Molecular marker for identifying excellent haplotype of rice lodging-resistant gene osfkp and application thereof

Abstract

This invention discloses a method for identifying lodging resistance genes in rice. OsFKP Molecular markers of superior haplotypes and their applications, wherein the superior haplotype is OsFKP HET The haplotype, SNP858167, located in the upstream regulatory region of its gene, is used for identification. OsFKP HET The haplotype dCAPS primers include a forward primer with the nucleotide sequence shown in SEQ ID NO. 1 and a reverse primer shown in SEQ ID NO. 2. The dCAPS molecular markers provided by this invention are used for rice... OsFKP Gene haplotype identification, combined with lodging resistance phenotypic data, confirmed that the carrier was... OsFKP HET Haplotype rice varieties exhibit higher lodging resistance. This marker can be directly applied to marker-assisted selection (MAS) breeding to achieve precise aggregation and targeted transfer of superior haplotypes, thereby effectively improving the lodging resistance of rice breeding materials and significantly accelerating the breeding process.

Description

Technical Field

[0001] This invention relates to rice breeding, and more specifically, to a method for identifying lodging resistance genes in rice. OsFKP DNA molecular markers of superior haplotypes and their applications. Background Technology

[0002] Faced with the severe challenges of climate change, population growth, and arable land loss, the global food security situation is becoming increasingly tense. It is projected that by 2050, the global population will reach 9.8 billion, requiring food production to double from current levels. As a major staple crop, rice production model innovation is crucial. Direct-seeded rice has been widely promoted due to its high efficiency and labor-saving nature, but its high risk of lodging and poor plant population structure severely restrict the realization of its yield-increasing potential through dense planting. Lodging has become one of the primary agronomic problems limiting high and stable rice yields, especially under dense planting conditions, where the contradiction between photosynthetic inhibition and insufficient stem strength is even more pronounced. Therefore, improving rice's lodging resistance is an urgent need to overcome current breeding bottlenecks.

[0003] Lodging resistance in rice is a complex trait controlled by multiple genes. Currently, several lodging resistance-related genes have been identified, such as SCM2, SCM3, and MYB110. OsFKP The gene encodes an L-fucokinase / GDP-L-fucose pyrophosphorylase. Studies have shown that overexpression of this gene... OsFKP The gene significantly enhances stem strength and lodging resistance in rice, while knocking out the gene significantly weakens these traits. However, regarding... OsFKP There are no reports yet on how differences in SNPs in gene regulatory regions affect the expression level of the gene, and thus lead to differences in lodging resistance among different rice varieties. The favorable haplotypes still need to be explored in depth. Summary of the Invention

[0004] To address the above problems, this invention provides a method for identifying lodging resistance genes in rice. OsFKP Molecular markers of superior haplotypes and their applications: Using these molecular markers, new lodging-resistant rice germplasm and new lodging-resistant varieties can be efficiently created through molecular marker-assisted breeding technology, thereby effectively solving the problem of lodging-related issues in direct seeding or dense planting of rice.

[0005] To achieve the above objectives, the present invention provides, in one aspect, a rice... OsFKP Gene OsFKP HET The application of haplotypes in breeding to improve lodging resistance in rice, the OsFKP HET The haplotype is SNP858167, located in the upstream regulatory region of its gene.

[0006] The second aspect of the present invention provides for identifying the above-mentioned OsFKP HET The haplotype dCAPS primers, which include nucleotide sequences such as SEQ ID NO. 1 (5' CCATGCCATCGAGAATTCCAC The forward primer shown in SEQ ID NO. 2 (5') and the forward primer shown in SEQ ID NO. 2 (5') The reverse primer shown in CCTTTCTGCTAACCTAGCAG 3' is used to distinguish between the G or C base at physical position 858167 (Chr3:858167).

[0007] The primers described above in this invention can rapidly and intuitively identify lodging resistance in rice, making them suitable for large-scale breeding screening and shortening the rice lodging resistance breeding cycle. OsFKP Haplotype detection can screen and identify rice varieties with strong lodging resistance, thereby improving the efficiency of marker-assisted selection in rice lodging resistance breeding.

