A lamp-crispr reaction tube, kit and method for detecting varicella-zoster virus
By combining LAMP-CRISPR detection with a carefully designed LAMP primer set and crRNA, a rapid, sensitive, and specific detection of varicella-zoster virus was achieved, solving the problems of long detection cycles and high equipment requirements in existing technologies. This method is suitable for primary healthcare institutions and home self-testing.
Patent Information
- Application Number
- CN202610533881.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-22
- Publication Date
- 2026-07-24
- Estimated Expiration
- 2046-04-22
AI Technical Summary
Existing technologies for varicella-zoster virus (VZV) detection suffer from problems such as long detection cycles, low sensitivity, high equipment requirements, complex operation, high detection costs, poor reaction system stability, and high non-specific amplification rates, making it difficult to meet the rapid and sensitive detection needs of primary healthcare institutions and home self-testing.
The LAMP-CRISPR combined detection method was adopted. By designing a carefully crafted LAMP primer set and crRNA, and combining the LAMP reaction system lyophilized microspheres and the CRISPR detection system lyophilized powder, a single-tube one-step detection method was achieved. The LAMP primer set was used to specifically amplify the VZV ORF62 gene, and the detection was performed with high sensitivity using the CRISPR/Cas12a system. A nucleic acid release agent was added to efficiently release viral nucleic acid.
It achieves rapid, sensitive, and highly specific VZV detection, with a detection time as fast as 35 minutes. It requires no complicated equipment and is suitable for primary healthcare institutions and home self-testing. The detection limit is as low as 100 copies/μL, which can effectively detect low viral load samples during the latent infection period.
Smart Images

Figure CN122060934B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biological detection technology, specifically relating to a method for detecting varicella-zoster virus (VZV) using loop-mediated isothermal amplification (LAMP) in conjunction with a CRISPR / Cas12a system, as well as a dedicated reaction tube and kit for implementing this method. Background Technology
[0002] Varicella-zoster virus (VZV) is a highly contagious alpha-herpesvirus. Initial infection often causes chickenpox in children. After recovery, the virus remains dormant in nerve ganglia. When the body's immunity declines, the virus can reactivate, leading to shingles, characterized by a severe, painful rash distributed along the nerve pathways. Furthermore, VZV infection can cause serious complications such as encephalitis and pneumonia, posing a significant threat, especially to the elderly and immunocompromised individuals (such as HIV patients and cancer patients undergoing radiotherapy and chemotherapy). Therefore, early and rapid detection of VZV is crucial for clinical intervention and VZV control.
[0003] Currently, commonly used clinical methods for detecting VZV have significant limitations: viral isolation and culture is the gold standard for diagnosis, but the culture cycle is as long as 5-7 days, and the sensitivity is low, making it difficult to meet the needs of rapid diagnosis; serological testing achieves diagnosis by detecting viral antibodies, but it cannot distinguish between past infection and current infection, and is prone to false positives or false negatives; although conventional PCR and quantitative real-time PCR technologies have high sensitivity, they rely on sophisticated temperature cycling instruments, resulting in high testing costs and complex operating procedures, making it difficult to promote and apply them in primary healthcare institutions.
[0004] In recent years, loop-mediated isothermal amplification (LAMP) technology has gained widespread attention in pathogen detection due to its advantages such as eliminating the need for high-temperature denaturation, rapid nucleic acid amplification under isothermal conditions, and low equipment requirements. CRISPR technology, with its high-precision nucleic acid recognition capabilities and triggerable nuclease activity, provides a new technical means for specific detection. While there are reports of combining LAMP with CRISPR for detecting other pathogens, existing LAMP-CRISPR / Cas12a combinations suffer from drawbacks such as easy nucleic acid degradation, poor reaction system stability, high non-specific amplification rate, high risk of lyophilized powder hygroscopic shedding, aerosol contamination, and difficulty in achieving a balance between detection sensitivity and specificity. Furthermore, issues such as insufficient selection of detection reagents and inadequate compatibility between lyophilized reagents and methods lead to fluctuations in detection results. Given the significant differences in the genomic sequences of different pathogens and the characteristics of clinical samples, simply transplanting this combined technology to VZV detection cannot achieve ideal detection results. Summary of the Invention
[0005] In view of this, the purpose of this invention is to provide a reaction tube, kit and method for the dedicated LAMP-CRISPR combined detection of VZV, so as to achieve rapid and sensitive detection of VZV and meet the needs of multiple scenarios such as primary medical institutions, rapid on-site screening and home self-testing.
[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a LAMP-CRISPR reaction tube for detecting varicella-zoster virus. The reaction tube includes lyophilized microspheres of the LAMP reaction system placed at the bottom of the tube, and lyophilized powder of the CRISPR detection system sprayed on the tube cap. The LAMP reaction system includes LAMP primer sets with nucleic acid sequences as shown in SEQ ID NO: 2-7; the CRISPR detection system includes crRNA with nucleic acid sequences as shown in SEQ ID NO: 8.
[0007] In one embodiment, the lyophilized microspheres in the LAMP reaction system contain dithiothreitol and a complex enzyme stabilizer, wherein the complex enzyme stabilizer is trehalose, mannitol and arginine in a mass ratio of 1.8~2 : 0.9~1 : 0.45~0.5.
