KASP molecular marker associated with erigeron breviscapus erigoster B and application thereof
By developing a KASP molecular marker associated with ethyl ester in *Erigeron breviscapus*, and using a specific primer combination to detect the genotype at locus 39926064 on chromosome 7A of *Erigeron breviscapus*, the problems of long cycle, high cost and low selection efficiency in traditional breeding methods were solved, and early molecular-assisted selection and efficient breeding of ethyl ester content were realized.
Patent Information
- Application Number
- CN202610123404.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-29
- Publication Date
- 2026-05-19
AI Technical Summary
Existing breeding methods for *Erigeron breviscapus* rely on traditional phenotypic selection, resulting in long breeding cycles, high costs, and significant susceptibility to environmental factors. Furthermore, self-incompatibility leads to low selection efficiency, making it difficult to effectively increase the content of ethyl esters in *Erigeron breviscapus*.
We developed a KASP molecular marker associated with erythritol B in *Erigeron breviscapus*, and used a specific primer combination to detect the genotype at locus 39926064 on chromosome 7A of *Erigeron breviscapus*. We then used PCR amplification to determine the erythritol B content, thus enabling early molecular-assisted selection.
This method enables accurate identification and early selection of the ethyl acetate content in *Erigeron breviscapus*, improving breeding efficiency, reducing manpower and material costs, and enhancing the stability and efficiency of selection.
Smart Images

Figure CN122060893A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a KASP molecular marker associated with Estradiol buergerianum and its application. Background Technology
[0002] *Erigeron breviscapus* is a traditional medicinal plant with therapeutic effects on cardiovascular and cerebrovascular diseases. Erigeron breviscapus (SE) and dicaffeoylquinic acid (diCQA) are the main active ingredients of *Erigeron breviscapus*, and are prescription drugs for treating these diseases. Dicaffeoylquinic acid includes ethyl filtrate (EB), 3,5-diCQA, and 4,5-diCQA, with EB having a high content. Drugs using dicaffeoylquinic acid as a raw material include *Erigeron breviscapus* capsules and *Erigeron breviscapus* capsules. Since *Erigeron breviscapus* is a medicinal plant, its medicinal value mainly depends on the content of its medicinal components. Therefore, increasing the content of ethyl filtrate in *Erigeron breviscapus* is one of the important goals in breeding and agricultural production.
[0003] KASP (Kompetitive Allele Specific PCR) is a molecular marker method based on SNP sites, favored in genotyping due to its high stability, accuracy, and cost-effectiveness. It is particularly suitable for high-throughput analysis, especially when processing large numbers of samples but with limited available SNP sites. The application of KASP technology not only improves the speed and efficiency of genotyping but also reduces costs, making it a promising candidate for applications in agricultural breeding, genetic research, and molecular diagnostics.
[0004] Currently, the main technical bottleneck in the breeding of *Erigeron breviscapus* varieties lies in its heavy reliance on traditional phenotypic selection methods. Specifically, breeders need to cultivate plants to maturity, then use high-performance liquid chromatography (HPLC) to determine the content of medicinal components, and then screen superior individual plants accordingly. *Erigeron breviscapus* variety breeding mainly employs a group-mixed selection method, relying primarily on phenotypic selection to obtain a population of varieties. This is currently the main breeding method for *Erigeron breviscapus* variety breeding. This process is not only lengthy and costly in terms of manpower and resources, but the accumulation of secondary metabolites in the plants is also significantly affected by factors such as cultivation environment, climate conditions, and harvest time. Furthermore, *Erigeron breviscapus* exhibits self-incompatibility, leading to low selection efficiency and insufficient stability. Therefore, identifying SNPs significantly associated with the content of *Erigeron breviscapus* ester ethylsporin and developing KASP molecular markers for assisted breeding to achieve early molecular-assisted selection of target traits and improve breeding efficiency is particularly important. Overcoming the shortcomings of existing technologies is a pressing issue that needs to be addressed in the field of genetic engineering technology. Summary of the Invention
[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a KASP molecular marker associated with Ethyl argentea var. chinensis and its application.
[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows: The first aspect of the present invention provides a KASP molecular marker associated with Estradiol buergerianum, wherein the KASP molecular marker contains the nucleotide sequence of the 39926064th position on chromosome 7A of Estradiol buergerianum, wherein the base at the 39926064th position is G or C.
[0007] Furthermore, the KASP molecular marker is shown in SEQ ID NO.6, where the 101st position is G or C.
[0008] A second aspect of the present invention provides primers for a KASP molecular marker associated with Ethyl argentea var. chinensis, including forward primer 1, forward primer 2 and a shared reverse primer; The nucleotide sequence of the forward primer 1 is shown in SEQ ID NO. 1; The nucleotide sequence of the forward primer 2 is shown in SEQ ID NO.2; The nucleotide sequence of the shared reverse primer (39926064-R) is shown in SEQ ID NO.3.
