmaceutical composition comprises one or more oligomers and sterile water or or consists of sterile water. In some embodiments, the sterile water is pharmaceutical grade water. In some embodiments, the pharmaceutical composition comprises one or more oligomers and phosphate-buffered saline (PBS) or or consists of PBS. In some embodiments, the sterile PBS is pharmaceutical grade PBS. In some embodiments, the pharmaceutical composition comprises an oligomer and artificial cerebrospinal fluid (“artificial CSF” or “aCSF”) or or consists of aCSF. In some embodiments, the artificial cerebrospinal fluid is pharmaceutical grade artificial cerebrospinal fluid.

[0339] In some embodiments, the pharmaceutical composition comprises an oligomer and water. In some embodiments, the pharmaceutical composition consists of an oligomer and water. In some embodiments, the pharmaceutical composition consists essentially of an oligomer and water. In some embodiments, the water is pharmaceutical grade. In some embodiments, the pharmaceutical composition comprises a modified oligonucleotide and water. In some embodiments, the pharmaceutical composition consists of a modified oligonucleotide and water. In some embodiments, the pharmaceutical composition consists essentially of a modified oligonucleotide and water. In some embodiments, the water is pharmaceutical grade.

[0340] In some embodiments, the pharmaceutical composition comprises an oligomer and PBS. In some embodiments, the pharmaceutical composition consists of an oligomer and PBS. In some embodiments, the pharmaceutical composition consists essentially of an oligomer and PBS. In some embodiments, the PBS is pharmaceutical grade. In some embodiments, the pharmaceutical composition comprises a modified oligonucleotide and PBS. In some embodiments, the pharmaceutical composition consists of a modified oligonucleotide and PBS. In some embodiments, the pharmaceutical composition consists essentially of a modified oligonucleotide and PBS. In some embodiments, the PBS is pharmaceutical grade.

[0341] In some embodiments, the pharmaceutical composition comprises an oligomer and artificial cerebrospinal fluid (aCSF). In some embodiments, the pharmaceutical composition consists of an oligomer and aCSF. In some embodiments, the pharmaceutical composition consists essentially of an oligomer and aCSF. In some embodiments, the aCSF is pharmaceutical grade. In some embodiments, the pharmaceutical composition comprises a modified oligonucleotide and aCSF. In some embodiments, the pharmaceutical composition consists of a modified oligonucleotide and aCSF. In some embodiments, the pharmaceutical composition consists essentially of a modified oligonucleotide and aCSF. In some embodiments, the artificial cerebrospinal fluid is pharmaceutical grade. In some embodiments, the aCSF comprises sodium chloride, potassium chloride, sodium dihydrogen phosphate dihydrate, anhydrous disodium hydrogen phosphate, calcium chloride dihydrate, and magnesium chloride hexahydrate. The pH of the aCSF solution is adjusted to the range of about 7.1 to 7.3 or to about 7.2 using a suitable pH adjuster (e.g., an acid, such as hydrochloric acid, and a base, such as sodium hydroxide).

[0342] In some embodiments, the pharmaceutical composition comprises one or more oligomers and one or more excipients. In some embodiments, the excipients are selected from water, salt solutions, alcohols, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silica, viscous paraffin, hydroxymethyl cellulose, and polyvinylpyrrolidone.

[0343] In some embodiments, the oligomer may be mixed with pharmaceutically acceptable active and / or inert substances for the preparation of pharmaceutical compositions or formulations. The composition and formulation of pharmaceutical compositions depend on many criteria, including but not limited to route of administration, disease severity, or dosage.

[0344] In some embodiments, pharmaceutical compositions comprising oligomers include any pharmaceutically acceptable salt of the oligomer, an ester of the oligomer, or a salt of such an ester. In some embodiments, pharmaceutical compositions comprising oligomers are capable of providing (directly or indirectly) their biologically active metabolites or residues when administered to a subject (including a human). Thus, for example, this disclosure also relates to pharmaceutically acceptable salts of oligomers, their prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium, potassium, calcium, and magnesium salts. In some embodiments, a prodrug comprises one or more conjugate groups attached to an oligonucleotide, wherein such conjugate groups are cleaved by endogenous nucleases in vivo.

[0345] In some embodiments, the oligomer is lyophilized and isolated as a sodium salt. In some embodiments, the sodium salt of the oligomer is mixed with a pharmaceutically acceptable diluent. In some embodiments, the pharmaceutically acceptable diluent comprises saline, water, PBS, or aCSF. In some embodiments, the sodium salt of the oligomer compound, oligoduplex, or antisense agent is mixed with PBS. In some embodiments, the sodium salt of the oligomer is mixed with aCSF. In some embodiments, the sodium salt of the oligomer is a sodium salt of a modified oligonucleotide.

[0346] Lipid moieties have been used in nucleic acid therapy in various ways. In some such methods, nucleic acids (such as oligomers) are introduced into pre-formed liposomes or lipid complexes made from a mixture of cationic and neutral lipids. In some methods, DNA complexes with mono- or polycationic lipids are formed in the absence of neutral lipids. In some embodiments, lipid moieties are selected to increase the distribution of agents to specific cells or tissues. In some embodiments, lipid moieties are selected to increase the distribution of agents to adipose tissue. In some embodiments, lipid moieties are selected to increase the distribution of agents to muscle tissue.