[0008] The third aspect of this invention provides the above-described dCAPS primers for identification OsFKP HET Applications in haplotypes.

[0009] The fourth aspect of this invention provides the application of the above-mentioned dCAPS primers in identifying lodging resistance in rice.

[0010] The fifth aspect of this invention provides a method for identifying lodging resistance in rice, comprising the following steps: 1) PCR amplification reaction: Using the rice genomic DNA to be tested as a template, PCR amplification was performed using the above primer pair, and the length of the amplification product was 181 bp. 2) Enzyme digestion and electrophoresis detection: The rice variety was digested with the restriction endonuclease BssSI, followed by agarose gel electrophoresis analysis. If the fragment length after digestion remained at 181 bp (the amplification product was not cleaved by BssSI), it indicated that the rice variety being tested carried the enzyme. OsFKP LET The haplotype exhibits low lodging resistance; if the fragment length shortens to 162 bp after enzyme digestion (the amplification product is cleaved by BssSI), it indicates that the tested rice variety carries the haplotype. OsFKP HET The haplotype exhibits high lodging resistance.

[0011] Specifically, in step 1), the PCR amplification system (10 μL) is as follows: 20 1 μL of 100 ng / μL rice genomic DNA to be tested, 5 μL of 2×EasyTaq® PCR SuperMix, 1 μL each of 10 μmol / L forward and reverse primers, and ddH2O to bring the total volume to 10 μL; The PCR amplification reaction conditions were as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 30 sec, annealing at 54℃ for 30 sec, extension at 72℃ for 20 sec, for 35 cycles; final extension at 72℃ for 5 min; and storage at 12℃.

[0012] In step 2), the enzyme digestion reaction system and conditions are as follows: 1 μL of 10×BT buffer (containing BSA), 3 μL of PCR product, 0.1 μL of BssSI restriction endonuclease, and ddH2O to a final volume of 10 μL. Incubate at 37°C for 1 hour. The length of the digested product is 162 bp.

[0013] The enzyme digestion products were separated by electrophoresis on a 2% (w / v) agarose gel at a voltage of 120 V for 20 min. The haplotype and lodging resistance of the rice were determined based on the size of the enzyme digestion product bands.

[0014] Through the above technical solution, the present invention achieves the following beneficial effects: 1. This invention provides a set of dCAPS molecular marker primer pairs for identifying lodging resistance in rice, which can target lodging resistance-related genes in rice. OsFKP This method enables precise detection of different haplotypes. It is simple to operate, provides high visibility of amplified products, and has a high detection throughput, making it suitable for rapid screening of large-scale breeding materials.

[0015] 2. Using the dCAPS molecular marker primer pair provided by this invention, the lodging resistance of rice can be determined quickly and accurately. This method is based on DNA-level detection, is not affected by environmental conditions or growth stage, and has the characteristics of good repeatability and stable results, which is significantly better than traditional field phenotypic identification methods.

[0016] 3. Using the dCAPS molecular markers provided by this invention to target rice OsFKP Gene haplotype identification, combined with lodging resistance phenotypic data, confirmed that the carrier was... OsFKP HET Haplotype rice varieties exhibit higher lodging resistance. This marker can be directly applied to marker-assisted selection (MAS) breeding to achieve precise aggregation and targeted transfer of superior haplotypes, thereby effectively improving the lodging resistance of rice breeding materials and significantly accelerating the breeding process. Attached Figure Description

[0017] Figure 1 for OsFKPLocation of SNPs and Indels in gene regulatory and coding regions; Figure 2 To analyze the significant differences in stem strength and lodging index among 310 main rice varieties HapI to HapVII tested; Figure 3 for OsFKP Analysis of the significance of differences in gene expression levels between HapI and HapVII; Figure 4 To clarify the dual-luciferase assay OsFKP SNP858167 in the gene regulatory region is a superior allelic variant site; Figure 5 Detection of dCAPS molecular markers in 20 major rice varieties OsFKP Genotyping of SNP858167 in the gene regulatory region. Detailed Implementation

[0018] The specific embodiments of the present invention will be described in detail below with reference to examples. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit the present invention. Unless otherwise stated, the experimental methods in the following examples are all conventional methods, and the materials, reagents, carriers, etc. used are all commercially available.

