Rotavirus, enteroadenovirus and norovirus detection kit

By designing primer pairs and probes with tailed and folded sequences, and combining them with low-melting-point agarose, MgCl2, and BSA to regulate the reaction system, the problems of cumbersome operation and insufficient sensitivity in enterovirus detection were solved, enabling rapid and accurate multiplex virus detection.

CN122060933APending Publication Date: 2026-05-19INNOVITA BIOLOGICAL TECH CO LTD +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202610516607.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-17
Publication Date
2026-05-19

AI Technical Summary

Technical Problem

Existing technologies for enterovirus detection suffer from problems such as cumbersome operation, high cost, insufficient sensitivity, and non-specific amplification, making it impossible to achieve rapid and accurate on-site detection.

Method used

Primer pairs and probes with tailed and folded sequences were designed to form hairpin structures for convective PCR detection, improving the sensitivity and specificity of the detection. Low-melting-point agarose, MgCl2, and BSA were used to adjust the viscosity of the reaction system to achieve single-tube multiplex detection.

Benefits of technology

It enables the simultaneous detection of norovirus, enteric adenovirus, and rotavirus in a single reaction tube, with short detection time, low cost, high accuracy, and avoidance of false positives and environmental contamination. It is suitable for various sample types.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122060933A_ABST
    Figure CN122060933A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of biomedical treatment, and particularly relates to a rotavirus, enteric adenovirus and norovirus detection kit. A convection amplification primer group in the kit comprises an upstream primer and a downstream primer, each of the upstream primer and the downstream primer comprises a complementary sequence complementary with target nucleic acid and a tailed sequence, and the tailed sequence is located at the 5'end of the complementary sequence and is not complementary with the target nucleic acid; the complementary sequence has a folded sequence, and the folded sequence is complementary with the tailing sequence, so that the primer sequence has a curved hairpin structure; the enterovirus is a norovirus, an enteroadenovirus and a rotavirus. Meanwhile, a primer probe is designed, and a kit for simultaneously detecting multiple enteroviruses is prepared. The kit can avoid non-specific amplification and improve the detection sensitivity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to a detection kit for rotavirus, enteroadenovirus, and norovirus. Background Technology

[0002] Viral gastroenteritis, also known as viral diarrhea, is a group of acute intestinal infectious diseases caused by various viruses. Clinical features include rapid onset, nausea, vomiting, abdominal pain, and diarrhea (watery or loose stools). Fever and general malaise may also occur. The course of the disease is short, and the mortality rate is low. The clinical manifestations of gastroenteritis caused by various viruses are basically similar. Many types of viruses are associated with acute gastroenteritis, among which the main viruses causing viral diarrhea include norovirus (NV), rotavirus (RV), and enteric adenovirus.

[0003] Delayed or inaccurate diagnosis can lead to inappropriate antibiotic use, treatment failure, worsening of the condition, and even death, especially in immunocompromised children, the elderly, or individuals with underlying medical conditions. Furthermore, the clinical symptoms and signs caused by most intestinal bacteria or pathogens are quite similar (often manifesting as vomiting, diarrhea, abdominal pain, etc.), making it extremely difficult to accurately predict the cause based solely on clinical symptoms and signs.

[0004] Norovirus is one of the main pathogens causing acute nonbacterial gastroenteritis in humans. Belonging to the Caliciviridae family, its genome is a single-stranded positive-sense RNA. It is approximately 26–35 nm in diameter, non-enveloped, with a rough surface, spherical shape, and icosahedral symmetry. It is isolated from the feces of patients with acute gastroenteritis and cannot currently be cultured in cells or tissues; there is also no suitable animal infection model. The genome is a full-length single-stranded positive-sense RNA of approximately 7.7 kJ. Based on the homology of its viral VP1 protein sequence, norovirus can be divided into five genogroups (GI to GV), with GI and GII being the main genogroups causing human infection. Norovirus is highly contagious and spreads rapidly, primarily through the fecal-oral route, and can be transmitted through contaminated water, food, and objects. Clinical manifestations are mainly nausea, vomiting, diarrhea, and abdominal pain.

[0005] Enteric adenoviruses, primarily belonging to the Adenovirus F subgenus and including serotypes 40 and 41, are important pathogens causing acute viral gastroenteritis in infants and children. They are mainly transmitted through the digestive tract and commonly present with symptoms such as diarrhea, vomiting, and fever. Their genome is double-stranded DNA, allowing for specific detection via nucleic acid amplification.

[0006] Rotavirus is a double-stranded RNA virus belonging to the Reoviridae family; it is one of the main pathogens causing severe acute gastroenteritis in infants and children. Almost every child in the world around the age of five has been infected with rotavirus at least once. It is primarily transmitted through the fecal-oral route, and clinical manifestations include diarrhea, vomiting, fever, and dehydration. Its genome consists of multiple double-stranded RNA segments, which can be specifically detected through nucleic acid amplification methods. There are seven types of rotavirus, designated A, B, C, D, E, F, and G. Humans are mainly infected by rotavirus types A, B, and C, with rotavirus type A being the most common.

[0007] Chinese patent document CN114292956A discloses a kit, primer-probe composition, and method for the combined detection of multiple enteroviruses. The kit includes a first nucleic acid reaction and a second nucleic acid reaction solution. In the first nucleic acid reaction solution, the nucleotide sequences of the primer pairs and probes for norovirus group GI are as shown in SEQ ID NO. 1–3; the nucleotide sequences of the primer pairs and probes for norovirus group G2 are as shown in SEQ ID NO. 4–6; and the nucleotide sequences of the primer pairs and probes for norovirus are as shown in SEQ ID NO. 7–9. In the second nucleic acid reaction solution, the nucleotide sequences of the primer pairs and probes for rotavirus group A are as shown in SEQ ID NO. 10–12; the nucleotide sequences of the primer pairs and probes for rotavirus group B are as shown in SEQ ID NO. 13–15; and the nucleotide sequences of the primer pairs and probes for astrovirus are as shown in SEQ ID NO. 16–18. While the existing technology can detect norovirus, zarrovirus, rotavirus and human astrovirus in combination, it requires two tubes for testing, which is cumbersome and costly. In addition, it requires a real-time quantitative PCR instrument, which is bulky and expensive, and cannot perform rapid on-site testing (POCT).