[0009] Forward primer 1: aaacaaacacggaatgtttcagagc (SEQ ID NO.1); Forward primer 2: aaacaaacacggaatgtttcagagg (SEQ ID NO.2); Shared reverse primer 39926064-R: tctgtatcacgagccaaccacat (SEQ ID NO.3).
[0010] A third aspect of the present invention provides primers for a KASP molecular marker associated with Ethyl argentea var. chinensis, including a forward primer 1 labeled with a FAM fluorescence signal, a forward primer 2 labeled with a HEX fluorescence signal, and a shared reverse primer. The nucleotide sequence of the forward primer 1 labeled with the FAM fluorescent signal is shown in SEQ ID NO.4, and the nucleotide sequence of the forward primer 2 labeled with the HEX fluorescent signal is shown in SEQ ID NO.5.
[0011] Forward primer 139926064-F1 labeled with FAM fluorescent signal: 5'-gaaggtgaccaagttcatgctaaacaaacacggaatgtttcagagc-3' (SEQ ID NO.4); Forward primer 239926064-F2 labeled with HEX fluorescent signal: 5'-gaaggtcggagtcaacggattaaacaaacacggaatgtttcagagg-3' (SEQ ID NO.5); Shared reverse primer 39926064-R: tctgtatcacgagccaaccacat (SEQ ID NO.3).
[0012] A fourth aspect of the present invention provides detection reagents, detection kits, or test strips containing primers containing the KASP molecular marker associated with Estradiol breviscapus ester.
[0013] The fifth aspect of this invention provides the application of detection reagents, detection kits, or test strips for primers associated with the KASP molecular marker of *Erigeron breviscapus* ester ethyl in marker-assisted breeding of *Erigeron breviscapus*.
[0014] The sixth aspect of this invention provides a method for identifying the content of ethyl linalool in plants, characterized by comprising: using the DNA of the sample of *Erigeron breviscapus* to be tested as a template, using primers of the KASP molecular marker associated with ethyl linalool in *Erigeron breviscapus*, or using the detection reagent, detection kit or detection strip, to perform PCR amplification, and determining the content of ethyl linalool in the plant sample to be tested based on the amplification results.
[0015] Furthermore, the method for identifying the content of ethyl phenolate in plants includes: using primers with the KASP molecular marker associated with ethyl phenolate in *Erigeron breviscapus*, or using the detection reagent, detection kit, or test strip to perform PCR amplification of polymorphic sites, wherein the polymorphic site is the 39926064th site on chromosome 7A of *Erigeron breviscapus*, with a polymorphism of G or C. *Erigeron breviscapus* with genotype GG has a high content of ethyl phenolate, and *Erigeron breviscapus* with genotype CC has a low content of ethyl phenolate.
[0016] The seventh aspect of this invention provides primers for KASP molecular markers associated with Ethyl arvense esters, or the aforementioned detection reagents, detection kits, or test strips in any of the following applications: (1) Used for the identification, selection and improvement of the content of ethyl acetate in *Erigeron breviscapus*; (2) Used for early prediction of the content of ethyl acetate in *Erigeron breviscapus*; This invention provides a KASP marker related to ethyl aril from *Erigeron breviscapus*, which is an SNP molecular marker associated with the medicinal plant *Erigeron breviscapus*. The marker contains a nucleotide sequence with a G / C polymorphism at position 39926064 bp on chromosome 7A of *Erigeron breviscapus*. Plants with the GG genotype at the polymorphic site of this marker have a higher ethyl aril content compared to plants with the CC genotype.
[0017] This invention provides a method for identifying the content (high or low) of ephedrine ethyl acetate in plants, comprising: using the DNA of the plant sample as a template, performing PCR amplification using the aforementioned KASP primers, detection reagents, detection kits, or test strips; determining the ephedrine ethyl acetate content of the plant sample based on the amplification results; and analyzing the genotypes of the polymorphic sites contained in the markers in the amplification products, showing that plants with the genotype GG have a higher ephedrine ethyl acetate content than those with the genotype CC.
[0018] Compared with the prior art, the beneficial effects of this invention are as follows: The KASP primer combination developed in this invention can directly and specifically distinguish and detect the G or C bases at the mutation site of C7-39926064. When using this KASP primer combination to identify the content of *Erigeron breviscapus* esters, it can clearly separate the two genotypes. In molecular marker C7-39926064, the dots near the Y-axis indicate the presence of the CC allelic variant, with the genotype being CC, and the *Erigeron breviscapus* genotype having a relatively low *Erigeron breviscapus* ester content; the dots near the X-axis indicate the presence of the GG allelic variant, with the genotype being GG, and the *Erigeron breviscapus* genotype having a relatively high *Erigeron breviscapus* ester content. The KASP primer combination developed in this invention has good application value, enabling pre-selection and molecular-assisted breeding of the *Erigeron breviscapus* ester content trait. It has important theoretical and practical guiding significance for the genetic improvement process of *Erigeron breviscapus* ester content breeding and for improving breeding selection efficiency. Attached Figure Description
[0019] Figure 1 These are the Manhattan and QQ-plots of the GWAS results for ethyl phloretin in *Erigeron breviscapus* provided in Example 1 of this invention; where a: Manhattan Plot; b: QQ Plot Figure 2 This is the genotyping result of *Erigeron breviscapus* at locus 39926064 on chromosome 7A provided in Example 2 of this invention; where NTC: negative control; Empty: empty sample; Unknown: unknown genotype; missing: missing data; Figure 3 This is a statistical chart showing the isoallic variation and phenotypic significance of the content of ethyl pyrithione provided in Example 2 of the present invention. Detailed Implementation
[0020] The present invention will now be described in further detail with reference to the embodiments.