[0347] In some embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems can be used to prepare certain pharmaceutical compositions, including those comprising hydrophobic compounds. In some embodiments, certain organic solvents, such as dimethyl sulfoxide, are used.

[0348] In some embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more of the agents disclosed herein to a specific tissue or cell type. For example, in some embodiments, the pharmaceutical composition comprises liposomes coated with tissue-specific antibodies.

[0349] In some embodiments, the pharmaceutical composition comprises a cosolvent system. Some of these cosolvent systems include, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In some embodiments, such cosolvent systems are used for hydrophobic compounds. A non-limiting example of such a cosolvent system is the VPD cosolvent system, which is an absolute ethanol solution comprising 3% w / v benzyl alcohol, 8% w / v the nonpolar surfactant polysorbate 80™, and 65% w / v polyethylene glycol 300. The proportions of such cosolvent systems can vary considerably without significantly altering their solubility and toxicity properties. Furthermore, the identity of the cosolvent components can be varied: for example, other surfactants can be used instead of Polysorbate 80™; the fractional size of the polyethylene glycol can be varied; other biocompatible polymers can replace polyethylene glycol, such as polyvinylpyrrolidone; and other sugars or polysaccharides can replace glucose.

[0350] In some embodiments, the pharmaceutical composition is prepared for oral administration. In some embodiments, the pharmaceutical composition is prepared for oral administration. In some embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intraventricular (ICV), etc.). In some such embodiments, the pharmaceutical composition comprises a carrier and is formulated in an aqueous solution, such as water or a physiologically compatible buffer, such as Hanks' solution, Ringer's solution, or physiological saline buffer. In some embodiments, other components are included (e.g., components that contribute to solubility or act as preservatives). In some embodiments, an injectable suspension is prepared using a suitable liquid carrier, suspending agent, etc. Some injectable pharmaceutical compositions are present in a single dosage form, such as an ampoule or a multi-dose container. Some injectable pharmaceutical compositions are oily or aqueous media containing suspensions, solutions, or emulsions, and may contain formulations such as suspending agents, stabilizers, and / or dispersants. Certain solvents suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils such as sesame oil, synthetic fatty acid esters such as ethyl oleate or triglycerides, and liposomes.

[0351] Under certain conditions, some of the compounds disclosed herein act as acids. Although such compounds can be drawn or described as protonated (free acid) or ionized and associated with cations (salts), aqueous solutions of such compounds exist in equilibrium between these forms. For example, the phosphate ester bonds of oligonucleotides in aqueous solutions exist in equilibrium between free acid, anionic, and salt forms. Unless otherwise stated, the compounds described herein are intended to include all such forms. Furthermore, some oligonucleotides have multiple such bonds, each in equilibrium. Thus, oligonucleotides in solution exist in multiple forms at multiple locations, all in equilibrium. The term "oligonucleotide" is intended to include all such forms. The drawn structures necessarily depict a single form. However, unless otherwise stated, such figures are also intended to include corresponding forms. In this document, the depiction of the structure of a compound as a free acid and the subsequent term "or its salt" explicitly include all such forms that can be fully or partially protonated / deprotonated / associated with cations. In some cases, one or more specific cations are identified. Cations include, but are not limited to, sodium, potassium, calcium, and magnesium.

[0352] In some embodiments, the oligomers provided herein are present in an aqueous solution containing sodium. In some embodiments, the oligomers are present in an aqueous solution containing potassium. In some embodiments, the oligomers are present in PBS. In some embodiments, the oligomers are present in water. In some such embodiments, the pH of the solution is adjusted to a desired pH using NaOH and / or HCl.

[0353] This article describes certain specific dosages. Dosages may be expressed in units of dosage. For clarity, oligomer dosages (or units of dosage) in milligrams represent the mass of the modified oligonucleotide or oligomer in its free acid form. As mentioned above, in aqueous solution, the free acid is in equilibrium with its anionic and salt forms. However, for the purpose of dosage calculation, it is assumed that the modified oligonucleotide or oligomer exists as a solvent-free, sodium acetate-free, anhydrous, free acid.

[0354] For example, when the oligomer is present in a sodium-containing solution (e.g., saline), the oligomer can be partially or completely deprotonated and associated with sodium ions. However, the mass of the protons is still included in the weight of the dose, while the mass of the sodium ions is not. Therefore, for example, the dose or dose unit of 10 mg of a number of fully protonated molecules is equal to the number of fully protonated molecules weighing 10 mg. This is equivalent to 10.59 mg of solvent-free, sodium acetate-free, anhydrous sodium-containing compound No. 1653044. When the oligomer contains a conjugating group, the mass of the conjugating group is included in the calculation of the dose of the oligomer. If the conjugating group also has an acid, it is also assumed that the conjugating group is fully protonated for the purpose of calculating the dose.