[0019] In the following examples, resequencing data from 310 major rice varieties were used, based on OsFKP Based on SNP and Indel site information in the gene regulatory and coding regions, the gene was classified into seven haplotypes (HapI to HapVII). By integrating phenotypic analysis, gene expression analysis, and promoter enzyme activity analysis among different haplotypes, the specific sites corresponding to superior alleles were identified. Based on this, the present invention developed the dCAPS molecular marker for high-throughput identification of lodging resistance in rice. Specific implementation methods are as follows: Example 1 OsFKP Haplotype analysis of genes Using resequencing data from 310 major rice varieties, the study... OsFKP Analysis of gene regulatory and coding region sequences identified a total of 26 SNP sites and 3 InDel sites. Figure 1 Based on the above mutation site information, 310 rice varieties were divided into 7 haplotypes (HapI ~ HapVII).

[0020] Example 2: Analysis of stem strength and lodging index of HapI to HapVII The stem strength and lodging index of 310 major rice varieties were measured. Using a YYD-1 stem puncture tester, the breaking force (in N) of the third internode of each rice variety was measured at the milk stage. Simultaneously, the fresh weight (W) of the above-ground organs (including the panicle, the three terminal internodes, leaves, and leaf sheaths) was measured, and the vertical distance from the third internode to the panicle tip was measured with a ruler. The bending moment (BM) was calculated as: Bending moment (BM) = Length from the third internode to the panicle tip × W. The lodging index (LI) was calculated using the following formula: LI = BM / Breaking force. A lower lodging index indicates stronger lodging resistance in the rice variety.

[0021] The results are as follows Figure 2 As shown, the stem strength of rice varieties with haplotype HapI was significantly higher than that of the other six haplotypes, while the lodging index was significantly lower. This indicates that haplotype I is an excellent haplotype for lodging resistance in rice.

[0022] Example 3: HapI ~ HapVII haplotype rice varieties OsFKP Gene expression analysis To further verify different haplotypes and OsFKP The relationship between gene expression levels was investigated by analyzing the gene expression levels of representative materials belonging to each haplotype from HapI to HapVII in 310 tested rice varieties. Total RNA was extracted from the third internode tissue of rice stems at the milk-ripe stage, reverse transcribed into cDNA, and detected using real-time quantitative PCR (qRT-PCR). OsFKP Relative gene expression levels. (Taking rice as an example) OsActin Genes were used as internal controls, and 2 -ΔΔCt The relative expression level was calculated using this method. OsFKP Specific primers were designed based on the full-length cDNA sequence of the gene. The upstream primer is SEQ ID No. 3, and the downstream primer is SEQ ID No. 4. OsActin This is an internal reference gene, with its upstream primer being SEQ ID No. 5 and its downstream primer being SEQ ID No. 6.

[0023] SEQ ID No.3: 5'-TGTGTTCACTGGTCAAGTAAGGC-3'; SEQ ID No.4: 5'-TCACCATTCATCAGGGCTTCCC-3'; SEQ ID No.5: 5'-CCCCTCCTGAAAGGAAGTA-3'; SEQ ID No.6: 5'-GGTCCGAAGAATTAGAAGCA-3'; The results are as follows Figure 3 As shown: HapI haplotype rice varieties OsFKP Gene expression levels were significantly higher than in other haplotypes (HapII ~ HapVII), indicating OsFKP High gene expression is an important molecular basis for enhancing stem strength and improving lodging resistance.