[0021] Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be construed as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed in accordance with the techniques or conditions described in the literature in the field or according to the product instructions. Materials or equipment whose manufacturers are not specified are all conventional products that can be obtained by purchase.
[0022] Example 1: KASP molecular marker sites associated with the content of ethyl ester in *Erigeron breviscapus* Germplasm resources were screened to obtain 360 materials, including *Erigeron breviscapus* materials and wild materials from five different regions (Nanjian, Gejiu, Reshui, Baoshan, and Huize). Genomic DNA was extracted using the CTAB method and 10X whole-genome resequencing was performed.
[0023] The *Erigeron breviscapus* sample was dried at 55℃ to constant weight, pulverized using a pulverizer, and 0.1 g of the sample (passed through a 40-mesh sieve) was accurately weighed and placed in a 10 mL volumetric flask. 70% methanol was added and the volume was adjusted to the mark. The sample was sonicated in a water bath at room temperature for 45 min. After standing for 2 hours, the supernatant was collected and filtered through a 0.45 μm microporous membrane to obtain 1 mL of the test solution.
[0024] High-performance liquid chromatography (HPLC) was used to quantitatively analyze ethyl phenoxylate using the external standard method. A Kinetex® C18 column (100 × 4.6 mm, 2.6 μm) was used; the flow rate was 0.6 ml / min; the column temperature was 30℃; and the injection volume was 10 µL. The detection wavelength was 335 nm. The mobile phase consisted of acetonitrile (A) and 0.2 m / v % phosphoric acid aqueous solution (B). The elution gradient was as follows: 0 min, 15% A; 0–25 min, 15%–22% A; 25–26 min, 22%–90% A; 26–33 min, 90% A; 33–35 min, 90%–15% A; 35–40 min, 15% A. Linearity was considered throughout the gradient. Identification was based on retention time, and quantification was performed using the external standard method, with peak area as the quantification basis.
[0025] Using SNP loci as genotypic data and EB content of erythropoietin as phenotypic data, genome-wide association studies (GWAS) were performed using EMMAX software with a mixed linear model (MLM). The results are as follows: Figure 1As shown. Using -log10(P)>5.5 as the threshold, the SNP molecular marker C7-39926064, which is significantly associated with erythropoietin B, is located at base 39926064 on chromosome Chr7. Combined analysis with the erythropoietin B content in the population material revealed three genotypes at the C7-39926064 locus: CC, GC, and GG. The GG genotype showed a higher erythropoietin B content. At least 100 bp flanking sequences were extracted upstream and downstream of the SNP locus, and the sequence information of the gene sequence 100 bp before and after the Chr7A-39926064 locus is as follows: agtcgagcagccccatcatcataccgtctatgtttcacttggtattttttccaccaaggctgtgtttctgtatcacgagccaaccacatgcagagcggca[g / c]ctctgaaacattccgtgtttgtttaaccgcaacaagctgatttctgtgcaccttgaccatttgcacctccaccatctggttgattaatcttgatcgtgga Using NCBI's Primer-BLAST function and based on the KASP principle, a primer set for PCR amplification to obtain the molecular marker of *Erigeron breviscapus* was further developed and designed. The specific design is as follows: 39926064-F1: 5'-gaaggtgaccaagttcatgctaaacaaacacggaatgtttcagagc-3' (SEQ ID NO.4); the 5' end of this primer, "gaaggtgaccaagttcatgct" (SEQ ID NO.1), is a FAM marker sequence; 39926064-F2: 5'-gaaggtcggagtcaacggattaaacaaacacggaatgtttcagagg-3' (SEQ ID NO.5); the 5' end of this primer, "gaaggtcggagtcaacggatt" (SEQ ID NO.2), contains a HEX marker sequence. 39926064-R: tctgtatcacgagccaaccacat (SEQ ID NO. 3).
[0026] When 39926064-F1 and 39926064-R are used as primer pairs, they are used to amplify the C-base sequence at the 39926064 site on chromosome 7A in the molecular marker of *Erigeron breviscapus*. When 39926064-F2 and 39926064-R are used as primer pairs, they are used to amplify the G-base sequence at chromosome 39926064 on chromosome 7A in the molecular marker of *Erigeron breviscapus*.
[0027] Example 2: Application of SNP labeling in the identification of Ethylene scutellariae var. sarcodactylis integrifolia Primers were designed for SNP sites and flanking sequences using Primer 3 software. Genomic DNA was extracted from 94 randomly selected *Erigeron breviscapus* individual plants. Using the genomic DNA as a template, PCR amplification was performed using the SNP marker KASP-specific primers developed in Example 1.