[0008] Convection PCR utilizes natural thermal convection to continuously circulate the reaction solution between different temperature zones, thus replacing the programmed heating / cooling of traditional thermal cyclers to achieve nucleic acid amplification. While numerous studies have reported on this technology, it generally suffers from non-specific amplification and insufficient detection sensitivity. Therefore, its current application is limited to fields with lower sensitivity requirements. For applications requiring high sensitivity and specificity, such as the gut microbiota, there are no industrial-scale application cases yet. Improving the detection sensitivity and specificity of convection PCR is a key factor for its industrial application. Summary of the Invention

[0009] The purpose of this invention is to provide a detection kit for rotavirus, enteric adenovirus, and norovirus. By designing primer pairs and probes with folded and tailed sequences for use in countercurrent PCR, the designed primer pairs have a higher annealing temperature due to the tailed sequence, and the hairpin structure formed by the complementary tailed and folded sequences can avoid non-specific amplification, thereby fully utilizing the binding efficiency of primers and probes and improving detection sensitivity.

[0010] To solve the aforementioned technical problems, the present invention specifically adopts the following technical solution: A first aspect of the present invention is to provide a set of convection amplification primers for the simultaneous detection of rotavirus, enteric adenovirus, and norovirus, the set of convection amplification primers comprising an upstream primer and a downstream primer, wherein the sequence of the upstream primer comprises the nucleotide sequences shown in SEQ ID NO:1, SEQ ID NO:4, and SEQ ID NO:7; and the sequence of the downstream primer comprises the nucleotide sequences shown in SEQ ID NO:2, SEQ ID NO:5, and SEQ ID NO:8. Both the upstream and downstream primers include a complementary sequence and a tailing sequence that are complementary to the target nucleic acid. The tailing sequence is located at the 5' end of the complementary sequence and is not complementary to the target nucleic acid. The complementary sequence contains a folded sequence that is complementary to the tailing sequence, giving the primer sequence a curved hairpin structure. The enteroviruses are norovirus, enteric adenovirus, and rotavirus, wherein the specific nucleotide sequence of norovirus is shown in SEQ ID NO:19, the specific nucleotide sequence of enteric adenovirus is shown in SEQ ID NO:20, and the specific nucleotide sequence of rotavirus is shown in SEQ ID NO:21.

[0011] Using the above technical solution, primer pairs with tailed and folded sequences were designed. The tailed sequence is located at the 5' end of the target nucleic acid complementary sequence and is not complementary to the target nucleic acid. The folded sequence is part of the target nucleic acid complementary sequence, located within the target nucleic acid complementary sequence, and is complementary to the tailed sequence. This creates a curved hairpin structure in the entire primer sequence. In the high-temperature region, the hairpin structure is maintained to avoid non-specific amplification, while in the low-temperature region, the hairpin structure opens due to the high temperature, thus achieving effective binding with the template strand. Compared with conventional primer-probe designs, this structure has been experimentally verified to significantly improve detection sensitivity, and can achieve specific, accurate, and sensitive rapid qualitative detection of the aforementioned enteroviruses within 25-35 minutes.

[0012] Preferably, the nucleotide sequences shown in SEQ ID NO:1 and SEQ ID NO:2 are used to detect norovirus, the nucleotide sequences shown in SEQ ID NO:4 and SEQ ID NO:5 are used to detect enteric adenovirus, and the nucleotide sequences shown in SEQ ID NO:7 and SEQ ID NO:8 are used to detect rotavirus.

[0013] Preferably, both the tailed sequence and the folded sequence contain 3-6 bases, and the total content of guanine and cytosine in the bases of the tailed sequence and the folded sequence exceeds 50%. The amplification effect is better when the total content of guanine (G) and cytosine (C) in the bases exceeds 50%.

[0014] A second aspect of the present invention is to provide a probe for simultaneously detecting the convective amplification of multiple enteroviruses as described in the first aspect of the present invention, wherein the 5' end of the probe sequence is labeled with a fluorescent group, wherein the fluorescent group is VIC, FAM, or ROX; and the 3' end of the probe sequence is labeled with an MGB group. The nucleotide sequence of the probe used to detect norovirus is shown in SEQ ID NO:3; the nucleotide sequence of the probe used to detect enteric adenovirus is shown in SEQ ID NO:6; and the nucleotide sequence of the probe used to detect rotavirus is shown in SEQ ID NO:9.

[0015] In some embodiments, the fluorescent groups of each probe sequence should be different and non-interfering with each other, that is, the fluorescent groups used in each fluorescent channel are different and will not affect each other's detection, so that multiple targets can be detected simultaneously using different channels.

[0016] Preferably, the probe for detecting norovirus has a FAM fluorescent group labeled at its 5' end and an MGB group labeled at its 3' end; the probe for detecting enteric adenovirus has a VIC fluorescent group labeled at its 5' end and an MGB group labeled at its 3' end; and the probe for detecting rotavirus has a ROX fluorescent group labeled at its 5' end and an MGB group labeled at its 3' end.

[0017] A third aspect of the present invention is to provide an application of a detection kit for rotavirus, enteric adenovirus, and norovirus, the kit comprising the convection amplification primer pair described in the first aspect of the present invention and the probe described in the second aspect of the present invention, wherein the convection amplification primer pair and the probe are both disposed in the same reaction tube, and nucleic acid amplification reaction is achieved by convection PCR.