[0355] In some embodiments, when the oligomer is present in a solution containing sodium, potassium, calcium, and magnesium (such as aCSF), the modified oligonucleotide or oligomer compound may be partially or completely deprotonated and associated with sodium, potassium, calcium, and / or magnesium. However, the mass of the protons is still included in the weight of the dose, and the mass of the sodium, potassium, calcium, and magnesium ions is not included in the weight of the dose.

[0356] In some embodiments, when the oligomer contains a conjugating group, the mass of the conjugating group may be included in the dosage calculation of the oligomer compound. If the conjugating group also has an acid content, it is also assumed that the conjugating group is fully protonated for dosage calculation purposes.

[0357] Unrestricted disclosure and incorporation by reference Every reference and patent publication listed herein is incorporated herein by reference in its entirety. While certain compounds, compositions, and methods described herein have been specifically described with reference to certain embodiments, the following examples are for illustrative purposes only and are not intended to limit the compounds described herein. Every reference, GenBank accession number, ENSEMBL identifier, etc., cited in this application is incorporated herein by reference in its entirety.

[0358] The sequence listing submitted with this application identifies each nucleic acid sequence as “RNA” or “DNA” as needed; however, those skilled in the art will readily understand that the naming of “RNA” or “DNA” to describe modified oligonucleotides is arbitrary in some cases. For example, an oligonucleotide containing a nucleoside comprising a 2'-OH sugar moiety and a thymine base may be described as DNA having a modified sugar (2'-OH replacing a 2'-H in DNA) or as RNA having a modified base (thymine (5-methyluracil) replacing uracil in RNA); and some nucleic acid compounds described herein contain one or more nucleosides with a modified sugar moiety containing a 2'-substituent that is neither OH nor H. Those skilled in the art will readily understand that labeling such nucleic acid compounds as “RNA” or “DNA” does not alter or limit the description of such nucleic acid compounds.

[0359] In this document, the description of compounds having the nucleobase sequence of SEQ ID NO “ ” describes only the nucleobase sequence. Therefore, unless otherwise described, such a description of the compound by reference to the nucleobase sequence of SEQ ID NO does not limit the presence or absence of sugar or nucleoside inter-bond modifications or additional substituents (such as conjugation groups). Furthermore, unless otherwise described, the nucleobases of compounds having the nucleobase sequence of SEQ ID NO “ ” include modified forms of such compounds having the nucleobases identified as described herein.

[0360] In this document, unless otherwise stated, the description of compounds by chemical symbols (subscripts and / or superscripts indicating chemical modifications) does not involve specific compound numbers, but only includes each indicated modification, but may include additional substituents, such as conjugated groups. For example, “A es T ko m C ez G ds C dThe chemical symbol “” represents a compound in which the first nucleoside comprises a 2'-MOE sugar moiety (indicated by the subscript “e”) and an unmodified adenine nucleobase linked to the second nucleoside via a thiophosphate bond (indicated by the subscript “s”); the second nucleoside comprises a cEt sugar moiety (indicated by the subscript “k”) and an unmodified thymine nucleobase linked to the third nucleoside via a phosphodiester bond (indicated by the subscript “o”); the third nucleoside comprises a 2'-MOE sugar moiety and an unmodified thymine nucleobase linked to the third nucleoside via a methanesulfonylaminophosphine bond. The compound comprises a 5-methyl modified cytosine nucleobase (indicated by the superscript "m") linked to a fourth nucleoside via an ester bond (indicated by the subscript "z"); the fourth nucleoside comprises a 2'-β-D-deoxyribosyl sugar moiety (indicated by the subscript "d") and an unmodified guanine nucleobase linked to a fifth nucleoside via a thiophosphate bond; and the fifth nucleoside comprises a 2'-β-D-deoxyribosyl sugar moiety and an unmodified cytosine nucleobase; and the compound may include additional substituents, such as conjugation groups.

[0361] In this document, when a specific compound is described by chemical symbols (as in the examples) (e.g., referring to compound numbers), each nucleobase, sugar, and nucleoside bond of that specific compound is modified only as indicated. Therefore, in the context of the description of a specific compound with a specific compound number, “A” es T ko m C ez G ds C d The compound is defined as follows: the first nucleoside comprises a 2'-MOE sugar moiety (indicated by the subscript "e") and an unmodified adenine nucleobase linked to the second nucleoside via a thiophosphate ester bond (indicated by the subscript "s"); the second nucleoside comprises a cEt sugar moiety (indicated by the subscript "k") and an unmodified thymine nucleobase linked to the third nucleoside via a phosphodiester bond (indicated by the subscript "o"); the third nucleoside comprises a 2'-MOE sugar moiety and an unmodified thymine nucleobase linked to the third nucleoside via a methanesulfonylamine bond. The compound comprises a 5-methyl modified cytosine nucleobase (indicated by the superscript "m") linked to a fourth nucleoside via a thiophosphate ester bond (indicated by the subscript "z"); the fourth nucleoside comprises a 2'-β-D-deoxyribosyl sugar moiety (indicated by the subscript "d") and an unmodified guanine nucleobase linked to a fifth nucleoside via a thiophosphate ester bond; and the fifth nucleoside comprises a 2'-β-D-deoxyribosyl sugar moiety and an unmodified cytosine nucleobase; and the compound does not contain any additional substituents.