[0028] The PCR reaction system was designed as follows: 1 μL of 15 ng / μL DNA template; 1 μL of 2×KASP Master mix; and 0.01 μL of KASP mixed primers, which included upstream primers 39926064-F1, 39926064-F2, and a common reverse primer 39926064-R. The concentrations of all three primers were 50 μM, and the volume ratio of the mixed primers was 1:1:3. The PCR amplification program was as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s; annealing at 61–55℃ for 40 s, decreasing the annealing temperature by 0.6℃ per cycle, for 10 cycles; followed by 95℃ denaturation for 20 s and 55℃ annealing for 40 s, for 35 cycles. After PCR amplification, the fluorescence signal is read, analyzed, and converted. The fluorescence scan results are automatically converted into graphs. Both pairs of labeled primers can clearly separate the two genotypes. Figure 2 ).
[0029] This invention detected the genotypes of 580 *Erigeron breviscapus* materials and identified the correlation between genotype and *Erigeron breviscapus* ethyl content. The 580 *Erigeron breviscapus* materials were divided into three categories according to genotype, coded as Eb1-Eb580. Specific genotypes and statistical results of *Erigeron breviscapus* ethyl content are shown in Table 1 and... Figure 3 As shown.
[0030] Table 1. Correspondence between genotypes of different *Erigeron breviscapus* materials and their *Festuca ethyl* content. serial number genotype Content of Felicin B (%) serial number genotype Content of Felicin B (%) serial number genotype Content of Felicin B (%) Eb1 C:C 1.52% Eb195 C:C 1.07% Eb389 C:C 0.64% Eb2 C:C 2.03% Eb196 C:C 0.89% Eb390 C:C 1.19% Eb3 C:C 1.86% Eb197 C:C 1.13% Eb391 C:C 0.79% Eb4 C:C 0.68% Eb198 C:C 1.98% Eb392 C:C 0.66% Eb5 C:C 1.00% Eb199 C:C 0.92% Eb393 C:C 1.35% Eb6 C:C 1.16% Eb200 C:C 0.63% Eb394 C:C 0.51% Eb7 C:C 0.46% Eb201 C:C 1.55% Eb395 C:C 1.02% Eb8 C:C 0.83% Eb202 C:C 0.79% Eb396 C:C 0.81% Eb9 C:C 0.84% Eb203 C:C 1.89% Eb397 C:C 0.93% Eb10 C:C 1.52% Eb204 C:C 2.02% Eb398 C:C 0.58% Eb11 C:C 1.21% Eb205 C:C 1.66% Eb399 C:C 0.62% Eb12 C:C 1.60% Eb206 C:C 0.69% Eb400 C:C 0.65% Eb13 C:C 1.55% Eb207 C:C 1.59% Eb401 C:C 0.98% Eb14 C:C 0.82% Eb208 C:C 1.55% Eb402 C:C 1.15% Eb15 C:C 0.78% Eb209 C:C 1.30% Eb403 C:C 0.59% Eb16 C:C 0.51% Eb210 C:C 0.98% Eb404 C:C 1.05% Eb17 C:C 0.76% Eb211 C:C 1.11% Eb405 C:C 1.10% Eb18 C:C 0.44% Eb212 C:C 1.36% Eb406 C:C 0.68% Eb19 C:C 0.96% Eb213 C:C 1.27% Eb407 C:C 0.56% Eb20 C:C 0.80% Eb214 C:C 1.27% Eb408 C:C 1.00% Eb21 C:C 1.01% Eb215 C:C 1.05% Eb409 C:C 0.67% Eb22 C:C 0.83% Eb216 C:C 0.93% Eb410 C:C 0.67% Eb23 C:C 0.91% Eb217 C:C 1.12% Eb411 C:C 1.53% Eb24 C:C 1.53% Eb218 C:C 1.48% Eb412 C:C 0.95% Eb25 C:C 1.45% Eb219 C:C 1.93% Eb413 C:C 0.83% Eb26 C:C 0.54% Eb220 C:C 0.94% Eb414 C:C 0.49% Eb27 C:C 0.94% Eb221 C:C 0.70% Eb415 C:C 0.58% Eb28 C:C 1.83% Eb222 C:C 0.69% Eb416 C:C 0.89% Eb29 C:C 1.69% Eb223 C:C 1.43% Eb417 