A highly efficient degrading bacterium with a metabolic preference for chlorophenol pollutants and its application.
By screening and isolating the RT8 strain of Bacillus thuringiensis, the problem of narrow resolution spectrum reduction in existing chlorophenol pollutant degrading strains with additional carbon sources was solved, achieving efficient degradation of various chlorophenol compounds in complex environments and improving the application effect of microbial remediation technology.
Patent Information
- Application Number
- CN202610562186.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-27
- Publication Date
- 2026-06-30
- Estimated Expiration
- 2046-04-27
AI Technical Summary
Existing strains that degrade chlorophenol pollutants have narrow degradation spectra due to the presence of additional carbon sources, are easily inhibited by carbon metabolites, and are difficult to efficiently degrade chlorophenol pollutants in complex environments, and their degradation spectrum is relatively narrow.
A strain of Cupriavidus sp., RT8, was screened out. By enriching and purifying it in a medium containing trichlorophenol, a highly efficient degrading bacterium with a metabolic preference for chlorophenol pollutants was obtained, which can maintain high degradation activity in the presence of an additional carbon source.
Strain RT8 can efficiently degrade a variety of chlorophenols, including monochlorophenol, dichlorophenol and trichlorophenol, and maintains high adaptability in complex environments, overcoming the carbon metabolite inhibition effect and promoting the practical application of microbial remediation technology.
Smart Images

Figure CN122081182B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbial technology, specifically relating to a highly efficient degrading bacterium with a metabolic preference for chlorophenol pollutants and its applications. Background Technology
[0002] Chlorophenols (CPs), such as monochlorophenol (MCP), dichlorophenol (DCP), and trichlorophenol (TCP), are important organic pollutants widely used in wood preservatives, pesticides, herbicides, and chemical synthesis intermediates. These substances are highly toxic, difficult to biodegrade, and environmentally persistent, and are listed as priority pollutants by many countries. They pose significant "three-fold" risks (carcinogenic, teratogenic, and mutagenic) to aquatic organisms and humans; therefore, the development of efficient, economical, and environmentally friendly chlorophenol pollutant removal technologies is urgently needed.
[0003] Microbial degradation is one of the most promising methods for treating chlorophenol contamination. The principle is to utilize the metabolic activities of specific microorganisms to convert toxic chlorophenols into harmless or less toxic products, or even completely mineralize them into CO2, H2O, etc. Currently, numerous studies have reported strains capable of degrading specific chlorophenols, such as certain Pseudomonas species (…). Pseudomonas ), Sphingosine mononucleosis ( Sphingomonas ), Rhodococcus ( Rhodococcus )wait.
[0004] However, the practical application of microbial degradation technology is severely constrained by environmental factors, among which the presence of additional carbon sources is a key challenge. In actual wastewater or contaminated sites, chlorophenol pollutants rarely exist alone and usually coexist with easily degradable organic matter such as sugars, organic acids, and alcohols. For most reported degrading bacteria, these readily available additional carbon sources trigger the "Carbon Catabolite Repression" (CCR) effect. The consequences are: (1) Degradation pathways are inhibited: microorganisms preferentially metabolize and utilize simple additional carbon sources, and the synthesis of key enzymes responsible for chlorophenol degradation (such as oxygenases and dehalogenases) is inhibited or delayed; (2) Degradation activity is reduced: strains may severely delay initiating the degradation of chlorophenols, leading to treatment failure or extended cycles; (3) Poor process stability: many strains that perform well under pure culture conditions in the laboratory are difficult to achieve the expected efficiency in the complex environment of actual conditions, limiting their engineering applications.
[0005] Most current screening or functional studies of strains degrading chlorophenols only consider the pollutant as the sole carbon source, without verifying their ability to resist interference from additional carbon sources. Most reported strains typically exhibit specificity or high degradation activity against only one or two structurally similar chlorophenols, resulting in a narrow degradation spectrum.
[0006] There is an urgent need in this field for a novel microbial resource that combines broad-spectrum and highly efficient degradation activity with strong environmental adaptability, capable of efficiently degrading chlorophenols in the presence of an additional carbon source (i.e., exhibiting a metabolic preference for the target pollutant), in order to solve existing technical problems and promote the practical application of bioremediation technology for chlorophenol pollutants. Summary of the Invention
[0007] 1. Purpose of the invention
[0008] The purpose of this invention is to provide a highly efficient degrading bacterium with a metabolic preference for chlorophenol pollutants and its application. This chlorophenol-degrading strain belongs to the genus *Copper-degrading Bacillus*. Cupriavidus sp. A new strain, named RT8, is found in the study. It combines broad-spectrum degradation and environmental robustness.