[0008] In one embodiment, the LAMP reaction system lyophilized microspheres are prepared by lyophilizing a mixture of the following components: reaction buffer, dNTPs, MgSO4, Bst DNA polymerase, the LAMP primer set, dithiothreitol, and the complex enzyme stabilizer.
[0009] In a preferred embodiment, the amounts of each component in the lyophilized microspheres of the LAMP reaction system are as follows: 4.0–6.0 μL of 10×LAMP reaction buffer, 2.0–3.5 μL of 25 mM dNTPs mixture, 2.5–3.5 μL of 100 mM MgSO4, 0.8–2.6 μL of LAMP primer set, 1.5–2.5 μL of 100 mM dithiothreitol, 3.0–5.0 μL of 80 mM complex enzyme stabilizer, 1.5–2.5 μL of 8 U / μL Bst DNA polymerase, and nuclease-free pure water to make up to 40 μL; The LAMP primer set contains two outer primers, two inner primers, and two circular primers. The amount of each primer is as follows: 0.05~0.15μL of each 100μM outer primer, 0.6~1.0μL of each 100μM inner primer, and 0.3~0.5μL of each 100μM circular primer.
[0010] In one embodiment, the CRISPR detection system contains the following components in varying amounts: 1.8–2.2 μL of 1 μM LbaCas12a protein, 2.25–2.75 μL of 1 μM crRNA, and 1.8–2.2 μL of 10 nM dual-labeled fluorescent reporter probe, wherein the nucleic acid sequence of the dual-labeled fluorescent reporter probe is FAM--TTTG--BHQ1.
[0011] The present invention also provides a kit for detecting varicella-zoster virus, comprising the above-mentioned LAMP-CRISPR reaction tube and a nucleic acid release agent.
[0012] In one embodiment, the nucleic acid releasing agent comprises the following components: 0.5-1 M Tris-HCl pH 8.0, 10-20 mM NaCl, 0.5%-0.8% PEG-6000, 0.3%-0.8% Triton X-100, 0.3-0.8 mM surfactin, 300-500 ppM ProClin 300, 1.0-1.5 M betaine, 0.2-0.5 M trehalose, and 0.5-0.8 mM EDTA.
[0013] In one embodiment, the kit further includes a positive control and / or a negative control, wherein the positive control is a recombinant plasmid containing the varicella-zoster virus ORF62 gene fragment, and the negative control is nuclease-free purified water.
[0014] The present invention also provides a method for detecting varicella-zoster virus for non-diagnostic purposes using the above-mentioned kit, comprising the following steps: Viral nucleic acid was extracted from the sample using the nucleic acid releasing agent; The lyophilized microspheres in the LAMP-CRISPR reaction tube were dissolved in nuclease-free pure water, and the viral nucleic acid was added to the LAMP-CRISPR reaction tube for LAMP amplification reaction. After the LAMP amplification reaction is complete, the LAMP-CRISPR reaction tube is inverted to dissolve the lyophilized CRISPR detection system powder in the tube cap into the LAMP amplification reaction solution for CRISPR detection. Result interpretation: The test system detects whether a fluorescent or colorimetric signal is generated in the reaction system. If a signal is generated, the sample is determined to be VZV positive; if no signal is generated, the sample is determined to be VZV negative.
[0015] In one implementation, the LAMP amplification reaction is performed at a temperature of 60-65°C for 20-30 minutes; the CRISPR detection is performed at a temperature of 35-40°C for 15-30 minutes.
[0016] Compared with the prior art, the present invention has the following beneficial effects: (1) High specificity: The present invention, through the double guarantee of carefully designed LAMP primer set and crRNA, generates a specific positive signal only for VZV and has no cross-reaction with common herpesviruses such as herpes simplex virus type 1 / 2 (HSV-1 / 2), cytomegalovirus (CMV), and Epstein-Barr virus (EBV).
[0017] (2) High sensitivity: The method of the present invention can stably detect samples with viral loads as low as 100 copies / μL. Its sensitivity is 10-50 times higher than that of the traditional qPCR method. It can effectively detect samples with low viral loads during the latent infection period and is suitable for early infection diagnosis.
[0018] (3) Fast and convenient: The entire detection process can be completed in as little as 35 minutes. There is no need for complicated nucleic acid extraction operations or temperature cycling. Only a constant temperature water bath, metal bath or portable constant temperature device is needed.