[0362] In this document, sugars, nucleotide bonds, and nucleobase modifications may be represented within the nucleotide or nucleobase sequence (e.g., by superscript or subscript, as shown above) or in the accompanying text (e.g., in separate text appearing within, above, or below the compound table).

[0363] In the case of a specific compound described herein by way of a drawn chemical structure, each nucleobase, sugar, and nucleoside bond of that particular compound includes only the modifications indicated in the drawn chemical structure. However, those skilled in the art will understand that the drawn compound may exist in equilibrium between tautomeric forms and / or as a salt in equilibrium with protonated or ionic forms. The drawn structures are intended to capture all such forms of such compounds.

[0364] Although every effort has been made to accurately describe the compounds in the appended sequence listing, if there are any discrepancies between the descriptions in this specification and those in the appended sequence listing, the descriptions in this specification but not in the sequence listing are accurate descriptions.

[0365] The compounds described herein include variants in which one or more atoms are replaced by non-radioactive or radioactive isotopes of the element shown. For example, compounds containing hydrogen atoms are covered herein. 1 All possible deuterium substitutions of the H hydrogen atom. Isotopic substitutions covered in the compounds described herein include, but are not limited to: 2 H or 3 H replaces 1 H, 13 C or 14 C replaces 12 C, 15 N replaces 14 N, 17 O or 18 O replaces 16 O, and 33 S, 34 S, 35 S or 36 S replaces 32 S. In some embodiments, non-radioactive isotope substitution can impart new properties to the oligomeric compound that are beneficial for use as a therapeutic or research tool. In some embodiments, radioactive isotope substitution can make the compound suitable for research or diagnostic purposes, such as imaging.

[0366] Example The following examples illustrate certain embodiments of this disclosure and are not limiting. Furthermore, in providing specific embodiments, the inventors have considered the general application of those specific embodiments. For example, the disclosure of oligonucleotides having a specific motif provides reasonable support for other oligonucleotides having the same or similar motifs. And, for example, where a specific high-affinity modification appears at a specific position, other high-affinity modifications at the same position are considered appropriate, unless otherwise stated.

[0367] Example 1: Design of modified oligonucleotides complementary to human TUBB4A RNA Modified oligonucleotides complementary to human TUBB4A RNA were designed and synthesized.

[0368] The modified oligonucleotides in the table below are 5-10-5 MOE spacers with mixed PS / PO internucleotide motifs. The modified oligonucleotides in the table are 20 linked nucleotides in length, with the glycosylation motif (5' to 3'): eeeeddddddddddeeeee; where "e" represents the 2'-MOE ribose motif and "d" represents the 2'-β-D-deoxyribosyl ribose motif. The internucleotide motif (5' to 3') is: soooosssssssssssooss; where each "s" represents a phosphate thioester internucleotide bond and each "o" represents a phosphodiester internucleotide bond. Each cytosine residue is 5-methylcytosine.

[0369] “Start site” indicates the 5' nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide. “Termination site” indicates the 3' nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide. The modified oligonucleotides listed in the table below are 100% complementary to SEQ ID NO: 1 (ENSEMBL ID ENSG00000104833.12, Ensembl Release 109 – February 2023).

[0370] Table 1 A 5-10-5 MOE spacer complementary to human TUBB4A RNA and featuring a mixed PS / PO nucleotide interbonded motif. Example 2: 5-10-5 MOE-modified oligonucleotide pairs in vitro Effects of human TUBB4A RNA, single dose The modified oligonucleotide pairs complementary to human TUBB4A nucleic acid were tested. in vitro The effect of a single dose of TUBB4A RNA.

[0371] SH-SY5Y cells were seeded at 10,000 cells / well and differentiated for 10 days in 10 µM retinoic acid, followed by 4 days of free uptake treatment with 15 µM (15,000 nM) of modified oligonucleotides. Total RNA was isolated from the cells, and TUBB4A RNA levels were measured by quantitative real-time RT-PCR. TUBB4A RNA levels were measured using the human primer-probe set RTS54615 (forward sequence CCTTCGGTCAGATCTTTCGG, designated as SEQ ID NO: 2; reverse sequence CCTCTTCCGGACTACGTC, designated as SEQ ID NO: 3; probe sequence TGTAGTGCCCCTTTGCCCAGTT, designated as SEQ ID NO: 4). TUBB4A RNA levels were normalized relative to total RNA levels as measured by RIBOGREEN®. In the table below, the decrease in TUBB4A RNA is expressed as a percentage (% UTC) of TUBB4A RNA relative to the amount of TUBB4A RNA in untreated control cells. Table 2 The 5-10-5 MOE spacer with mixed PS / PO nucleotide internucleotide bonds reduced TUBB4A RNA at a concentration of 15,000 nM in differentiated SH-SY5Y cells. Example 3: Modified oligonucleotide pairs in vitro Dose-dependent inhibition of human TUBB4A, multiple doses Modified oligonucleotides selected from the examples above were tested at various doses in differentiated SH-SY5Y cells. SH-SY5Y cells were seeded at 10,000 cells / well and differentiated in 10 µM retinoic acid for 10 days, followed by 4 days of free uptake treatment with modified oligonucleotides at the concentrations shown in the table below. Total RNA was isolated from the cells, and TUBB4A RNA levels were measured by quantitative real-time RTPCR. RNA levels were measured using the human TUBB4A primer-probe set RTS54615 (as described above). TUBB4A RNA levels were normalized relative to total RNA content as measured by RIBOGREEN®. In the table below, the decrease in TUBB4A RNA is expressed as a percentage (% UTC) of the amount of TUBB4A RNA relative to the amount of TUBB4A RNA in untreated control cells.