[0018] Preferably, the kit further includes an internal reference primer set and an internal reference probe for detecting the human GAPDH gene. The internal reference primer set includes an upstream internal reference primer and a downstream internal reference primer. Both the upstream and downstream internal reference primers include a nucleic acid sequence complementary to the conserved region of the internal reference gene and an internal reference tail sequence. The internal reference tail sequence is located at the end of the nucleic acid sequence complementary to the conserved region of the internal reference gene and is not complementary to the conserved region of the internal reference gene. The nucleic acid sequence complementary to the conserved region of the internal reference gene contains an internal reference folding sequence, which is complementary to the internal reference tail sequence, giving the internal reference primer sequence a curved hairpin structure. The nucleotide sequence of the upstream primer of the internal standard is shown in SEQ ID NO:10; the nucleotide sequence of the downstream primer of the internal standard is shown in SEQ ID NO:11; The nucleotide sequence of the internal standard probe is shown in SEQ ID NO:12; the 5' end of the internal standard probe is labeled with a CY5 fluorescent group, and the 3' end is labeled with an MGB group.

[0019] Preferably, the number of bases in both the internal standard tail sequence and the internal standard fold sequence is 3-6, and the total content of guanine and cytosine in the bases of the internal standard tail sequence and the internal standard fold sequence exceeds 50%.

[0020] Preferably, the convective PCR reaction system comprises: DNA polymerase, deoxynucleoside triphosphate (dNTPs), deoxyuridine triphosphate (dUTPs), UNG enzyme, and PCR buffer. The PCR buffer contains 0.10-0.50% (w / w) low-melting-point agarose, 5-10 mM MgCl2, and 0.6-1.0 mg / mL BSA. The preferred concentrations of low-melting-point agarose are 0.15% (w / w), MgCl2, and BSA. The preferred concentrations are 0.8 mg / mL. The gel temperature of the low-melting-point agarose is 26-30°C (1.5% gel), and the sol temperature is ≤65°C (1.5% gel). By adjusting the concentration of low-melting-point agarose, the viscosity of the reaction system can be adjusted, thereby controlling the nucleic acid amplification reaction time and, consequently, the primer-template binding time during convective PCR.

[0021] Preferably, the convective PCR includes an upper-temperature zone and a lower-temperature zone, wherein the temperature of the upper-temperature zone is 40-95℃, the temperature of the lower-temperature zone is 90-100℃, and the duration is 50-1500s. Preferably, both the upper-temperature zone and the lower-temperature zone are at 95℃, and the duration is preferably 300s.

[0022] Preferably, the method for simultaneously detecting rotavirus, enteroadenovirus, and norovirus using the kit comprises the following steps: S1: Extract nucleic acid from the sample to obtain nucleic acid; S2: Add the nucleic acid to the kit and perform counter-PCR amplification to obtain the analytical results; The types of samples include pathogen cultures, as well as one or more of clinically collected fecal samples, anal swab samples, or gastrointestinal secretion samples; The detection time of the kit is 25-35 minutes.

[0023] In practical applications, the aforementioned kit can simultaneously detect multiple enteroviruses (i.e., norovirus, enteric adenovirus, and rotavirus), and the method is simple and rapid. First, nucleic acids are extracted from the samples, yielding a wide range of sample types, including pathogen cultures, as well as one or more clinically collected fecal samples, anal swab samples, or gastrointestinal secretion samples, meeting the needs of different clinical scenarios. Then, the nucleic acids are added to the kit for convection PCR amplification. By analyzing the signals of different fluorescence channels, the detection results can be obtained. This method not only improves detection efficiency but also provides strong evidence for clinicians to formulate timely treatment plans, helping to improve patient prognosis.

[0024] Using the above-mentioned technical solution, a detection kit is prepared by placing primer pairs and probes, all of which have folded sequences forming hairpin structures, and enteroviruses (i.e., norovirus, enteric adenovirus, and rotavirus) in a single reaction tube. This kit enables the simultaneous detection of these three enteroviruses (norovirus, enteric adenovirus, and rotavirus) in a single tube and in a single experiment. Furthermore, it employs convection PCR amplification, with an actual detection time of only approximately 25-35 minutes, offering advantages such as low cost, high accuracy and sensitivity, and short processing time. In addition, the entire detection process is performed under single-tube closed conditions, avoiding false positives and environmental contamination caused by cross-contamination between samples.

[0025] Preferably, the convection PCR amplification is divided into three stages: Stage 1: Lower temperature region is 60℃, upper temperature region is 40℃, duration is 300s. Stage 2: Lower temperature region is 95℃, upper temperature region is 95℃, duration is 300s. Stage 3: Lower temperature region is 95℃, upper temperature region is 60℃, duration is 1300s. Correspondingly, the detection time for convection PCR is 32min; the detection limit is 500 copies / mL.

[0026] Beneficial technical effects: (1) Primer pairs and probes with tailed sequences and folded sequences were designed. The tailed sequence was placed at the 5' end of the sequence complementary to the target nucleic acid and was not complementary to the target nucleic acid. At the same time, the folded sequence was in the sequence complementary to the target nucleic acid and was complementary to the tailed sequence, so that the primer sequence formed a hairpin structure. During convective PCR amplification, the hairpin structure was maintained in the upper temperature region to avoid non-specific amplification, while in the lower temperature region, the hairpin structure was opened due to the high temperature conditions, thereby achieving effective binding with the template strand and improving the sensitivity and specificity of detection.

[0027] (2) The kit provided by the present invention can detect three enteroviruses (i.e., norovirus, enteroadenovirus and rotavirus) in one reaction tube and in one test. It is low in cost, high in accuracy and sensitivity, and short in time. The actual detection time is only about 25-35 minutes.

[0028] (3) The convection PCR device provided by the present invention is simple, low in cost and portable, and has a wide range of applicable scenarios.