[0019] (4) Simple operation and easy to promote: The LAMP-CRISPR reaction tube of the present invention adopts a "one-step" single-tube closed operation. After sample processing, it only needs to be added to the LAMP-CRISPR reaction tube for detection, without the need for professional technicians. The detection results can be read by a portable fluorescence detector or by observing the color change with the naked eye. It is very suitable for promotion and application in resource-limited primary medical institutions, on-site and even home environments. Attached Figure Description
[0020] Figure 1 The appearance of the LAMP-CRISPR reaction tube; Figure 2 These are the binding sites of each primer to the target sequence; Figure 3 Real-time LAMP amplification curves for three sets of LAMP primers; Figure 4 This indicates the binding site between the crRNA sequence and the target sequence. Figure 5 Results of crRNA screening; Figure 6 A flowchart for rapid and visual detection of VZV using a single-tube, one-step method; Figure 7 This is a schematic diagram of the detection results, where the left side shows the fluorescence detection results and the right side shows the visual detection results; Figure 8 The result of the sensitivity test is shown in the figure; Figure 9 This is a graph showing the results of a specificity test. Detailed Implementation
[0021] This invention provides a LAMP-CRISPR reaction tube for detecting varicella-zoster virus. The reaction tube includes lyophilized microspheres of the LAMP reaction system placed at the bottom of the tube, and lyophilized CRISPR detection system powder sprayed onto the tube cap. This invention uses pre-dispensed LAMP and CRISPR lyophilized reagents within the reaction tube. During use, only the sample to be tested needs to be added, the tube cap tightened, and simple centrifugation / shaking is required to mix the CRISPR detection system in the cap with the LAMP amplification product at the bottom of the tube, achieving "single-tube, one-step" amplification and detection. The pre-dispensed lyophilized reagents ensure precise homogenization of the reaction system in each tube, avoiding batch-to-batch errors and operational deviations associated with manual reagent preparation, and significantly improving the repeatability and reliability of the detection results. Meanwhile, the process does not require multiple pipetting and cap opening. The single-tube closed reaction reduces the interference of the external environment on the reaction system, which reduces the risk of false positives caused by aerosol contamination and greatly simplifies the operation steps. Non-professionals can complete the test after simple training. It can be directly applied to real-time testing scenarios such as clinical emergency, primary screening, and entry-exit quarantine, without relying on large laboratory equipment, effectively expanding the application scope of LAMP-CRISPR technology.
[0022] In the LAMP-CRISPR reaction tube of the present invention, the LAMP reaction system includes a LAMP primer set, which targets the conserved sequence of the VZV ORF62 gene (SEQ ID NO:1), including outer primers F3 and B3, inner primers FIP and BIP, and circular primers LF and LB. The nucleic acid sequences of each primer are as follows: S1-F3: CACCTTTGGGCCAGCG (SEQ ID NO: 2); S1-B3:ACCCCGAGACTGTCGC (SEQ ID NO:3); S1-FIP: GCACAACACAGGGGTTGTTCGTTGCTCGTATCGAGACTGCG (SEQ ID NO: 4); S1-BIP: AAGACCCGCGTCCCCCTGTGGTCCTTGCAACCGTCAA (SEQ ID NO: 5); S1-LF: CCGGGTACAGGTTGGCAAA (SEQ ID NO: 6); S1-LB: CCCCGTGAATACCGGCAGT (SEQ ID NO:7).
[0023] The LAMP primer set of this invention adopts a multi-site cooperative design strategy, designing 6 primers for multiple conserved sites in the target region, which not only ensures isothermal and efficient amplification of LAMP, but also reduces the risk of non-specific amplification through the complementary binding of multiple primers.
[0024] The LAMP reaction system of this invention contains dithiothreitol (DTT) and a complex enzyme stabilizer in its lyophilized microspheres. The complex enzyme stabilizer is composed of trehalose, mannitol, and arginine in a mass ratio of 1.8–2: 0.9–1: 0.45–0.5, with a more preferred mass ratio of 2:1:0.5. The synergistic effect of dithiothreitol and the complex enzyme stabilizer effectively protects the structure and activity of biological components in the LAMP reaction system, particularly Bst DNA polymerase. The active site conformation of Bst DNA polymerase depends on free thiol groups (-SH). DTT can reduce mismatched disulfide bonds in the enzyme molecule to free thiol groups by constructing a reducing environment, thereby preventing irreversible denaturation of Bst DNA polymerase. The complex enzyme stabilizer provides synergistic protection at the physical level, improving the physical properties of the lyophilized microspheres and ensuring the efficiency and stability of the amplification reaction after microsphere reconstitution.
[0025] In one embodiment, the LAMP reaction system lyophilized microspheres of the present invention are prepared by lyophilizing a mixture of the following components: reaction buffer, dNTPs, MgSO4, Bst DNA polymerase, the LAMP primer set, the dithiothreitol, and the complex enzyme stabilizer. In some embodiments, the amounts of each component in each LAMP reaction system lyophilized microsphere are as follows: 4.0–6.0 μL of 10×LAMP reaction buffer, 2.0–3.5 μL of 25 mM dNTPs mixture, 2.5–3.5 μL of 100 mM MgSO4, 0.05–0.15 μL each of 100 μM external primers, 0.6–1.0 μL each of 100 μM internal primers, 0.3–0.5 μL each of 100 μM loop primers, 1.5–2.5 μL of 100 mM dithiothreitol, 3.0–5.0 μL of 80 mM complex enzyme stabilizer, 1.5–2.5 μL of 8 U / μL Bst DNA polymerase, and nuclease-free pure water to make up to 40 μL; more preferably, the amounts of each component in each LAMP reaction system lyophilized microsphere are: 10×LAMP 5 μL reaction buffer, 2.8 μL 25 mM dNTPs mixture, 3 μL 100 mM MgSO4, 0.1 μL 100 μM S1-F3 primer, 0.1 μL 100 μM S1-B3 primer, 0.8 μL 100 μM S1-FIP primer, 0.8 μL 100 μM S1-BIP primer, 0.4 μL 100 μM S1-LF primer, 0.4 μL 100 μM S1-LB primer, 2 μL 100 mM DTT, 4 μL 80 mM complex enzyme stabilizer, add nuclease-free pure water to 38 μL, mix thoroughly, add 2 μL Bst DNA polymerase (8 U / μL), and lyophilize.