[0372] The half-maximal inhibitory concentration (IC50) of the modified oligonucleotide 50 ) is also shown in the table below.

[0373] Table 3 The modified oligonucleotides reduced the dose-dependent effect of human TUBB4A RNA on differentiated SH-SY5Y cells. Example 4: Activity of modified oligonucleotides targeting TUBB4A in transgenic mice, 2 weeks The effects of the modified oligonucleotides on TUBB4A mRNA described above were tested in TUBB4A transgenic mice (Taconic Biosciences). The TUBB4A transgenic mice used in this study were engineered to be constitutively humanized with the Tubb4a gene via CRISPR / Cas9-mediated gene editing. This strategy was based on the Ensembl transcript ENSMUST00000071135.6 (mice) and the GENBANK transcript NM_006087.4 (humans). Exon 1 contains the translation start codon. The mouse genome sequences of exons 1 through 4, including the 5' and 3' untranslated regions (UTRs), were replaced with their human counterparts. The D249N mutation was introduced into human exon 4.

[0374] TUBB4A transgenic mice were divided into four groups. Each mouse received a single ICV bolus of 700 µg of modified oligonucleotides. Four mice in one group received PBS as a negative control.

[0375] Two weeks after treatment, mice were sacrificed and RNA was extracted from cortical brain tissue and spinal cord for quantitative real-time RT-PCR analysis of TUBB4A RNA. Human primer and probe set RTS54614 (forward sequence CAGTGCGGCAACCAGAT, designated as SEQ ID NO: 7; reverse sequence CACGTTGATCCTCTCCAGTT, designated as SEQ ID NO: 8; probe sequence TGCCATGTTCGTCACTGATAACCTCC, designated as SEQ ID NO: 9) and human primer and probe set RTS54615 (as described above) were used. TUBB4A RNA is expressed as a percentage (% control) of the amount of TUBB4A RNA relative to the amount in PBS-treated animals, normalized to mouse GAPDH. Mouse GAPDH was amplified using the primer and probe set mGapdh_LTS00102 (forward sequence GGCAAATTCAACGGCACAGT, designated as SEQ ID NO: 10 in this paper; reverse sequence GGGTCTCGCTCCTGGAAGAT, designated as SEQ ID NO: 11 in this paper; probe sequence AAGGCCGAGAATGGGAAGCTTGTCATC, designated as SEQ ID NO: 12 in this paper).

[0376] Table 4 The reduction of TUBB4A mRNA in transgenic mice treated with 700 µg of modified oligonucleotides Example 5: The role of modified oligonucleotides targeting TUBB4A in transgenic mice, 2 weeks. The modified oligonucleotides described above were tested for their effects on TUBB4A mRNA in the TUBB4A transgenic mice described above.

[0377] TUBB4A transgenic mice were divided into 3 to 4 groups. Each mouse received a single ICV bolus of the various doses of modified oligonucleotides shown in the table below. Three mice in one group received PBS as a negative control.

[0378] Two weeks after treatment, mice were sacrificed and RNA was extracted from cortical brain tissue and spinal cord for quantitative real-time RT-PCR analysis of TUBB4A RNA, using human primer and probe sets RTS54614 (as described above) and RTS54615 (as described above). TUBB4A RNA is expressed as a percentage (% control) of the amount of TUBB4A RNA relative to the amount of TUBB4A RNA in PBS-treated animals, normalized to mouse GAPDH. Mouse GAPDH was amplified using primer and probe set mGapdh_LTS00102 (described above).

[0379] The half-maximum effective dose (ED) of each modified oligonucleotide was calculated using GraphPad Prism 10 software (GraphPad Software, San Diego, CA). 50 ).

[0380] Table 5 Dose-dependent effects of modified oligonucleotides on TUBB4A mRNA levels

Claims

1. An oligomer comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the modified oligonucleotide includes a targeting region comprising at least 12 consecutive nucleosides, wherein the nucleobase sequence of the targeting region is at least 80% complementary to the nucleobase sequence of an iso-length target region of TUBB4A nucleic acid, and wherein the sugar moiety of at least one nucleoside of the modified oligonucleotide is a modified sugar moiety and / or at least one internucleotide bond of the modified oligonucleotide is a modified internucleotide bond.