C:C 0.83% Eb30 C:C 1.16% Eb224 C:C 1.49% Eb418 C:C 0.97% Eb31 C:C 1.22% Eb225 C:C 1.07% Eb419 C:C 0.89% Eb32 C:C 1.39% Eb226 C:C 1.59% Eb420 C:C 1.17% Eb33 C:C 0.65% Eb227 C:C 1.94% Eb421 C:C 0.65% Eb34 C:C 1.28% Eb228 C:C 2.07% Eb422 C:C 1.14% Eb35 C:C 1.09% Eb229 C:C 1.57% Eb423 C:C 1.28% Eb36 C:C 0.79% Eb230 C:C 1.32% Eb424 C:C 0.96% Eb37 C:C 1.17% Eb231 C:C 1.75% Eb425 C:C 0.51% Eb38 C:C 2.05% Eb232 C:C 1.37% Eb426 C:C 0.62% Eb39 C:C 1.18% Eb233 C:C 1.50% Eb427 C:C 0.67% Eb40 C:C 0.53% Eb234 C:C 1.12% Eb428 C:C 0.86% Eb41 C:C 1.11% Eb235 C:C 1.68% Eb429 C:C 0.62% Eb42 C:C 1.75% Eb236 C:C 2.06% Eb430 C:C 0.65% Eb43 C:C 0.95% Eb237 C:C 1.25% Eb431 C:C 0.73% Eb44 C:C 0.85% Eb238 C:C 0.78% Eb432 C:C 1.89% Eb45 C:C 1.43% Eb239 C:C 1.93% Eb433 C:C 1.79% Eb46 C:C 1.06% Eb240 C:C 1.98% Eb434 C:C 0.56% Eb47 C:C 0.93% Eb241 C:C 1.75% Eb435 C:C 0.37% Eb48 C:C 1.75% Eb242 C:C 1.51% Eb436 C:C 0.60% Eb49 C:C 0.98% Eb243 C:C 2.04% Eb437 C:C 0.55% Eb50 C:C 1.20% Eb244 C:C 0.74% Eb438 C:C 0.35% Eb51 C:C 0.74% Eb245 C:C 1.47% Eb439 C:C 0.34% Eb52 C:C 0.62% Eb246 C:C 0.84% Eb440 C:C 0.52% Eb53 C:C 1.48% Eb247 C:C 1.24% Eb441 C:C 0.53% Eb54 C:C 0.85% Eb248 C:C 2.01% Eb442 C:C 0.59% Eb55 C:C 1.10% Eb249 C:C 1.25% Eb443 C:C 0.63% Eb56 C:C 1.32% Eb250 C:C 2.03% Eb444 C:C 0.68% Eb57 C:C 1.28% Eb251 C:C 1.58% Eb445 C:C 1.42% Eb58 C:C 1.29% Eb252 C:C 1.38% Eb446 C:C 0.61% Eb59 C:C 0.66% Eb253 C:C 1.02% Eb447 C:C 0.67% Eb60 C:C 1.22% Eb254 C:C 1.88% Eb448 C:C 0.46% Eb61 C:C 1.05% Eb255 C:C 2.13% Eb449 C:C 1.25% Eb62 C:C 1.32% Eb256 C:C 2.08% Eb450 C:C 0.92% Eb63 C:C 0.73% Eb257 C:C 1.72% Eb451 C:C 0.88% Eb64 C:C 1.89% Eb258 C:C 1.78% Eb452 C:C 0.89% Eb65 C:C 1.07% Eb259 C:C 1.53% Eb453 C:C 0.52% Eb66 C:C 0.66% Eb260 C:C 1.69% Eb454 G:C 1.5252% Eb67 C:C 0.92% Eb261 C:C 1.51% Eb455 G:C 0.4584% Eb68 C:C 1.82% Eb262 C:C 0.84% Eb456 G:C 0.5185% Eb69 C:C 0.62% Eb263 C:C 1.28% Eb457 G:C 0.7609% Eb70 C:C 0.74% Eb264 C:C 1.76% Eb458 G:C 0.7409% Eb71 C:C 1.24% Eb265 C:C 1.46% Eb459 G:C 1.1472% Eb72 C:C 0.98% Eb266 C:C 1.58% Eb460 G:C 0.8204% Eb73 C:C 1.07% Eb267 C:C 1.74% Eb461 G:C 1.2078% Eb74 C:C 0.60% Eb268 C:C 1.90% Eb462 G:C 1.1756% Eb75 C:C 1.39% Eb269 C:C 1.25% Eb463 G:C 0.9862% Eb76 C:C 1.31% Eb270 C:C 1.02% Eb464 G:C 0.9742% Eb77 C:C 0.71% Eb271 C:C 1.32% Eb465 G:C 0.7634% Eb78 C:C 1.53% Eb272 C:C 1.15% Eb466 G:C 0.7963% Eb79 C:C 1.09% Eb273 C:C 1.73% Eb467 G:C 1.3357% Eb80 C:C 1.35% Eb274 C:C 1.28% Eb468 G:C 1.8774% Eb81 C:C 0.83% Eb275 C:C 0.85% Eb469 G:C 1.5980% Eb82 C:C 0.72% Eb276 C:C 1.03% Eb470 G:C 0.8663% Eb83 C:C 0.83% Eb277 C:C 0.65% Eb471 G:C 0.9514% Eb84 C:C 1.08% Eb278 C:C 1.12% Eb472 G:C 1.2528% Eb85 C:C 0.94% Eb279 C:C 0.88% Eb473 G:C 1.0677% Eb86 C:C 0.96% Eb280 C:C 0.82% Eb474 G:C 1.0523% Eb87 C:C 2.07% Eb281 C:C 1.41% Eb475 G:C 1.8828% Eb88 C:C 1.08% Eb282 C:C 1.45% Eb476 G:C 1.4317% Eb89 C:C 1.00% Eb283 C:C 1.91% Eb477 G:C 1.0358% Eb90 C:C 0.91% Eb284 C:C 