[0026] The CRISPR detection system of this invention includes Lba Cas12a (Cpf1), VZV-specific crRNA, and a dual-labeled fluorescent reporter probe, which are mixed and then lyophilized. The nucleic acid sequence of the crRNA described in this invention is UAAUUUCUACUAAGUGUAGAUGUUUUAGAGCUAUGCU-TGCCGCGGTGGGAACGTCGCATA (SEQ ID NO:8), with a specific target sequence modification at the 5' end. By designing crRNA at different sites, this invention not only precisely matches the VZV target sequence but also improves the binding efficiency with the Cas12a protein. Simultaneously, it strictly adheres to the PFS (TTTN) sequence requirements of Cas12a, ensuring that only LAMP-amplified VZV-specific products are recognized, without binding to amplified fragments of other homologous viruses, further amplifying the specificity of the detection and reducing non-specific cleavage activity. The LAMP primer set of this invention is functionally integrated with crRNA, and the LAMP amplification product specifically contains the recognition site of crRNA, which enables efficient connection between amplification and detection in a single tube system without the need for additional transfer or processing. This simplifies the operation process and reduces the risk of aerosol contamination, making it suitable for point-of-care testing (POCT) scenarios with a "single tube one-step method", significantly improving the practicality and translational value of the technology.
[0027] In one implementation method, the concentration of Lba Cas12a (Cpf1) was 1 μM, with a single reaction volume of 1.8–2.2 μL and a specific activity ≥10000 U / mg; the concentration of crRNA was 1 μM, with a single reaction volume of 2.25–2.75 μL; the nucleic acid sequence of the dual-labeled fluorescent reporter probe was FAM--TTTG--BHQ1 (SEQ ID NO:9), with a concentration of 10 nM and a single reaction volume of 1.8–2.2 μL. The CRISPR reaction system was prepared as lyophilized powder and sprayed onto the inside of the reaction tube cap, enabling "single-tube, one-step" amplification and detection in the LAMP-CRISPR reaction tube, reducing contamination and operational errors, and improving the accuracy and sensitivity of detection.
[0028] The present invention also provides a kit for detecting varicella-zoster virus, comprising the above-mentioned LAMP-CRISPR reaction tube, a sampling tube containing a nucleic acid release agent, and negative and / or positive controls.
[0029] In one embodiment, the nucleic acid release agent of the present invention comprises the following components: 0.5-1 M Tris-HCl pH 8.0, 10-20 mM NaCl, 0.5%-0.8% PEG-6000, 0.3%-0.8% Triton X-100, 0.3-0.8 mM surfactantin, 300-500 ppM ProClin 300, 1.0-1.5 M betaine, 0.2-0.5 M trehalose, and 0.5-0.8 mM EDTA. The nucleic acid release agent of this invention has a dual function of "lysis-protection". Using surfactantin as the core lysis agent, it efficiently releases nucleic acid by disrupting the lipid bilayer structure of the VZV viral capsid. A new composite protective agent system of "PEG-6000 + betaine + trehalose + EDTA" is added. PEG-6000 provides steric hindrance stability, betaine regulates osmotic pressure and enhances amplification specificity, trehalose inhibits nuclease activity through water substitution, and EDTA chelates metal ions to block nuclease activation pathways, simultaneously achieving viral lysis, nucleic acid release, and nucleic acid stability protection. As one embodiment, the nucleic acid release agent is placed in a sampling tube with a dropper. During detection, the dropper is unscrewed, the sample to be tested is added to the sampling tube, the dropper is screwed back on, and the tube is inverted to mix. After standing, the lysed sample is then used as a template and added to the LAMP reaction solution for detection. Using the nucleic acid release agent of this invention, VZV viral nucleic acid can be released efficiently. The lysed nucleic acid template can be stably stored at room temperature for 12 hours without the need for cold chain transportation.
[0030] The kit of the present invention also contains a positive control and / or a negative control, wherein the positive control is a recombinant plasmid containing the varicella-zoster virus ORF62 gene fragment, and the negative control is nuclease-free purified water.
[0031] This invention provides a method for detecting varicella-zoster virus for non-diagnostic purposes based on the above-mentioned kit, comprising the following steps: Viral nucleic acid was extracted from the sample using the nucleic acid releasing agent; The lyophilized microspheres in the LAMP-CRISPR reaction tube were dissolved in nuclease-free pure water, and the viral nucleic acid was added to the LAMP-CRISPR reaction tube for LAMP amplification reaction. After the LAMP amplification reaction is complete, the LAMP-CRISPR reaction tube is inverted to dissolve the lyophilized CRISPR detection system powder in the tube cap into the LAMP amplification reaction solution for CRISPR detection. Result interpretation: The test system detects whether a fluorescent or colorimetric signal is generated in the reaction system. If a signal is generated, the sample is determined to be VZV positive; if no signal is generated, the sample is determined to be VZV negative.