[0029] (4) The present invention uses low melting point agarose, which can adjust the viscosity of the reaction system according to the amplification requirements of different targets, and achieve the best amplification conditions through the synergistic effect of MgCl2 and BSA. Attached Figure Description

[0030] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. In all the drawings, similar parts are generally identified by similar reference numerals. In the drawings, the elements or parts are not necessarily drawn to scale. Obviously, the drawings described below are some embodiments of the present invention, and those skilled in the art can obtain other drawings based on these drawings without creative effort.

[0031] Figure 1 This is a norovirus nucleic acid amplification curve of a specific embodiment 1 of the present invention; Figure 2 This is a specific embodiment 1 of the present invention, showing the amplification curve of intestinal adenovirus nucleic acid. Figure 3 This is a rotavirus nucleic acid amplification curve of a specific embodiment 1 of the present invention; Figure 4 This is an amplification curve of the GAPDH internal standard in a specific embodiment 1 of the present invention; Figure 5 This is the amplification curve of norovirus using conventional primers in Comparative Example 1 of the present invention; Figure 6 The amplification curve of norovirus with an interface sequence but no folded sequence in Comparative Example 2 of the present invention is shown. Figure 7 The norovirus of Comparative Example 3 of the present invention has an interface sequence and a folding sequence, but the GC content in the altered bases is less than 50% of the nucleic acid amplification curve. Figure 8 This is a nucleic acid amplification curve for simultaneous detection of three enteroviruses and an internal standard in specific embodiment 2 of the present invention; Figure 9 This is a comparative nucleic acid amplification curve of the enriched magnetic beads in specific embodiment 2 of the present invention; Figure 10 The image shows the nucleic acid amplification curves for simultaneous detection of three enteroviruses and an internal standard using the reagent kit in Specific Example 5 of this invention. Figure 11 The diagram shows the structure of the upstream primer for norovirus designed for this invention. Detailed Implementation

[0032] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0033] In this document, "and / or" includes any and all combinations of one or more of the listed related items.

[0034] In this article, "multiple" means two or more, that is, it includes two, three, four, five, etc.

[0035] As used in this specification, the term "about" typically means + / -5% of the value, more typically + / -4%, more typically + / -3%, more typically + / -2%, even more typically + / -1%, even more typically + / -0.5%.

[0036] In this specification, certain embodiments may be disclosed in a range-bound format. It should be understood that this "range-bound" description is merely for convenience and brevity and should not be construed as a rigid limitation on the disclosed range. Therefore, the description of a range should be considered as having specifically disclosed all possible subranges and the individual numerical values ​​within those ranges. For example, a description of the range 1-6 should be considered as having specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., and the individual numbers within those ranges, such as 1, 2, 3, 4, 5, and 6. This rule applies regardless of the breadth of the range.

[0037] Definition of noun: As used herein, “nucleic acid” refers to DNA, RNA, or DNA / RNA hybrid molecules existing in single-stranded or double-stranded form. In some embodiments, nucleic acid samples may be isolated from cells or viruses. In some embodiments, nucleic acid samples may include chromosomal DNA, plasmid DNA, recombinant DNA, messenger RNA, ribosomal RNA, transfer RNA, double-stranded RNA, or other RNA present in cells or viruses. Nucleic acid is derived from artificially prepared pathogen cultures, and from one or more clinically collected stool samples, anal swab samples, or gastrointestinal secretion samples.

[0038] As used herein, "target nucleic acid" or "template nucleic acid" refers to a single-stranded or double-stranded DNA or RNA fragment or sequence that is intended to be selectively amplified. The target nucleic acid may be a fragment contained within a longer double-stranded or single-stranded nucleic acid or may be the entire double-stranded or single-stranded nucleic acid. This invention does not impose a specific limitation on the length of the target nucleic acid. In some embodiments, the length of the target nucleic acid is less than 1000 bp, for example, less than 1000, 900, 800, 700, 600, 500, 400, 300, 200, or 100 bp.

[0039] As used herein, “denaturation” refers to the dissociation of all or part of the two complementary strands of a double-stranded nucleic acid using high temperature. As used herein, “annealing” refers to the sequence-specific binding of a primer to a single-stranded nucleic acid template. A primer may bind to the complementary sequence of only one template strand without binding to other regions of the template.

[0040] As used herein, a "primer" refers to a single-stranded nucleic acid or oligonucleotide capable of binding in a sequence-specific manner to a single-stranded region on a target nucleic acid, allowing polymerase-dependent replication of the target nucleic acid. In some embodiments, the target nucleic acid may be a double-stranded nucleic acid such as double-stranded DNA, or a single-stranded nucleic acid such as single-stranded RNA or DNA. If the target nucleic acid is double-stranded, it may be denatured by heating or using an enzyme to induce DNA polymerase activity and amplify the desired single-stranded template or template region.

[0041] As used in this article, convective PCR is an isothermal amplification technique that does not require temperature control equipment. Its core principle is to use the temperature gradient within the reaction system to drive solution convection, thereby achieving nucleic acid denaturation, annealing, and extension cycles, and completing the isothermal amplification method for nucleic acid amplification.

[0042] The following detailed descriptions and discussions of primer pair design and application effects are provided through specific examples.

[0043] First, the primer and probe information of this invention is introduced. The primer pairs and probe sequences designed in specific embodiment 1 and comparative embodiments 1-3 are shown in Table 1. Figure 11 As shown.

[0044] Table 1. Primer pairs and probe sequences designed for Specific Example 1 and Comparative Examples 1-3 Note: In Table 1, a single underline indicates a tail sequence; a double underline indicates a fold sequence, i.e., the position that forms a curved hairpin structure.