1.39% Eb478 G:C 1.1203% Eb91 C:C 0.79% Eb285 C:C 0.57% Eb479 G:C 1.3354% Eb92 C:C 0.82% Eb286 C:C 1.25% Eb480 G:C 1.3001% Eb93 C:C 0.74% Eb287 C:C 1.16% Eb481 G:C 1.4666% Eb94 C:C 0.71% Eb288 C:C 1.20% Eb482 G:C 1.6238% Eb95 C:C 1.91% Eb289 C:C 1.95% Eb483 G:C 0.9203% Eb96 C:C 1.59% Eb290 C:C 0.81% Eb484 G:C 1.7549% Eb97 C:C 1.59% Eb291 C:C 1.95% Eb485 G:C 0.7941% Eb98 C:C 0.80% Eb292 C:C 1.20% Eb486 G:C 1.2900% Eb99 C:C 1.49% Eb293 C:C 1.18% Eb487 G:C 1.6831% Eb100 C:C 1.44% Eb294 C:C 1.57% Eb488 G:C 0.5962% Eb101 C:C 1.01% Eb295 C:C 1.75% Eb489 G:C 1.0291% Eb102 C:C 1.41% Eb296 C:C 1.22% Eb490 G:C 0.4696% Eb103 C:C 0.96% Eb297 C:C 1.19% Eb491 G:C 1.5825% Eb104 C:C 0.75% Eb298 C:C 1.02% Eb492 G:C 1.0687% Eb105 C:C 1.14% Eb299 C:C 0.85% Eb493 G:C 1.4718% Eb106 C:C 1.25% Eb300 C:C 1.70% Eb494 G:C 1.9924% Eb107 C:C 0.58% Eb301 C:C 1.02% Eb495 G:C 1.1752% Eb108 C:C 1.29% Eb302 C:C 1.66% Eb496 G:C 1.2859% Eb109 C:C 0.82% Eb303 C:C 1.76% Eb497 G:C 1.9633% Eb110 C:C 1.58% Eb304 C:C 1.02% Eb498 G:C 0.8544% Eb111 C:C 0.75% Eb305 C:C 1.51% Eb499 G:C 1.6246% Eb112 C:C 0.80% Eb306 C:C 1.56% Eb500 G:C 1.2177% Eb113 C:C 0.87% Eb307 C:C 0.87% Eb501 G:C 1.0017% Eb114 C:C 0.85% Eb308 C:C 1.51% Eb502 G:C 1.1668% Eb115 C:C 1.82% Eb309 C:C 0.67% Eb503 G:C 0.9321% Eb116 C:C 1.08% Eb310 C:C 1.02% Eb504 G:C 1.7030% Eb117 C:C 1.49% Eb311 C:C 0.96% Eb505 G:C 1.1180% Eb118 C:C 0.68% Eb312 C:C 1.01% Eb506 G:C 0.8783% Eb119 C:C 0.80% Eb313 C:C 0.92% Eb507 G:C 0.88% Eb120 C:C 1.07% Eb314 C:C 1.02% Eb508 G:C 0.55% Eb121 C:C 0.74% Eb315 C:C 1.47% Eb509 G:C 0.77% Eb122 C:C 0.61% Eb316 C:C 1.36% Eb510 G:C 0.52% Eb123 C:C 0.65% Eb317 C:C 1.60% Eb511 G:C 1.80% Eb124 C:C 1.87% Eb318 C:C 1.28% Eb512 G:C 0.88% Eb125 C:C 0.76% Eb319 C:C 1.39% Eb513 G:C 0.12% Eb126 C:C 1.69% Eb320 C:C 1.15% Eb514 G:C 0.58% Eb127 C:C 0.56% Eb321 C:C 1.66% Eb515 G:C 0.36% Eb128 C:C 0.57% Eb322 C:C 0.98% Eb516 G:C 0.15% Eb129 C:C 0.74% Eb323 C:C 1.22% Eb517 G:C 1.16% Eb130 C:C 0.69% Eb324 C:C 1.24% Eb518 G:C 0.60% Eb131 C:C 0.50% Eb325 C:C 1.09% Eb519 G:C 1.32% Eb132 C:C 0.86% Eb326 C:C 0.79% Eb520 G:G 3.82% Eb133 C:C 0.70% Eb327 C:C 1.36% Eb521 G:G 3.14% Eb134 C:C 1.17% Eb328 C:C 1.94% Eb522 G:G 1.93% Eb135 C:C 1.66% Eb329 C:C 1.58% Eb523 G:G 1.22% Eb136 C:C 0.45% Eb330 C:C 1.41% Eb524 G:G 1.02% Eb137 C:C 0.51% Eb331 C:C 0.79% Eb525 G:G 0.73% Eb138 C:C 0.39% Eb332 C:C 1.99% Eb526 G:G 1.83% Eb139 C:C 0.75% Eb333 C:C 0.64% Eb527 G:G 1.3467% Eb140 C:C 1.20% Eb334 C:C 1.02% Eb528 G:G 1.8775% Eb141 C:C 0.66% Eb335 C:C 1.14% Eb529 G:G 1.4858% Eb142 C:C 0.39% Eb336 C:C 1.09% Eb530 G:G 0.8353% Eb143 C:C 0.52% Eb337 C:C 0.71% Eb531 G:G 1.0970% Eb144 C:C 0.41% Eb338 C:C 1.26% Eb532 G:G 1.1773% Eb145 C:C 0.57% Eb339 C:C 0.57% Eb533 G:G 0.8786% Eb146 C:C 0.53% Eb340 C:C 0.56% Eb534 G:G 0.9995% Eb147 C:C 0.80% Eb341 C:C 0.84% Eb535 G:G 0.9133% Eb148 C:C 1.23% Eb342 C:C 0.96% Eb536 G:G 1.6466% Eb149 C:C 0.43% Eb343 C:C 