[0032] In one implementation, the LAMP amplification reaction is performed at a temperature of 60-65°C for 20-30 minutes; the CRISPR detection is performed at a temperature of 35-40°C for 15-30 minutes.
[0033] The detection method of this invention can be completed in as little as 35 minutes. After sample processing, it only needs to be added to a LAMP-CRISPR reaction tube for detection. This "one-step" single-tube closed-tube operation requires no professional technicians and is very suitable for promotion and application in resource-limited primary healthcare institutions, field settings, and even home environments. The method of this invention has high specificity and sensitivity, with a detection limit as low as 100 copies / μL, and can effectively detect samples with low viral load during the latent infection period, making it suitable for early infection diagnosis.
[0034] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0035] Unless otherwise specified, the following embodiments are all conventional methods.
[0036] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0037] Example 1 Preparation of LAMP-CRISPR reaction tubes LAMP reaction system: Prepare a lyophilized core mixture for one person's reaction system, with the following components: 5 μL 10×LAMP reaction buffer, 2.8 μL 25 mM dNTPs mixture, 3 μL 100 mM MgSO4, 0.1 μL each of 100 μM outer primers, 0.8 μL each of 100 μM inner primers, 0.4 μL each of 100 μM loop primers, 2 μL 100 mM DTT, 4 μL 80 mM complex enzyme stabilizer (trehalose:mannitol:arginine = 2:1:0.5, mass ratio), add nuclease-free pure water to a final volume of 38 μL, mix thoroughly, add 2 μL Bst DNA polymerase (8 U / μL), lyophilize, and aliquot into the bottom of reaction tubes (40 μL / tube).
[0038] The LAMP freeze-dried microspheres were prepared using a gradient cooling-vacuum freeze-drying process: pre-freezing at -20℃ for 2 hours → deep freezing at -50℃ for 4 hours → sublimation drying at -50℃ under vacuum of 10Pa for 12 hours → desorption drying at 25℃ under vacuum of 5Pa for 8 hours. The moisture content of the freeze-dried microspheres was ≤3%, and they were stored in a sealed container.
[0039] CRISPR reaction system: Prepare a mixture for one person's reaction: 2 μL of 1 μM Lba Cas12a protein, 2.5 μL of 1 μM specific crRNA, and 2 μL of 10 nM dual-labeled fluorescent reporter probe (5'-FAM--TTTG--BHQ1-3'). Mix thoroughly, freeze-dry, and then spray evenly onto the inside of the reaction tube cap. The dual-labeled fluorescent reporter probe was synthesized by Shanghai Sangon Biotech Co., Ltd., with the 5' end modified with the fluorescent group FAM and the 3' end modified with the quencher group BHQ1, forming a fluorescence resonance energy transfer (FRET) system suitable for visualization detection under ultraviolet light.
[0040] The CRISPR lyophilized powder preparation process is as follows: It is prepared using a "double lyophilization" process: pre-freezing at -40℃ for 3 hours → lyophilization at -40℃ for 8 hours under vacuum of 15Pa → addition of 30μL of a compound protective agent (0.5% pullulan + 0.3% hydroxypropyl-β-cyclodextrin) → second lyophilization at -30℃ for 4 hours, followed by spraying onto the tube cap.
[0041] The LAMP reaction system and CRISPR detection system were prepared in the same reaction tube. The LAMP amplification reaction system was prepared in the form of lyophilized microspheres and placed at the bottom of the reaction tube; the CRISPR detection system was sprayed onto the tube cap in the form of lyophilized powder (see the appearance of the reaction tube for details). Figure 1 ).
[0042] Example 2 LAMP primer design and screening This invention targets the conserved region of the varicella-zoster virus (VZV) ORF62 target gene (reference sequence number NCBI: NC_001348.1) and designs LAMP primers using the NEB LAMP Primer Design Tool online design software. Different LAMP primers have different amplification efficiencies, which can affect the performance of single-tube detection using LAMP-CRISPR / Cas12a. Therefore, this invention designed and obtained three sets of LAMP primers. The primer sequences are shown in Table 1, and the binding positions of each primer to the target sequence are as follows: Figure 2 As shown. Primers were synthesized by Shanghai Sangon Biotech Co., Ltd.
[0043] Table 1 LAMP primer sequence information The three sets of LAMP primers were configured into three independent LAMP reaction systems; recombinant plasmid DNA containing the ORF62 target gene sequence (sequence shown in SEQ ID NO:1) (synthesized by Shanghai Sangon Biotech Co., Ltd.) was used as a standard template and serially diluted to 10⁻⁶. 3 10 2 10 1 Three concentration gradients of plasmid templates (copies / mL) were established, with enzyme-free pure water (ddH2O) as a negative control. Subsequently, plasmid templates of different concentrations and the negative control were added to their respective LAMP reaction systems, placed in a fluorescence signal detector, and amplified at a constant temperature of 60℃. The detection sensitivity of the three LAMP reaction systems was comprehensively evaluated by monitoring changes in fluorescence signals.