[0024] Example 4: Dual-luciferase assay for superior allelic variant sites Sequence alignment analysis revealed that HapI shares three SNPs with the other six non-superior haplotypes in the promoter region: SNP-1046, SNP-390, and SNP-127. Figure 1 To further identify the impact. OsFKP Key mutation sites related to gene expression and lodging resistance were identified by ligating promoter sequences and sequences with different point mutation types from the high-expression variety Wuyunjing 7 (WYG7) and the low-expression variety Huazhan (HZ) into the pGreen-0800 vector, which was then transformed into rice protoplasts. Differences in dual-luciferase activity were detected. The upstream and downstream primers used were as follows: SEQ ID No. 7: 5'-CCCCCCTCGAGGTCGACTGGAGTGGAGTTGTGGAGCTG-3'; SEQ ID No. 8: 5'-TTGGCGTCTTCCATGGCGATCGAGCGACTTTTGCTC-3'; The results are as follows Figure 4 As shown, compared with the promoter activity of the low-expression variety Huazhan (HZ), the promoter fragment with the M1 mutation at SNP-1046 (physical location: Chr3: 858167) showed significantly increased relative activity, comparable to that of the promoter of the high-expression variety Wuyunjing 7 (WYG7). In contrast, the activities of the M2 and M3 point mutations were lower, similar to those of the HZ promoter. This suggests that SNP-1046 (physical location: Chr3: 858167) may be the cause of the high expression of the HZ varietal expression. OsFKP Functional variation sites that differentiate allele expression levels. Therefore, this site is used to... OsFKP Haplotypes are divided into two types: one is the superior type with high expression levels ( OsFKP HET Another type is the one with low expression levels ( OsFKP LET ).

[0025] Example 5: Development of dCAPS molecular markers for identifying lodging resistance in rice Using the dCAPS primer design website http: / / helix.wustl.edu / dcaps / dcaps.html, dCAPS primers SEQ ID NO.1 and SEQ ID NO.2 were designed using SNP-1046 (physical location: Chr3: 858167) to distinguish... OsFKP HET and OsFKP LET In this primer pair, the upstream primer SEQ ID NO. 1 introduces a mutation in a C base, resulting in a primer containing... OsFKP HET A BssSI restriction site for CACGAG is formed in the DNA amplification product of haplotype varieties.

[0026] Example 6: Detection of SNP sites using dCAPS molecular marker primer pairs Twenty major rice varieties were randomly selected, and their genomic DNA was extracted. OsFKP PCR amplification was performed on the gene promoter regulatory region. The forward primer sequence is shown in SEQ ID NO.9, and the reverse primer sequence is shown in SEQ ID NO.10. The PCR products were sequenced and analyzed to classify the test materials into... OsFKP HET (SNP 858167 is base G) and OsFKP LET (SNP858167 is base C) Two haplotypes (Table 1).

[0027] SEQ ID NO.9: 5'-TGGAGTGGAGTGTGGAGCTG-3' SEQ ID NO.10: 5'-CGATCGAGCGACTTTTGCTC-3' Meanwhile, the DNA of the above 20 materials was amplified using the dCAPS primer pair (SEQ ID NO.1 and SEQ ID NO.2) designed in Example 5. The PCR products were then digested with the restriction endonuclease BssSI and analyzed by agarose gel electrophoresis. The judgment criteria were as follows: if the fragment length was still 181 bp after digestion (the amplification product was not cleaved by BssSI), it indicated that the tested rice carried the virus. OsFKP LET The haplotype exhibits low lodging resistance; if the fragment length is 162 bp after enzyme digestion (the amplification product is cleaved by BssSI), and the PCR product becomes smaller, it indicates that the tested rice contains [the following]. OsFKP HETThe haplotype exhibits high lodging resistance.

[0028] The above-mentioned dCAPS primer pairs (SEQ ID NO.1 and SEQ ID NO.2) were used to perform genotyping on 20 materials, and the results were completely consistent with the sequencing genotyping results. Figure 5 The above results demonstrate that the dCAPS molecular marker primer pair developed in Example 5 can accurately detect target SNP sites and has high reliability and practicality.

[0029] The PCR amplification system (10 μL) is as follows: 20 1 μL of 100 ng / μL rice genomic DNA to be tested, 5 μL of 2×EasyTaq® PCR SuperMix, 1 μL each of 10 μmol / L forward and reverse primers, and ddH2O to bring the total volume to 10 μL; The PCR amplification reaction conditions were as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 30 sec, annealing at 54℃ for 30 sec, extension at 72℃ for 20 sec, for 35 cycles; final extension at 72℃ for 5 min; and storage at 12℃.

[0030] The enzyme digestion reaction system and conditions were as follows: 1 μL of 10×BT buffer (containing BSA), 3 μL of PCR product, 0.1 μL of BssSI restriction endonuclease, and ddH2O to a final volume of 10 μL. Incubation was performed at 37°C for 1 hour. The product length after digestion was 162 bp.