[0045] The sequence of the target nucleic acid was obtained from the NCBI database website as follows: Norovirus (NV): AGCAGGTTGGTTTGGAAAGTTGGACCAAAACTCCATCCTCAGGCAGTTGTACTGGACAAGAGGACCCAACCATGAAGACCCCAGTGAGACCATGATACCACACGCACA (SEQ ID NO: 19); Enteric adenovirus (ADV): ​​ATGATGCCGCAATGGTCTTACATGCACATCGCCGGGCAGGACGCCTCGGAGTATCTGAGTCCGGGCCTGGTGCAGTTTGCCCGCGCCACCGATACGTACTTCAGCCTGGGGAACAAGTTCAG (SEQ IDNO: 20); Rotavirus (RV): ATTGGACCATCTGATTCTGCTTCAAACGATCCACTCACCAGCTTTTCGATTAGATCGAATGCAGTTAAGACAAATGCAGACGCTGGCGTGTCTATGGATTCAT (SEQ ID NO: 21); GAPDH gene: AAATCCCATCACCATCTTCCAGGAGCGAGATCCCTCCAAAATCAAGTGGGGCGATGCTGGCGCTGAGTACGTCGTGGAGTCCACTGG (SEQ ID NO: 22).

[0046] The nucleic acids in the amplification reaction systems of all examples were the target nucleic acids; Enzyme mix (including buffer) (using commercially available reagents) represents an enzyme mixture (containing reaction buffer), where 1× indicates the concentration of the enzyme mixture. The specific components of this enzyme mixture are: polymerase, reverse transcriptase, UNG enzyme, and buffer (containing Mg). 2+ The concentration was 20 mM, and dN(U)TPs were used. PCR buffer and enzyme mix (Taq enzyme + reverse transcriptase + UNG enzyme) were provided by Beijing Yinghe Lingyuan Biotechnology Co., Ltd.

[0047] Low melting point agarose (A600015), MgCl2 (A631017), and BSA (A351835) were all provided by Sangon Biotech (Shanghai) Co., Ltd. When used, they were prepared with DEPC-treated water to form a 1.5% low melting point agarose solution (heated to 40℃ before use, and mixed well before use), a 50mM MgCl2 solution, and an 8mg / mL BSA solution, respectively.

[0048] Specific Example 1: In Specific Example 1, all three primer pairs and the internal standard primer pair were designed with tailing and folding sequences, as shown in Table 1. The primer pairs and probe combinations in Specific Example 1 were then detected as follows: (1) Norovirus culture medium, enteric adenovirus culture medium, and rotavirus culture medium were diluted with physiological saline to 1×10⁻⁶. 3 The samples were collected at a rate of copies / mL, and clinically negative stool samples were also collected. After nucleic acid extraction from the samples, counter-PCR amplification was performed.

[0049] (2) The specific steps for nucleic acid extraction are as follows: (1) Using rotavirus and enteric adenovirus pathogen cultures, and norovirus samples with high concentrations detected by real-time PCR, and diluted with physiological saline, simulated samples containing rotavirus, enteric adenovirus and norovirus were prepared; 200 μL of simulated sample was taken, 200 μL of lysis buffer was added, and then ultrasonic lysis was performed for 120 s. The lysis buffer composition was: 30 mM Tris–HCl (pH 7.4), 0.50% IGEPAL CA-630 (Octylphenoxy poly(ethyleneoxy)ethanol), and 1.0% Triton X-100. (2) After sonication, add 10 μL of carboxyl magnetic beads (1 μm, product number: 70104-5), shake to mix for 60 s, then place on a magnetic rack, remove 400 μL of supernatant, and resuspend in 40 μL of DEPC-treated water. (3) Cut off the tip of the pipette tip and repeatedly aspirate 5 times. Then take out 5 μL and add it to the amplification reaction system for convection PCR amplification.

[0050] (4) The amplification reaction system consists of DNA polymerase, deoxynucleoside triphosphate dNTP, UNG enzyme and PCR buffer. The PCR buffer is 0.50% low melting point agarose + 5mM MgCl2 + 0.8mg / mL BSA + PCR Buffer. The PCR Buffer and enzyme system (Taq enzyme + reverse transcriptase + UNG enzyme) are provided by Beijing Yinghe Lingyuan Biotechnology Co., Ltd.

[0051] (5) Convection PCR amplification was performed using convection PCR parameters for RNA.

[0052] The results are as follows Figures 1-4 As shown, all three targets can be amplified, and the internal standard can also be amplified. Therefore, it can be seen that the primer pairs and probe combinations of this invention can detect norovirus. Figure 1 ), enteroadenovirus ( Figure 2 ), Rotavirus ( Figure 3 ) and human-derived GAPDH internal standard ( Figure 4 ).

[0053] The norovirus amplification reaction system is shown in Table 2.

[0054] Table 2. Amplification reaction system for norovirus The amplification reaction system for intestinal adenovirus is shown in Table 3.

[0055] Table 3. Amplification reaction system for enteric adenovirus The rotavirus amplification reaction system is shown in Table 4.

[0056] Table 4. Rotavirus amplification reaction system The GAPDH amplification reaction system is shown in Table 5.

[0057] Table 5 Amplification reaction system of GAPDH internal standard PCR instrument: Convection PCR instrument; Amplification program: Stage 1: Lower temperature region 60℃, upper temperature region 40℃, duration 300s. Stage 2: Lower temperature region 95℃, upper temperature region 95℃, duration 300s. Stage 3: Lower temperature region 95℃, upper temperature region 60℃, duration 1300s.

[0058] The amplification effects of the designed primers are compared and illustrated below through several comparative examples.

[0059] Comparative Example 1: In this comparative example, neither the upstream nor downstream primer of the norovirus primer pair is designed with a tailing sequence or a folding sequence.