2. The oligomer according to claim 1, wherein the TUBB4A nucleic acid has the nucleobase sequence of SEQ ID NO:

1.

3. The oligomer according to claim 1 or claim 2, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to the isolength portion of nucleobases 3051 to 3070 of SEQ ID NO:

1.

4. The oligomer according to any one of claims 1 to 3, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to the isolength portion of the TUBB4A nucleic acid.

5. An oligomer comprising a modified oligonucleotide, said modified oligonucleotide being composed of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or 20 consecutive nucleosides, wherein the sugar moiety of at least one nucleoside of said modified oligonucleotide is a modified sugar moiety and / or at least one internucleotide bond of said modified oligonucleotide is a modified internucleotide bond.

6. The oligomer of claim 5, wherein the modified oligonucleotide consists of 16 to 25 linked nucleosides and has a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO:

5.

7. The oligomer of claim 5 or claim 6, wherein the modified oligonucleotide has a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO:

5.

8. The oligomer according to any one of claims 5 to 7, wherein the modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of SEQ ID NO:

5.

9. The oligomer according to any one of claims 5 to 8, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an isolength portion of the TUBB4A nucleic acid, wherein the TUBB4A nucleic acid has the nucleobase sequence of SEQ ID NO:

1.

10. The oligomerizing agent according to any one of claims 5 to 9, wherein the modified oligonucleotide comprises 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 16 to 25, 16 to 18 Composed of 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 22, 18 to 25, 18 to 30, 18 to 50, 19 to 20, 19 to 25, 19 to 30, 19 to 50, 20 to 25, 20 to 30, 20 to 50, 21 to 25, 21 to 30, 21 to 50, 22 to 25, 22 to 30, 22 to 50, 23 to 25, 23 to 30, or 23 to 50 linked nucleosides.

11. The oligomer according to any one of claims 5 to 10, wherein the modified oligonucleotide consists of 20 linked nucleosides.

12. The oligomer according to any one of claims 5 to 11, wherein at least one nucleoside of the modified oligonucleotide is a modified nucleoside.

13. The oligomer of claim 12, wherein the at least one modified nucleoside comprises a modified sugar moiety.

14. The oligomer of claim 13, wherein the modified sugar moiety comprises a bicyclic sugar moiety.

15. The oligomer of claim 13 or claim 14, wherein the bicyclic sugar moiety comprises a 2'-4' bridge selected from -O-CH2- and -O-CH(CH3)-.

16. The oligomer of claim 13, wherein the modified nucleoside comprises a non-bicyclic modified sugar moiety.

17. The oligomer of claim 16, wherein the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety, a 2'-OMe sugar moiety, or a β-D-deoxyxylose sugar moiety.

18. The oligomer of claim 16 or claim 17, wherein the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety.

19. The oligomer according to any one of claims 5 to 18, wherein at least one nucleoside internucleotide bond of the modified oligonucleotide is a phosphate thioester nucleoside internucleotide bond.

20. The oligomer of claim 19, wherein at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17 or at least 18 nucleoside bonds of the modified oligonucleotide are phosphate thioester nucleoside bonds.

21. The oligomer according to any one of claims 5 to 20, wherein at least one nucleoside internucleotide bond of the modified oligonucleotide is a phosphodiester nucleoside internucleotide bond.

22. The oligomer according to any one of claims 5 to 21, wherein the modified oligonucleotide comprises a nucleoside internucleotide motif (5' to 3') of sooooosssssssssssooss, wherein each "s" represents a thiophosphate nucleoside internucleotide and each "o" represents a phosphodiester nucleoside internucleotide.

23. The oligomer according to any one of claims 5 to 22, wherein the modified oligonucleotide comprises at least one modified nucleobase.

24. The oligomer of claim 23, wherein the modified nucleobase is 5-methylcytosine.

25. The oligomer of claim 24, wherein each cytosine is 5-methylcytosine.

26. The oligomer according to any one of claims 5 to 25, wherein one or more nucleosides of the modified oligonucleotide comprise unmodified nucleobases.

27. The oligomer of any one of claims 5 to 26, wherein the modified oligonucleotide comprises a deoxygenated region.

28. The oligomer of claim 27, wherein each nucleoside in the deoxygenated region is a 2'-β-D-deoxynucleoside.

29. The oligomer of claim 27 or claim 28, wherein the deoxygenated region is composed of 6, 7, 8, 9, 10, or 6 to 10 linked nucleosides.

30. The oligomer according to any one of claims 27 to 29, wherein each nucleoside immediately adjacent to the deoxygenated region comprises a modified sugar moiety.

31. The oligomer according to any one of claims 27 to 30, wherein the deoxygenated region is connected to a 5' external region on the 5' side and to a 3' external region on the 3' side, the 5' external region being composed of 1 to 6 linked 5' external region nucleosides, and the 3' external region being composed of 1 to 6 linked 3' external region nucleosides; in The 3' nucleotide in the 5' outer region contains a modified sugar moiety; and The 5' nucleotide in the 3' outer region contains a modified sugar moiety.