[0031] The enzyme digestion products were separated by electrophoresis on a 2% (w / v) agarose gel at a voltage of 120 V for 20 min. The haplotype and lodging resistance of the rice were determined based on the size of the enzyme digestion product bands.

[0032] Table 1. 20 Main Rice Varieties OsFKP Haplotypes of genes

[0033] In summary, this invention targets lodging-resistant genes in rice. OsFKP A systematic study of the haplotypes revealed that they were located on chromosome 3 of rice. OsFKP The SNPs and InDel sites in the gene regulatory and coding regions together constitute seven haplotypes (HapI to HapVII). Among them, HapI was identified as... OsFKP The superior haplotype of the gene significantly improves stem strength and lodging resistance in rice. Further gene expression analysis and dual-luciferase assays confirmed that the gene located at... OsFKPA key variant site is a SNP located at Chr3: 858167 in the upstream regulatory region of the gene. Based on this site, this invention developed a dCAPS molecular marker for [the study of gene mutations]. OsFKP Genotyping using the SNP-1046 gene (physical location: Chr3: 858167) can effectively differentiate rice varieties. OsFKP Superior and non-superior haplotypes of the gene. Through testing and verification in existing rice varieties, the results showed that the superior haplotype materials screened using this molecular marker exhibited significantly better lodging resistance than the non-superior haplotype materials. Therefore, the molecular marker provided by this invention can be widely applied to rice. OsFKP The detection of superior haplotypes and molecular marker-assisted breeding significantly improve the selection efficiency of lodging-resistant breeding.

[0034] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0035] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.

[0036] Furthermore, various different embodiments of the present invention can be combined in any way, as long as they do not violate the spirit of the present invention, they should also be regarded as the content disclosed by the present invention.

Claims

1. A type of rice OsFKP Gene OsFKP HET The application of haplotypes in breeding to improve lodging resistance in rice is characterized by, The OsFKP HET The haplotype is SNP858167, located in the upstream regulatory region of its gene.

2. For identifying the [object] as described in claim 1 OsFKP HET The haplotype dCAPS primer is characterized by, This includes a forward primer with a nucleotide sequence as shown in SEQ ID NO. 1 and a reverse primer as shown in SEQ ID NO.

2.

3. The dCAPS primer of claim 2 in identifying the primer of claim 1. OsFKP HET Applications in haplotypes.

4. The application of the dCAPS primers according to claim 2 in identifying lodging resistance in rice.

5. A method for identifying lodging resistance in rice, characterized in that, Includes the following steps: 1) Using the rice genomic DNA to be tested as a template, PCR amplification was performed using the primers described in claim 2, and the length of the amplification product was 181 bp; 2) Digestion with the restriction endonuclease BssSI. If the fragment length after digestion is still 181 bp, it indicates that the tested rice variety carries the virus. OsFKP LET The haplotype exhibits low lodging resistance; if the fragment length shortens to 162 bp after enzyme digestion, it indicates that the tested rice variety carries the haplotype. OsFKP HET The haplotype exhibits high lodging resistance.

6. The identification method according to claim 5, characterized in that, In step 1), the PCR amplification system is: 20 1 μL of 100 ng / μL rice genomic DNA to be tested, 5 μL of 2×EasyTaq® PCR SuperMix, 1 μL each of 10 μmol / L forward and reverse primers, and ddH2O to bring the total volume to 10 μL; The PCR amplification reaction conditions were as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 30 sec, annealing at 54℃ for 30 sec, extension at 72℃ for 20 sec, for 35 cycles; final extension at 72℃ for 5 min; and storage at 12℃.

7. The identification method according to claim 5, characterized in that, In step 2), the enzyme digestion reaction system and reaction conditions are as follows: 1 μL of 10×BT buffer, 3 μL of PCR product, 0.1 μL of BssSI restriction endonuclease, and ddH2O added to make up to 10 μL; incubate at 37°C for 1 hour.

8. The identification method according to claim 7, characterized in that, The enzyme digestion products were separated by electrophoresis on a 2% agarose gel at a voltage of 120 V for 20 min.

Images