[0060] Norovirus culture medium was diluted with physiological saline to 1×10⁻⁶. 3 The samples were collected at 100 copies / mL and nucleic acid was extracted for counter-current PCR amplification and detection. The result was negative. Figure 5 ),and Figure 1 Compared to the detection results, the amplification effect was significantly worse when the primers did not introduce the tailed sequence. The amplification reaction system is shown in Table 6.

[0061] Table 6. Amplification reaction system of Comparative Example 1 PCR instrument: Convection PCR instrument; Amplification program: Stage 1: Lower temperature region 60℃, upper temperature region 40℃, duration 300s. Stage 2: Lower temperature region 95℃, upper temperature region 95℃, duration 300s. Stage 3: Lower temperature region 95℃, upper temperature region 60℃, duration 1300s.

[0062] Comparative Example 2: In this comparative example, the upstream and downstream primers of the norovirus primer pair are designed with tailed sequences, but without folded sequences.

[0063] Norovirus culture medium was diluted with physiological saline to 1×10⁻⁶. 3 Copies / mL, nucleic acid was extracted and subjected to countercurrent PCR amplification and detection. Results are as follows: Figure 6 As shown, with Figure 1 Compared to the detection results, although the primers introduced a tailed sequence, they did not design a folding sequence, thus failing to form a hairpin structure, resulting in poor amplification. The amplification reaction system is shown in Table 7.

[0064] Table 7. Amplification reaction system of Comparative Example 2 PCR instrument: Convection PCR instrument; Amplification program: Stage 1: Lower temperature region 60℃, upper temperature region 40℃, duration 300s. Stage 2: Lower temperature region 95℃, upper temperature region 95℃, duration 300s. Stage 3: Lower temperature region 95℃, upper temperature region 60℃, duration 1300s.

[0065] Comparative Example 3: In this comparative example, both the upstream and downstream primers of the norovirus primer pair were designed with tailed sequences and folded sequences, but the GC content in the tailed sequence was less than 50%.

[0066] Norovirus culture medium was diluted with physiological saline to 1×10⁻⁶. 3 The samples were collected at a concentration of copies / mL and nucleic acid was extracted for counter-current PCR amplification and detection. The test result was negative. Figure 7 ),and Figure 3 Compared to the previous results, the GC content in the tailed sequence introduced by each primer in the primer pair was less than 50%, resulting in a significant decrease in amplification efficiency. The amplification reaction system is shown in Table 8.

[0067] Table 8. Amplification reaction system compared with Example 3 PCR instrument: Convection PCR instrument; Amplification program: Stage 1: Lower temperature region 60℃, upper temperature region 40℃, duration 300s. Stage 2: Lower temperature region 95℃, upper temperature region 95℃, duration 300s. Stage 3: Lower temperature region 95℃, upper temperature region 60℃, duration 1300s.

[0068] Specific Example 2: Whether or not low-melting-point agarose and MgCl₂ are added to the system 2、 BSA conducted a comparative analysis of the detection results, specifically as follows: Using the amplification system in Specific Example 1 (Table 2, excluding agarose, MgCl2 and BSA), and controlling whether to add low-melting-point agarose, MgCl2 and BSA, different detection systems were prepared. The norovirus samples after magnetic bead enrichment treatment in Specific Example 1 were directly subjected to convective PCR amplification and detection.

[0069] The specific test results are shown in Table 9. In the amplification reaction system, the detection effect was poor when no agarose, MgCl2, or BSA was added (Combination 8). The detection effect was poor when only one of MgCl2 or BSA was added (Combinations 6 and 7). The detection results were optimized when only agarose was added (Combination 4). The detection results were optimized when both agarose and BSA were added (Combination 2). The detection results were further optimized when both agarose and MgCl2 were added (Combination 3); the amplification effect was the best when all three products were added (Combination 1).

[0070] Table 9 Comparison of the effects of adding low-melting-point agarose and glycerin in specific examples 2 Notes: - indicates no amplification curve appeared. + indicates amplification is possible, but the amplification curve does not show a typical S-shaped curve, and the time of exponential amplification is relatively late; ++ indicates amplification is possible, slightly better than +, but there is still room for optimization in the fluorescence value and the time of appearance of the curve; +++ indicates amplification is possible, the S-shaped curve is easier to identify than ++, the fluorescence value is high, and the time of exponential amplification is earlier than ++, with better overall amplification effect.

[0071] Specific Example 3: Multiplex system validation was performed using the primer pairs and probe combinations from Specific Example 1, employing fecal samples and a release agent with magnetic beads for direct amplification. Specifically: 1. Using pathogen cultures and diluting them with the matrix solution eluted from negative fecal samples, simulated samples containing norovirus, enteric adenovirus, and rotavirus were prepared. (1) Take 200 μL of simulated sample, add 200 μL of lysis buffer, and then perform ultrasonic lysis for 120 s; ① The composition of the lysis buffer: 30 mM Tris-HCl (pH 7.4), 0.50% IGEPAAL CA-630 (Octylphenoxy poly(ethyleneoxy)ethanol), 1.0% Triton X-100; ② Control experiment: After lysis, 5 μL was directly added to the convection PCR reaction system; (2) After sonication, add 10 μL of carboxyl magnetic beads (1 μm, product number: 70104-5), shake to mix for 60 s, then place on a magnetic rack, remove 400 μL of supernatant, and resuspend in 40 μL of DEPC-treated water. (3) Cut off the tip of the pipette tip and aspirate repeatedly 5 times. Then take out 5 μL and add it to the amplification reaction system for amplification. 2. Amplification reaction system parameters: The amplification reaction system is shown in Table 10.

[0072] (1) The amplification reaction system consists of DNA polymerase, reverse transcriptase, deoxynucleoside triphosphate dNTPs, UNG enzyme and PCR buffer. The PCR buffer is 0.50% low melting point agarose + 5mM MgCl2 + 0.8mg / mL BSA + PCR Buffer. The PCR buffer and enzyme system (Taq enzyme + reverse transcriptase + UNG enzyme) are provided by Beijing Yinghe Lingyuan Biotechnology Co., Ltd.