32. The oligomer of claim 31, wherein each nucleoside in the 3' outer region comprises a modified sugar moiety.

33. The oligomer of claim 31 or claim 32, wherein each nucleoside in the 5' outer region comprises a modified sugar moiety.

34. The oligomer of claim 33, wherein the modified oligonucleotide has: The 5' outer region consists of 5 linked nucleosides; The deoxygenated region consisting of 10 linked nucleosides; and The 3' outer region consists of 5 linked nucleosides; Each of the 5' outer region nucleosides and each of the 3' outer region nucleosides is a 2'-MOE nucleoside.

35. An oligomer comprising a modified oligonucleotide according to the following chemical symbol: m C es A eo T eo G eo A eo m C ds T d s T ds T ds A ds A ds G ds m C ds T ds T ds m C eo A eo m C es A es A e (SEQ ID NO: 6), in: A = adenine nucleobase, m C = 5-methylcytosine nucleobase; G = Guanine nucleobase; T = thymine nucleobase; e = 2'-MOE sugar moiety; d = 2'-β-D-deoxyribosyl sugar moiety; s = thiophosphate nucleoside bond; and o = phosphate diester nucleoside internucleotide bond; and The oligomeric compounds optionally contain conjugated groups or terminal groups.

36. The oligomer according to any one of claims 1 to 35, wherein it comprises the modified oligonucleotide.

37. The oligomer according to any one of claims 1 to 36, wherein the oligomer compound comprises a conjugation group.

38. The oligomer of claim 37, wherein the conjugate group comprises a conjugate linker and a conjugate moiety.

39. The oligomer of claim 38, wherein the conjugate joint is composed of single bonds.

40. The oligomer according to any one of claims 38 to 39, wherein the conjugate linker is pyrolytic.

41. The oligomer according to any one of claims 38 to 40, wherein the conjugate linker comprises 1 to 3 linker-nucleosides.

42. The oligomer according to any one of claims 38 to 40, wherein the conjugate linker does not contain any linker nucleoside.

43. The oligomer according to any one of claims 38 to 42, wherein the conjugation group is attached to the 5' end of the modified oligonucleotide.

44. The oligomer according to any one of claims 38 to 42, wherein the conjugation group is attached to the modified oligonucleotide at the 3' end of the modified oligonucleotide.

45. The oligomer according to any one of claims 1 to 44, wherein the oligomer comprises a terminal group.

46. ​​The oligomer of claim 45, wherein the terminal group is a debased sugar moiety.

47. The oligomer according to any one of claims 1 to 46, wherein the oligomer is a single-chain oligomer.

48. A modified oligonucleotide based on the following chemical structure: (SEQ ID NO: 6) or a pharmaceutically acceptable salt thereof.

49. The modified oligonucleotide of claim 48, wherein the modified oligonucleotide is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium and magnesium.

50. The modified oligonucleotide according to claim 49, wherein the modified oligonucleotide is a sodium or potassium salt.

51. A modified oligonucleotide based on the following chemical structure: (SEQ ID NO: 6).

52. A group of chiral enriched oligomers according to any one of claims 1 to 47 or a group of chiral enriched modified oligonucleotides according to any one of claims 48 to 51, wherein the group is enriched with modified oligonucleotides comprising at least one thiophosphate nucleoside bond having a specific stereochemical configuration.

53. The chiral enrichment group according to claim 52, wherein the group enrichment comprises at least one having (Sp) or (Rp) Modified oligonucleotides with specific configurations of thiophosphate nucleoside bonds.

54. The chiral enrichment group according to claim 52, wherein the group is enriched with modified oligonucleotides having a specific, independently selected stereochemical configuration at each thiophosphate nucleoside internucleotide bond.

55. The chiral enrichment group according to claim 52, wherein the group is enriched with a specific thiophosphate nucleoside internucleotide bond at a particular site. (Rp) Configuration and has at each of the remaining thiophosphate nucleoside internucleotide bonds (Sp) Modified oligonucleotides with different configurations.

56. The chiral enrichment group according to claim 52, wherein the group is enriched with having a chiral enrichment in the 5' to 3' direction. Sp , Sp and Rp Modified oligonucleotides with at least three consecutive thiophosphate nucleoside bonds in configuration.

57. A group of oligomers according to any one of claims 1 to 47 or a group of modified oligonucleotides according to any one of claims 48 to 51, wherein each of the thiophosphate nucleoside internucleotides of the modified oligonucleotide is stereorandom.

58. A pharmaceutical composition comprising an oligomer according to any one of claims 1 to 47, a modified oligonucleotide according to any one of claims 48 to 51, or a group according to any one of claims 52 to 57, and a pharmaceutically acceptable diluent.

59. The pharmaceutical composition of claim 58, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid, water, or phosphate-buffered saline.

60. The pharmaceutical composition of claim 58 or claim 59, wherein the pharmaceutical composition comprises substantially the modified oligonucleotide, the oligomeric compound or the group and artificial cerebrospinal fluid.