0.95% Eb537 G:G 1.0360% Eb150 C:C 0.53% Eb344 C:C 0.73% Eb538 G:G 0.9674% Eb151 C:C 0.79% Eb345 C:C 1.21% Eb539 G:G 0.8976% Eb152 C:C 1.71% Eb346 C:C 1.03% Eb540 G:G 1.7580% Eb153 C:C 0.50% Eb347 C:C 1.16% Eb541 G:G 2.1092% Eb154 C:C 2.02% Eb348 C:C 1.21% Eb542 G:G 1.1243% Eb155 C:C 1.22% Eb349 C:C 1.17% Eb543 G:G 1.6041% Eb156 C:C 1.43% Eb350 C:C 0.83% Eb544 G:G 2.7786% Eb157 C:C 0.95% Eb351 C:C 0.93% Eb545 G:G 1.2994% Eb158 C:C 0.67% Eb352 C:C 0.69% Eb546 G:G 2.2185% Eb159 C:C 0.52% Eb353 C:C 1.02% Eb547 G:G 1.4924% Eb160 C:C 0.57% Eb354 C:C 1.23% Eb548 G:G 0.9171% Eb161 C:C 0.82% Eb355 C:C 1.35% Eb549 G:G 1.2887% Eb162 C:C 1.13% Eb356 C:C 1.08% Eb550 G:G 0.8045% Eb163 C:C 0.42% Eb357 C:C 0.74% Eb551 G:G 1.2152% Eb164 C:C 0.95% Eb358 C:C 1.05% Eb552 G:G 2.5218% Eb165 C:C 0.87% Eb359 C:C 1.64% Eb553 G:G 1.4218% Eb166 C:C 0.79% Eb360 C:C 1.17% Eb554 G:G 1.7152% Eb167 C:C 1.22% Eb361 C:C 1.49% Eb555 G:G 1.3712% Eb168 C:C 1.25% Eb362 C:C 0.70% Eb556 G:G 1.5710% Eb169 C:C 1.52% Eb363 C:C 0.95% Eb557 G: G 2.1207% Eb170 C: C 1.14% Eb364 C: C 0.51% Eb558 G: G 1.0304% Eb171 C: C 1.43% Eb365 C: C 1.51% Eb559 G: G 1.3331% Eb172 C: C 1.25% Eb366 C: C 1.39% Eb560 G: G 0.8782% Eb173 C: C 1.26% Eb367 C: C 0.81% Eb561 G: G 1.0364% Eb174 C: C 1.65% Eb368 C: C 0.39% Eb562 G: G 0.6308% Eb175 C: C 0.79% Eb369 C: C 1.18% Eb563 G: G 0.66% Eb176 C: C 1.26% Eb370 C: C 0.91% Eb564 G: G 1.14% Eb177 C: C 0.89% Eb371 C: C 1.22% Eb565 G: G 1.10% Eb178 C: C 1.71% Eb372 C: C 1.27% Eb566 G: G 0.86% Eb179 C: C 1.04% Eb373 C: C 1.19% Eb567 G: G 1.03% Eb180 C: C 1.23% Eb374 C: C 1.30% Eb568 G: G 1.05% Eb181 C: C 0.60% Eb375 C: C 1.00% Eb569 G: G 1.15% Eb182 C: C 1.12% Eb376 C: C 1.40% Eb570 G: G 0.92% Eb183 C: C 1.00% Eb377 C: C 1.52% Eb571 G: G 1.14% Eb184 C: C 1.27% Eb378 C: C 1.50% Eb572 G: G 0.67% Eb185 C: C 1.90% Eb379 C: C 1.37% Eb573 G: G 0.79% Eb186 C: C 0.95% Eb380 C: C 0.72% Eb574 G: G 3.98% Eb187 C: C 0.96% Eb381 C: C 1.67% Eb575 G: G 3.71% Eb188 C: C 1.15% Eb382 C: C 1.17% Eb576 G: G 3.52% Eb189 C: C 1.46% Eb383 C: C 0.94% [[ID= 3.73% 1.38% 1.50% 1.4245% 1.52% 0.73% 0.64% 1.16% 1.50% 0.92% 0.69% 1.29% 1.37% 0.68% The experimental results above show that the average content of ethyl phenolate in *Erigeron breviscapus* genotype GG is 1.5%; the average content of ethyl phenolate in *Erigeron breviscapus* genotype CC is 1.11%; and the average content of ethyl phenolate in *Erigeron breviscapus* genotype GC is 1.09%. The content of ethyl phenolate in *Erigeron breviscapus* genotype GG was significantly higher than that in genotype CC, increasing by 35.14%, a significant difference at the p<0.01 level. The content of ethyl phenolate in *Erigeron breviscapus* genotype GG was significantly higher than that in genotype GC, increasing by 37.61%. In other words, the content of ethyl phenolate in *Erigeron breviscapus* genotypes CC and GC was significantly lower than that in genotype GG.