[0073] (2) PCR Buffer and enzyme system (Taq enzyme + UNG enzyme) were provided by Beijing Yinghe Lingyuan Biotechnology Co., Ltd.

[0074] (3) Convection PCR amplification was performed using convection PCR parameters for RNA. The amplification results are as follows: Figure 8 As shown.

[0075] Specifically, the results show that all three targets can be amplified simultaneously, and the internal standard can also be amplified at the same time; Figure 8 In the image, there are four amplification curves from left to right, representing enteroviruses (Adenovirus)... Figure 8 2) Norovirus ( Figure 8 1) Rotavirus ( Figure 8 3) and GAPDH internal standard ( Figure 8 The amplification curve in section 4) is shown. Additionally, in the control experiment, 5 μL of the lysed sample was directly added to the convection PCR reaction system; the target gene amplification failed, as shown in the results below. Figure 9 As shown, in Figure 9 In the experiment, the successful amplification results were obtained from samples treated with carboxyl magnetic beads, while the unsuccessful amplification results were obtained from control experiments where samples were directly amplified after lysis. The comparison results show that by adding magnetic beads for nucleic acid enrichment after lysis, most of the PCR inhibitors in feces were removed, thus improving the detection rate of borderline positive samples.

[0076] Table 10 Amplification reaction system of specific embodiment 2 PCR instrument: Convection PCR instrument; Amplification program: Stage 1: Lower temperature region 60℃, upper temperature region 40℃, duration 300s. Stage 2: Lower temperature region 95℃, upper temperature region 95℃, duration 300s. Stage 3: Lower temperature region 95℃, upper temperature region 60℃, duration 1300s.

[0077] Tests showed that both the target gene and the internal control gene could be amplified within a detection time of 25-35 minutes, and this data was optimized. After experimental testing, the optimal condition was determined to be 32 minutes.

[0078] Testing showed that the second-stage reaction time could be expanded within the range of 50-500 seconds, and this data was optimized. After experimental testing, the optimal condition was determined to be 300 seconds.

[0079] In some specific embodiments, the method for simultaneously detecting multiple enteroviruses using the kit includes the following steps: S1: Extract nucleic acid from the sample to obtain nucleic acid; S2: Add the nucleic acid to the kit and perform counter-PCR amplification to obtain the analytical results; The types of samples include pathogen cultures, as well as one or more of clinically collected fecal samples, anal swab samples, or gastrointestinal secretion samples; The detection time of the kit is 32 minutes.

[0080] Specific Example 4: Sensitivity verification was performed on the kit prepared using the primer pair and probe combination from Specific Example 1, specifically as follows: Using rotavirus and enteric adenovirus pathogen cultures valued by digital PCR, and norovirus samples with high concentrations detected by quantitative real-time PCR and diluted with physiological saline (10 replicates), as well as 30 clinical samples, direct amplification detection was performed according to Specific Example 2.

[0081] The specific results are shown in Table 11. The detection limit for the three targets was 500 copies / ml, and all positive clinical samples were detectable. The concordance rate of the test results for the 30 clinical samples was 100%, as detailed in Table 12.

[0082] Table 11 Sensitivity Verification Results Table 12 Clinical Sample Validation Results Specific Implementation Example 5: Using the primer pairs and probes from Specific Implementation Example 1 to specifically detect other viruses, specifically as follows: Convection PCR amplification and detection were performed according to the amplification reaction system and amplification procedure of Specific Example 2. Specific pathogens were diluted with matrix solution eluted from negative fecal samples to a concentration >10. 7 CFU / ml (bacteria or mycoplasma) or 10 6 TCID50 (viruses): Eight pathogens were detected, including Coxsackievirus A16, Enterovirus 71, Escherichia coli, Staphylococcus aureus, Yersinia enterocolitica, Shigella flexneri, Salmonella dysenteriae, and Enterococcus faecalis. None of the target genes were detected, and the internal standard genes were amplified normally. The detection results are shown in Table 13.

[0083] Experimental parameters: (1) Nucleic acid extraction was performed on the above-mentioned pathogens; (2) The reaction system includes: DNA polymerase, reverse transcriptase, deoxynucleoside triphosphate dNTP, UNG enzyme and PCR buffer. The PCR buffer is 0.50% low melting point agarose + 5mM MgCl2 + 0.8 mg / mL BSA + PCR Buffer. The PCR Buffer and enzyme system (Taq enzyme + reverse transcriptase + UNG enzyme) are provided by Beijing Yinghe Lingyuan Biotechnology Co., Ltd.

[0084] (3) Amplification program: First stage: Lower temperature region is 60℃, upper temperature region is 40℃, duration is 300s. Second stage: Lower temperature region is 95℃, upper temperature region is 95℃, duration is 300s. Third stage: Lower temperature region is 95℃, upper temperature region is 60℃, duration is 1300s.

[0085] Table 13 Specific detection results The test results showed that all of the above-mentioned viruses were negative. These results demonstrate that the primer-probe combination of the present invention has excellent specificity and does not exhibit cross-reactivity with other common enteroviruses and bacteria.

[0086] Specific Example 6: Produce the corresponding reagent kit according to the amplification reaction system of Specific Example 2, and test the repeatability and stability of the reagent kit.

[0087] After storing the kits at -20±5℃ and 37℃ for one month, respectively, the samples enriched with magnetic beads as described in Example 2 were directly subjected to convection PCR amplification and detection. The results are as follows: Figure 10 As shown.

[0088] Specifically, in Figure 10 In the image, there are eight amplification curves from left to right, representing the detection of enteroviruses by the kit stored under two different conditions (-20±5℃ and 37℃). Figure 10 2) Norovirus ( Figure 10 1) Rotavirus ( Figure 10 3) and GA internal standard ( Figure 10 The amplification curves in section 4) are shown. The results indicate that the kit performance did not significantly decrease after being stored at 37℃ for one month, demonstrating good repeatability and stability. Furthermore, there was no significant difference in results compared to the kit stored at -20℃.