[0044] The results are as follows Figure 3 As shown, Set1 exhibits the best amplification efficiency and sensitivity, reaching 10 copies / μL. Therefore, the LAMP primers from Set1 were selected for subsequent experiments.
[0045] Example 3 crRNA Design and Screening Because the recognition and binding abilities of crRNAs at different sites to target sequences vary, this affects the cleavage efficiency of the CRISPR / Cas12a system. Therefore, this embodiment designs six corresponding CRISPR RNAs (crRNAs) based on the DNA fragment sequences amplified by LAMP. The sequences are shown in Table 2, and the binding positions of the crRNA sequences to the target sequences are as follows: Figure 4 As shown. Synthesized by Shanghai Sangon Biotech Co., Ltd. The LAMP amplification product from Example 2 was added to a LAMP-CRISPR reaction tube, mixed thoroughly, and then quickly placed into an instrument equipped with a FAM fluorescence acquisition system. Detection was performed at 37°C according to the preset program. A crRNA with good sensitivity and specificity was screened for subsequent kit development by determining whether the crRNA could recognize the target DNA sequence and activate the side-chain cleavage activity of Cas12a.
[0046] Table 2 crRNA sequence information The results are as follows Figure 5 As shown, among these 6 crRNAs, crRNA-1 exhibited the strongest cleavage activity in the reaction system, therefore crRNA-1 was identified as the optimal candidate crRNA for subsequent experiments.
[0047] Example 4 A kit for detecting varicella-zoster virus, comprising LAMP-CRISPR reaction tubes as determined in Example 3, nucleic acid release agent sampling tubes, nuclease-free purified water, and a positive control.
[0048] Nucleic acid release agent sampling tube: It contains 500μL of "one-step" nucleic acid release agent with compound protective agent, with dropper and spring pressing device, which can accurately dispense 10μL of solution. The sampling tube is made of polypropylene. The nucleic acid release agent contains the following components: 1M Tris-HCl (pH 8.0), 17mM NaCl, 0.5% PEG-6000, 0.5% Triton X-100, 0.5 mM surfactin, 500 ppM ProClin 300, 1.5M betaine, 0.3M trehalose, and 0.8mM EDTA. The above nucleic acid release agent is dispensed in 500 μL / tube samples using dropper-equipped tubes. This "one-step" nucleic acid release agent can efficiently and rapidly lyse and inactivate viruses and release nucleic acids in a single step, and is compatible with LAMP and CRISPR / Cas12a reaction systems in LAMP-CRISPR reaction tubes.
[0049] Positive control: a recombinant plasmid containing the ORF62 gene fragment of varicella-zoster virus; Nuclease-free pure water: 500μL per tube, individually packaged, can be used as a negative control.
[0050] Example 5 This embodiment utilizes the kit from Example 4 to provide a rapid one-step LAMP / CRISPR / Cas12a single-tube method for detecting varicella-zoster virus. The specific steps are as follows: (1) Sample processing: Add 50 μL of plasma or 10-20 μL of herpes fluid sample to the nucleic acid release agent sampling tube, screw on the dropper, invert and mix 10 times or use a vortex mixer to mix for 10 seconds, let stand at room temperature for 3 minutes before use.
[0051] (2) LAMP amplification reaction: Add 40 μL of nuclease-free pure water to the LAMP-CRISPR reaction tube and let it stand for 2 minutes until the LAMP lyophilized microspheres dissolve. Place the dropper of the nucleic acid release agent sampling tube above the LAMP-CRISPR reaction tube and gently press the spring at the top of the nucleic acid release agent sampling tube once (each press can accurately dispense 10 μL of solution). Shake the LAMP-CRISPR reaction tube left and right to mix the reaction solution. Then, perform the amplification reaction at a constant temperature of 65℃ for 20 minutes.
[0052] (3) CRISPR cleavage reaction: After LAMP amplification, invert the LAMP-CRISPR reaction tube for 2 minutes to dissolve the CRISPR / Cas12a lyophilized powder adhering to the tube cap; then invert the LAMP-CRISPR reaction tube 10 times to mix, and then concentrate the reaction solution to the bottom of the reaction tube by gently shaking the reaction tube or by short-term centrifugation; then carry out the cleavage reaction at a constant temperature of 37℃ for 15-20 minutes.
[0053] (4) Result Interpretation: Fluorescence signal intensity was analyzed using an instrument equipped with a FAM fluorescence acquisition system. The instrument was temperature-controlled at 37°C and collected FAM fluorescence intensity every 30 seconds. When the fluorescence signal intensity in the reaction tube increased, the sample contained VZV virus; when the fluorescence signal intensity in the reaction tube remained unchanged, the sample did not contain VZV virus. Figure 7 Left).
[0054] Alternatively, the results can be visually interpreted. Visual observation should be conducted under ultraviolet or blue light: when green fluorescence is visible to the naked eye, the sample contains VZV virus; when no green fluorescence is visible, the sample does not contain VZV virus. Figure 7 right).