[0009] 2. Technical Solution
[0010] To achieve the objective of this invention, the technical solution adopted by this invention is as follows:
[0011] This invention provides a highly efficient degrading bacterium with a metabolic preference for chlorophenol pollutants. This highly efficient degrading bacterium was deposited on December 19, 2025, at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number CCTCC NO: M20252969, and classified as follows: Cupriavidus sp. RT8.
[0012] Furthermore, the 16S rRNA gene sequence of the above-mentioned highly efficient degrading bacteria is shown in SEQ ID NO.3.
[0013] This invention also provides a method for screening highly efficient degrading bacteria with a metabolic preference for the above-mentioned chlorophenol pollutants, comprising the following steps:
[0014] S1: Using trichlorophenol as a carbon source to enrich microbial strains from activated sludge collected from the wastewater treatment plant's return tank;
[0015] S2: Isolate and purify the enriched bacterial strains.
[0016] Furthermore, the above-mentioned enrichment strains are obtained by culturing activated sludge in a culture medium containing trichlorophenol.
[0017] Furthermore, the culture medium contains an additional carbon source selected from one or more of sugars, alcohols, organic acids, and coexisting contaminants.
[0018] Furthermore, the above separation and purification involves diluting the product obtained in step S1, spreading it onto an agar plate, culturing it, and then streaking it for purification once colonies have grown on the plate.
[0019] Furthermore, the above dilution was prepared using sterile water to a concentration of 10. -1 -10 -7 Seven dilutions with concentration gradients.
[0020] Furthermore, the above-mentioned plating on agar plates was carried out at a constant temperature of 30°C for 24 hours.
[0021] The present invention also provides a biological agent containing the above-mentioned highly efficient degrading bacteria.
[0022] The present invention also provides the application of the above-mentioned highly efficient degrading bacteria in the degradation of chlorophenol pollutants.
[0023] Furthermore, the above application includes inoculating the highly efficient degrading bacteria into wastewater containing chlorophenol pollutants.
[0024] 3. Beneficial effects
[0025] Compared with the prior art, the advantages of this invention are as follows:
[0026] The present invention provides a highly efficient degrading bacterium with a metabolic preference for chlorophenol pollutants, which overcomes the limitation of the narrow degradation spectrum of existing strains. It can simultaneously and efficiently degrade multiple chlorophenol compounds such as monochlorophenol, dichlorophenol, and trichlorophenol, and is adapted to complex compound pollution environments.
[0027] The present invention provides a highly efficient degrading bacterium with a metabolic preference for chlorophenol pollutants, which overcomes the "carbon metabolite inhibition" effect. Under the condition that an additional carbon source (such as glucose) is readily available, it can still maintain highly efficient degradation activity of chlorophenols. It has high adaptability and treatment efficiency in real polluted environments, and promotes the practical engineering application of microbial remediation technology.
[0028] The strain RT8 provided by this invention belongs to the genus *Copper-bearing Bacillus* in taxonomy. Cupriavidus sp. This is a novel bacterial species. It exhibits excellent degradation capabilities for chlorophenols, and its degradation performance for 2,4,6-TCP remains unchanged even with the interference of a simple additional carbon source. In terms of performance, it is a rare bacterium that preferentially and efficiently metabolizes pollutants between simple carbon sources and recalcitrant pollutants. Attached Figure Description
[0029] Figure 1 This is a single-strain plate image of RT8.
[0030] Figure 2 This is a phylogenetic tree of RT8 single bacteria (in the figure, "This study" refers to the RT8 bacteria of this invention).
[0031] Figure 3 This is a graph showing the degradation performance of RT8 on monochlorophenol, dichlorophenol, and trichlorophenol.
[0032] Figure 4 This is a schematic diagram illustrating the degradation of 2,4,6-TCP by RT8 under different types and concentrations of additional carbon sources. Detailed Implementation
[0033] The present invention will be further described below with reference to specific embodiments.
[0034] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains; the term “and / or” as used herein includes any and all combinations of one or more of the associated listed items.
[0035] Unless otherwise specified in the examples, the procedures should be performed under standard conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.
[0036] As used herein, the term “about” is used to provide for the flexibility and imprecision associated with a given term, measure, or value. Those skilled in the art can readily determine the degree of flexibility for a particular variable.
[0037] As used herein, the term “at least one of…” is intended to be synonymous with “one or more of…”. For example, “at least one of A, B, and C” explicitly includes only A, only B, only C, and combinations thereof.