[0089] It should be noted that, in this document, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or apparatus. Unless otherwise specified, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the process, method, article, or apparatus that includes that element.

[0090] The embodiments of the present invention have been described above with reference to the accompanying drawings. However, the present invention is not limited to the specific embodiments described above. The specific embodiments described above are merely illustrative and not restrictive. Those skilled in the art can make many other forms under the guidance of the present invention without departing from the spirit and scope of the claims. All of these forms are within the protection scope of the present invention.

Claims

1. A pair of convection amplification primers for simultaneous detection of multiple enteroviruses, characterized in that, The convection amplification primer set includes an upstream primer and a downstream primer. The upstream primer contains nucleotide sequences as shown in SEQ ID NO:1, SEQ ID NO:4, and SEQ ID NO:

7. The downstream primer contains nucleotide sequences as shown in SEQ ID NO:2, SEQ ID NO:5, and SEQ ID NO:

8. Both the upstream and downstream primers include a complementary sequence and a tailing sequence that are complementary to the target nucleic acid. The tailing sequence is located at the 5' end of the complementary sequence and is not complementary to the target nucleic acid. The complementary sequence contains a folded sequence that is complementary to the tailing sequence, giving the primer sequence a curved hairpin structure. The enteroviruses mentioned are norovirus, enteric adenovirus, and rotavirus.

2. The convective amplification primer pair for simultaneous detection of multiple enteroviruses according to claim 1, characterized in that, Nucleotide sequences such as SEQ ID NO:1 and SEQ ID NO:2 are used to detect norovirus; nucleotide sequences such as SEQ ID NO:4 and SEQ ID NO:5 are used to detect enteric adenovirus; and nucleotide sequences such as SEQ ID NO:7 and SEQ ID NO:8 are used to detect rotavirus.

3. The convective amplification primer pair for simultaneous detection of multiple enteroviruses according to claim 1, characterized in that, The tailed sequence and the folded sequence each contain 3-6 bases; and the total content of guanine and cytosine in the bases of both the tailed sequence and the folded sequence exceeds 50%.

4. A probe for simultaneously detecting the convective amplification of multiple enteroviruses as described in any one of claims 1-3, characterized in that, The probe sequence is labeled with a fluorescent group at the 5' end, which is VIC, FAM, or ROX; the probe sequence is labeled with an MGB group at the 3' end. The nucleotide sequence of the probe used to detect norovirus is shown in SEQ ID NO:3; the nucleotide sequence of the probe used to detect enteric adenovirus is shown in SEQ ID NO:6; and the nucleotide sequence of the probe used to detect rotavirus is shown in SEQ ID NO:

9.

5. The probe according to claim 4, characterized in that, The probe for detecting norovirus has a FAM fluorescent group labeled at its 5' end and an MGB group labeled at its 3' end; the probe for detecting enteric adenovirus has a VIC fluorescent group labeled at its 5' end and an MGB group labeled at its 3' end; the probe for detecting rotavirus has a ROX fluorescent group labeled at its 5' end and an MGB group labeled at its 3' end.

6. A detection kit for rotavirus, enteroadenovirus, and norovirus, characterized in that, The kit includes the convection amplification primer set as described in claims 1-3 and the probe as described in claim 4 or 5, and the convection amplification primer set and the probe are placed in the same reaction tube to achieve nucleic acid amplification reaction by convection PCR.

7. The reagent kit according to claim 6, characterized in that, The kit also includes an internal reference primer set and an internal reference probe for detecting the human GAPDH gene. The internal reference primer set includes an upstream internal reference primer and a downstream internal reference primer. Both the upstream and downstream internal reference primers include a nucleic acid sequence complementary to the conserved region of the internal reference gene and an internal reference tail sequence. The internal reference tail sequence is located at the end of the nucleic acid sequence complementary to the conserved region of the internal reference gene and is not complementary to the conserved region of the internal reference gene. The nucleic acid sequence complementary to the conserved region of the internal reference gene contains an internal reference folding sequence, which is complementary to the internal reference tail sequence, giving the internal reference primer sequence a curved hairpin structure. The nucleotide sequence of the upstream primer of the internal control is shown in SEQ ID NO:10; the nucleotide sequence of the downstream primer of the internal control is shown in SEQ ID NO:11; The nucleotide sequence of the internal reference probe is shown in SEQ ID NO:12; the 5' end of the internal reference probe is labeled with a CY5 fluorescent group, and the 3' end is labeled with an MGB group.

8. The reagent kit according to claim 6, characterized in that, The reaction system of the convection PCR includes: DNA polymerase, deoxynucleoside triphosphate dNTPs, UNG enzyme and PCR buffer, wherein the PCR buffer contains 0.10-0.50% (w / w) agarose, 5-10 mg / mL MgCl2 and 0.6-1.0 mg / mL BSA.

9. The reagent kit according to claim 7, characterized in that, The convective PCR includes an upper temperature region and a lower temperature region. The temperature of the upper temperature region is 40-95℃, and the temperature of the lower temperature region is 90-100℃, with a duration of 50-1500s.

10. The reagent kit according to claim 9, characterized in that, The method for simultaneously detecting rotavirus, enteroadenovirus, and norovirus using the aforementioned kit comprises the following steps: S1: Extract nucleic acid from the sample to obtain nucleic acid; S2: Add the nucleic acid to the kit and perform counter-PCR amplification to obtain the analytical results; The types of samples include pathogen cultures, as well as one or more of clinically collected fecal samples, anal swab samples, or gastrointestinal secretion samples; The detection time of the kit is 25-35 minutes.