61. The pharmaceutical composition according to any one of claims 58 to 60, wherein the pharmaceutical composition comprises substantially the modified oligonucleotide, the oligomeric compound or the group and phosphate-buffered saline.

62. A method comprising administering to a subject an oligomer according to any one of claims 1 to 47, a modified oligonucleotide according to any one of claims 48 to 51, a group according to any one of claims 52 to 57, or a pharmaceutical composition according to any one of claims 58 to 61.

63. The method of claim 62, wherein administration of the oligomer, the modified oligonucleotide, the group, or the pharmaceutical composition improves at least one symptom of a disease or condition associated with TUBB4A.

64. The method according to claim 62 or claim 63, wherein administration of the oligomer, the modified oligonucleotide, the group, or the pharmaceutical composition reduces or slows the progression of hypomyelination, demyelination, dysphonia, dystonia, ataxia, spasticity, cerebellar and / or basal ganglia atrophy, visual impairment, rigidity, microcephaly, focal cortical dysplasia, seizures, and early childhood death.

65. The method according to any one of claims 62 to 64, wherein the TUBB4A protein level is reduced in the subject.

66. The method according to any one of claims 63 to 65, wherein the disease or condition associated with TUBB4A is a neurodegenerative disease or condition.

67. The method according to any one of claims 63 to 65, wherein the disease or condition associated with TUBB4A is leukodystrophy or type 4 dystonia (DYT4) associated with TUBB4A.

68. The method of claim 67, wherein the TUBB4A-associated leukodystrophy is selected from TUBB4A-leukodystrophy with onset in infancy, isolated hypomyelination with spastic quadriplegia, and hypomyelination with basal ganglia and cerebellar atrophy (H-ABC).

69. A method of treating a disease or condition associated with TUBB4A, the method comprising administering to a subject who has or is at risk of developing a disease or condition associated with TUBB4A a therapeutically effective amount of an oligomer according to any one of claims 1 to 47, a modified oligonucleotide according to any one of claims 48 to 51, a group according to any one of claims 52 to 57, or a pharmaceutical composition according to any one of claims 58 to 61, thereby treating the disease or condition associated with TUBB4A.

70. The method according to any one of claims 62 to 69, wherein administration of the oligomer, the modified oligonucleotide, the group, or the pharmaceutical composition improves at least one symptom of the disease or condition associated with TUBB4A.

71. The method according to any one of claims 69 to 70, wherein administration of the modified oligonucleotide, the oligomer, the group, or the pharmaceutical composition reduces or slows the progression of hypomyelination, demyelination, dysphonia, dystonia, ataxia, spasticity, cerebellar and / or basal ganglia atrophy, visual impairment, rigidity, microcephaly, focal cortical dysplasia, seizures, and early childhood death.

72. The method according to any one of claims 69 to 71, wherein the TUBB4A protein level in the subject is reduced.

73. The method according to any one of claims 69 to 72, wherein the disease or condition associated with TUBB4A is leukodystrophy associated with TUBB4A.

74. The method of claim 73, wherein the TUBB4A-associated leukodystrophy is selected from TUBB4A-leukodystrophy with onset in infancy, isolated hypomyelination with spastic quadriplegia, type 4 dystonia (DYT4), and hypomyelination with basal ganglia and cerebellar atrophy (H-ABC).

75. The method according to any one of claims 69 to 74, wherein the subject is a human being.

76. A method for reducing the expression of TUBB4A in cells, the method comprising contacting the cells with an oligomer according to any one of claims 1 to 47, a modified oligonucleotide according to any one of claims 48 to 51, a group according to any one of claims 52 to 57, or a pharmaceutical composition according to any one of claims 58 to 61.

77. The method of claim 76, wherein the cell is a neuron or an oligodendrocyte.

78. The method according to claim 76 or claim 77, wherein the cell is a human cell.

79. Use of the oligomer of any one of claims 1 to 47, the modified oligonucleotide of any one of claims 48 to 51, the group of any one of claims 52 to 57, or the pharmaceutical composition of any one of claims 58 to 61 for the treatment of diseases or conditions associated with TUBB4A.

80. Use of the oligomeric compound according to any one of claims 1 to 47, the modified oligonucleotide according to any one of claims 48 to 51, the group according to any one of claims 52 to 57, or the pharmaceutical composition according to any one of claims 58 to 61 in the manufacture of a medicament for treating diseases or conditions associated with TUBB4A.

81. The use according to any one of claims 79 to 80, wherein the disease or condition associated with TUBB4A is related to elevated TUBB4A levels.

82. The use according to any one of claims 79 to 81, wherein the disease or condition associated with TUBB4A is leukodystrophy or type 4 dystonia (DYT4) associated with TUBB4A.

83. The use according to claim 82, wherein the TUBB4A-associated leukodystrophy is selected from TUBB4A-leukodystrophy with onset in infancy, isolated hypomyelination with spastic quadriplegia, and hypomyelination with basal ganglia and cerebellar atrophy (H-ABC).

Images