[0055] The entire detection process of this invention takes about 35-40 minutes. Compared with traditional methods, it is shorter in time, lower in cost and simpler to operate. It does not require complex instruments and strict laboratory environment. Moreover, the one-tube method greatly reduces aerosol pollution caused by opening the cap for sampling and detection after amplification.
[0056] Example 6 Performance Validation of "One-Step" Nucleic Acid Release Agent To verify the feasibility of the "one-step" nucleic acid release agent extraction process in Example 4 of this invention, three positive herpes fluid samples (numbered 1-3) and five positive serum samples (numbered 4-8) were collected from clinical samples. The samples were extracted using the "one-step" extraction method of this invention and a commercially available nucleic acid extraction kit (viral genomic DNA / RNA extraction kit (DP315), purchased from Tiangen Biotech (Beijing) Co., Ltd.). Then, LAMP-CRISPR detection was performed according to the method in Example 5.
[0057] Experimental results: The detection results of the experimental group (one-step method) and the control group (commercially available kit) for 8 VZV positive samples were consistent, with a positive detection rate of 100% for both groups. The fluorescence signal intensity showed no significant difference between the two groups, indicating that the nucleic acid extraction efficiency of the present invention is comparable to that of commercially available column extraction kits, which can efficiently release VZV viral nucleic acid (results are shown in Table 3). Moreover, the operation process is simple and requires no additional equipment, which can meet the needs of multiple scenarios such as primary medical institutions, rapid on-site screening, and home self-testing.
[0058] Table 3 Comparison of extraction methods between "one-step" nucleic acid release agents and commercially available nucleic acid extraction kits. In addition, the lysed nucleic acid template of this invention was placed at room temperature (25℃) for 0h, 2h, 4h, 6h, 8h, 12h, 14h, and 16h, respectively. At each time point, 10μL of template was taken for LAMP-CRISPR detection, and each time point was repeated three times. The positive detection rate and the average change in fluorescence signal intensity were recorded. The results showed that the nucleic acid template lysed using this invention, when placed at room temperature for 12h, showed positive results in all three repeated detections, and the fluorescence signal intensity did not decrease. This indicates that the nucleic acid template extracted by the "one-step method" of this invention has good stability at room temperature (results are shown in Table 4).
[0059] Table 4. Stability test of nucleic acid templates extracted by the "one-step method" Example 7 LAMP / CRISPR / Cas12a Detection of VZV Virus Sensitivity Test Using ORF62 recombinant plasmid DNA as a standard, it was diluted to 1×10⁻⁶. 5 copies / μL, 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 Five concentration gradients were set up: copies / μL and 10 copies / μL, with enzyme-free pure water (ddH2O) as a negative control. The above standards were tested using the LAMP / CRISPR / Cas12a single-tube one-step method described in Example 5 to evaluate the sensitivity of this invention in detecting VZV virus.
[0060] The fluorescence visualization results under ultraviolet transmission show that ( Figure 8 ), in 1×10 5 copies / μL to 1×10 2Within the concentration range of copies / μL, all reaction tubes showed clear green fluorescent positive signals; while the 10 copies / μL sample and negative control tubes showed no obvious fluorescence, consistent with the background. Quantitative fluorescence analysis further verified this trend: the fluorescence values of the negative control and the 10 copies / μL group were close to the baseline, with no significant amplification signal; when the plasmid concentration reached 100 copies / μL, the detection system began to produce a quantifiable fluorescence signal, and the fluorescence intensity increased with increasing plasmid concentration, showing a clear dose-dependent relationship. Combining the visualization and quantitative results, the limit of detection (LOD) for VZV using this method is 100 copies / μL, indicating that the detection system can stably detect VZV recombinant plasmids as low as 100 copies / μL, possessing high detection sensitivity.
[0061] Example 8 LAMP / CRISPR / Cas12a assay for VZV virus specificity To verify the specificity of the LAMP / CRISPR / Cas12a single-tube one-step method for detecting varicella-zoster virus (VZV) established in this invention, we selected other herpesviruses in the same family as VZV: herpes simplex virus type 1 (HSV-1), herpes simplex virus type 2 (HSV-2), cytomegalovirus (CMV), and Epstein-Barr virus (EBV) standards, as well as healthy human genomic DNA (human DNA) and template-free purified water (NTC) as control samples, and performed parallel detection with VZV positive samples.
[0062] The fluorescence visualization results under ultraviolet transmission show that ( Figure 9 Only the reaction tubes corresponding to VZV positive samples showed a clear green fluorescent positive signal; while the reaction tubes of other herpesvirus samples such as HSV-1, HSV-2, CMV, and EBV, human genomic DNA samples, and negative control (NTC) showed no obvious fluorescence, consistent with the background, and no non-specific amplification signal was observed.
[0063] The above results demonstrate that the LAMP / CRISPR / Cas12a detection method established in this study has excellent specificity, can accurately identify VZV, and has no cross-reactivity with other common herpesviruses and human genomic DNA, effectively avoiding false positive results caused by non-target templates.
[0064] Example 9 LAMP / CRISPR / Cas12a clinical sample testing trials To verify the clinical applicability of the method of the present invention, we tested 48 clinical samples (36 plasma samples and 12 herpes fluid samples). All samples were randomly blinded and tested using both the method of Example 5 of the present invention and the gold standard qPCR, and the two detection methods were compared.