[0031] Since breeding requires stable inheritance of traits, and the offspring of heterozygotes (GC) exhibit phenotypic segregation (producing GG, GC, CC), it is difficult to maintain uniform traits, making it difficult to select ideal *Erigeron breviscapus* varieties. Therefore, this invention only considers the identification of GG and CC.
[0032] In summary, this invention, through the detection of specific SNP sites using carefully designed primers, can accurately determine the content of ethyl phenolate in *Erigeron breviscapus*. This technology not only provides accurate genotypic information for molecular breeding but also facilitates the rapid screening of *Erigeron breviscapus* varieties with ideal ethyl phenolate content. Furthermore, the technical and theoretical support of this invention makes a significant technological contribution to the development of high-content *Erigeron breviscapus* varieties, promoting agricultural technological progress and increasing the content of medicinal plant components.
[0033] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.
Claims
1. A KASP molecular marker associated with ethyl scutellaria baicalensis, characterized in that, The KASP molecular marker contains the nucleotide sequence of position 39926064 on chromosome 7A of *Erigeron breviscapus*, wherein the base at position 39926064 is G or C.
2. The KASP molecular marker associated with *Erigeron breviscapus* ester ethyl as described in claim 1, characterized in that, The KASP molecular marker is shown in SEQ ID NO.6, where the 101st position is G or C.
3. The primers for the KASP molecular marker associated with *Erigeron breviscapus* ester ethyl as described in claim 1, characterized in that, It includes forward primer 1, forward primer 2, and a shared reverse primer; The nucleotide sequence of the forward primer 1 is shown in SEQ ID NO. 1; The nucleotide sequence of the forward primer 2 is shown in SEQ ID NO.2; The nucleotide sequence of the shared reverse primer is shown in SEQ ID NO.
3.
4. The primers for the KASP molecular marker associated with *Erigeron breviscapus* ester ethyl as described in claim 3, characterized in that, It includes forward primer 1 labeled with FAM fluorescence signal, forward primer 2 labeled with HEX fluorescence signal, and a shared reverse primer; The nucleotide sequence of the forward primer 1 labeled with the FAM fluorescent signal is shown in SEQ ID NO.4, and the nucleotide sequence of the forward primer 2 labeled with the HEX fluorescent signal is shown in SEQ ID NO.
5.
5. Detection reagents, detection kits, or test strips containing primers containing the KASP molecular marker associated with Ethyl argentea var. spp. as described in claim 3 or 4.
6. The application of the detection reagent, detection kit, or test strip for the primers of the KASP molecular marker associated with Elymus esculenta as described in claim 5 in molecular marker-assisted breeding of Elymus esculenta.
7. A method for identifying the content of ethyl acetate in plant caryophyllum, characterized in that, include: Using the DNA of the *Erigeron breviscapus* sample as a template, PCR amplification is performed using the primers of the KASP molecular marker associated with *Erigeron breviscapus* ester as described in claim 3 or 4, or using the detection reagent, detection kit, or test strip as described in claim 5. The content of *Erigeron breviscapus* ester in the plant sample is determined based on the amplification results.
8. The method for identifying the content of plant physalis ethyl acetate according to claim 7, characterized in that, include: Primers for the KASP molecular marker associated with ethyl aril from *Erigeron breviscapus* as described in claim 3 or 4, or the detection reagent, kit, or test strip as described in claim 5, are used to amplify the polymorphic site by PCR. The polymorphic site is the 39926064th site on chromosome 7A of *Erigeron breviscapus*, with a polymorphism of G or C. *Erigeron breviscapus* with genotype GG has a high content of ethyl aril, while *Erigeron breviscapus* with genotype CC has a low content of ethyl aril.
9. The primers of the KASP molecular marker associated with Ethyl arvense ester of claim 3 or 4, or the detection reagent, detection kit, or test strip of claim 5, in any of the following applications: (1) Used for early prediction of the content of ethyl acetate in *Erigeron breviscapus*; (2) Used for screening or cultivating *Erigeron breviscapus* with high content of ethyl pyridinium chloride.