[0065] The results are shown in Table 5. All 48 samples that tested positive by qPCR were also positive using the method of this invention. Of the 22 samples that tested negative by qPCR, 5 were positive and 17 were negative using the method of this invention, resulting in a concordance rate of 89.58%. The sensitivity of qPCR is typically around 1000 copies / mL, indicating that the sensitivity of the method of this invention is significantly higher than that of qPCR.
[0066] Table 5 Comparison of Clinical Sample Test Results The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A LAMP-CRISPR reaction tube for detecting varicella-zoster virus, the reaction tube comprising lyophilized microspheres of the LAMP reaction system placed at the bottom of the tube, and lyophilized powder of the CRISPR detection system sprayed onto the tube cap; characterized in that, The LAMP reaction system lyophilized microspheres are prepared by mixing and lyophilizing the following components: reaction buffer, dNTPs, MgSO4, Bst DNA polymerase, LAMP primer set, dithiothreitol, and a complex enzyme stabilizer; the nucleic acid sequences of the LAMP primer set are shown in SEQ ID NO: 2-7; the complex enzyme stabilizer is trehalose, mannitol, and arginine in a mass ratio of 1.8-2: 0.9-1: 0.45-0.5; the CRISPR detection system includes crRNA with a nucleic acid sequence as shown in SEQ ID NO: 8, Lba Cas12a protein, and a dual-labeled fluorescent reporter probe.
2. The LAMP-CRISPR reaction tube according to claim 1, characterized in that, The amounts of each component in the lyophilized microspheres of the LAMP reaction system are as follows: 4.0–6.0 μL of 10×LAMP reaction buffer, 2.0–3.5 μL of 25 mM dNTPs mixture, 2.5–3.5 μL of 100 mM MgSO4, 0.8–2.6 μL of LAMP primer set, 1.5–2.5 μL of 100 mM dithiothreitol, 3.0–5.0 μL of 80 mM complex enzyme stabilizer, 1.5–2.5 μL of 8 U / μL Bst DNA polymerase, and nuclease-free pure water to make up to 40 μL; The LAMP primer set contains two outer primers, two inner primers, and two circular primers. The amount of each primer is as follows: 0.05~0.15μL of 100μM outer primer, 0.6~1.0μL of 100μM inner primer, and 0.3~0.5μL of 100μM circular primer.
3. The LAMP-CRISPR reaction tube according to claim 1, characterized in that, The CRISPR detection system contains the following components in varying amounts: 1.8–2.2 μL of 1 μM Lba Cas12a protein, 2.25–2.75 μL of 1 μM crRNA, and 1.8–2.2 μL of 10 nM dual-labeled fluorescent reporter probe. The nucleic acid sequence of the dual-labeled fluorescent reporter probe is FAM--TTTG--BHQ1.
4. A kit for detecting varicella-zoster virus, characterized in that, It includes the LAMP-CRISPR reaction tube as described in any one of claims 1 to 3, and the nucleic acid release agent.
5. The reagent kit according to claim 4, characterized in that, The nucleic acid releasing agent comprises the following components: 0.5-1 M Tris-HCl (pH 8.0), 10-20 mM NaCl, 0.5%-0.8% PEG-6000, 0.3%-0.8% Triton X-100, 0.3-0.8 mM surfactin, 300-500 ppM ProClin 300, 1.0-1.5 M betaine, 0.2-0.5 M trehalose, and 0.5-0.8 mM EDTA.
6. The reagent kit according to claim 4, characterized in that, It also includes a positive control and a negative control, wherein the positive control is a recombinant plasmid containing the varicella-zoster virus ORF62 gene fragment, and the negative control is nuclease-free pure water.
7. A method for detecting varicella-zoster virus for non-diagnostic purposes using the kit described in any one of claims 4 to 6, characterized in that, Includes the following steps: Viral nucleic acid was extracted from the sample using the nucleic acid releasing agent; The lyophilized microspheres in the LAMP-CRISPR reaction tube were dissolved in nuclease-free pure water, and the viral nucleic acid was added to the LAMP-CRISPR reaction tube for LAMP amplification reaction. After the LAMP amplification reaction is completed, the LAMP-CRISPR reaction tube is inverted to dissolve the lyophilized CRISPR detection system powder in the tube cap into the LAMP amplification reaction solution for CRISPR detection. Result interpretation: The test system detects whether a fluorescent or colorimetric signal is generated in the reaction system. If a signal is generated, the sample is determined to be VZV positive; if no signal is generated, the sample is determined to be VZV negative.
8. The method according to claim 7, characterized in that, The LAMP amplification reaction was performed at a temperature of 60-65℃ for 20-30 minutes; the CRISPR detection was performed at a temperature of 35-40℃ for 15-30 minutes.
Citation Information
Patent Citations
Kit and method for detecting crRNA and LAMP-CRISPR / Cas12a for detecting influenza virus types and application
CN118547109A
QPCR (quantitative polymerase chain reaction) primer probe combination for detecting varicella-zoster virus and application of qPCR primer probe combination
CN118745486A
Novel reaction tube
CN222540767U