[0038] Concentration, amount, and other numerical data may be presented in range format herein. It should be understood that such range format is used solely for convenience and brevity and should be flexibly interpreted to include not only the values explicitly stated as the limits of the range, but also all individual values or subranges encompassed within the range, as if each value and subrange were explicitly stated. For example, a range of values from about 1 to about 4.5 should be interpreted to include not only the explicitly stated limits of 1 to 4.5, but also individual numbers (such as 2, 3, 4) and subranges (such as 1 to 3, 2 to 4, etc.). The same principle applies to ranges that describe only a single value, such as "less than about 4.5," which should be interpreted to include all the values and ranges described above. Furthermore, this interpretation should apply regardless of the breadth of the range or characteristic described.
[0039] Example 1
[0040] This embodiment provides a method for isolating and enriching RT8 strains.
[0041] 1.1 Preparation of culture medium
[0042] Inorganic salt culture medium: K2HPO4 1.5g / L, KH2PO4 0.5g / L, (NH4)2SO4 0.5g / L, MgSO4 0.2g / L, CaCl2 0.03g / L, pH natural (no additional adjustment).
[0043] The agar plate formulation with trichlorophenol as the sole carbon source is as follows: 2,4,6-TCP 20 mg / L, K2HPO4 2 g / L, (NH4)2SO4 2 g / L, NaCl 0.1 g / L, MgSO4 0.4 g / L, CaCl2 0.1 g / L, and agar powder 15 g / L.
[0044] The LB liquid medium formula is as follows: 10 g / L tryptone, 5 g / L yeast extract, 5 g / L sodium chloride, pH=7.0±0.2.
[0045] The formula for LB solid medium is as follows: 10 g / L tryptone, 5 g / L yeast extract, 5 g / L sodium chloride, 15 g / L agar, pH=7.0±0.2.
[0046] All four culture media were prepared using deionized water. The pH of the latter two was adjusted with 1M NaOH or HCl solution. After preparation, the media were autoclaved at 121°C for 20 minutes and stored at 4°C.
[0047] 1.2 Enrichment Culture
[0048] The additional carbon sources were selected from four representative substances commonly found in wastewater: glucose (easily available carbon source), sodium acetate (small molecule substance), sodium chloroacetate (chlorinated small molecule organic acid acid), and phenol (coexisting pollutant). The recalcitrant pollutant was trichlorophenol (2,4,6-TCP), and five acclimation systems were designed (groups T, G, N, C, and P, respectively. Specifically, T: 2,4,6-TCP, G: 2,4,6-TCP + glucose, N: 2,4,6-TCP + sodium acetate, C: 2,4,6-TCP + sodium chloroacetate, and P: 2,4,6-TCP + phenol).
[0049] The acclimation system consisted of 200 ml flasks: activated sludge (from a wastewater treatment plant's return tank) washed three times with sterile phosphate-buffered saline (PBS, pH 7.4) was placed in five 250 ml Erlenmeyer flasks. Inorganic salt medium was used as the background, maintaining an initial sludge concentration of 500 mg / L. The concentration of 2,4,6-TCP in each group was 20 mg / L, and the additional carbon source (no carbon source added to group T; the other four groups added the corresponding carbon source) concentration was 100 mg / L. The acclimation was carried out for two months in a shaker at 30°C and 150 rpm, with weekly subculturing at a 50% ratio (i.e., 100 mL of old solution + 100 mL of new inorganic salt medium).
[0050] 1.3 Single-strain isolation
[0051] After two months of enrichment and acclimatization, standard serial dilutions were used to prepare 10⁻¹⁰ samples with sterile water. -1 -10 -7 Seven concentration gradient dilutions were prepared. 100 μl of each dilution was spread onto agar plates using trichlorophenol as the sole carbon source and incubated at 30°C for 24 hours. After the plates showed clear colonies, single colonies were streaked onto LB agar and incubated at 30°C for 24 hours for purification. The purified single colonies were then inoculated into 1 mL of LB liquid medium and incubated at 30°C and 150 rpm for 24 hours. Finally, the bacterial culture was mixed with 50% glycerol at a 1:1 volume ratio and stored at -80°C. The single bacteria isolated using the above steps were named RT8.
[0052] Group T was acclimatized using a single TCP carbon source, and most of the isolated bacteria were degrading bacteria under a single carbon source; the degradation performance under mixed carbon sources is unknown. The other four groups involved coexistence and acclimatization with additional carbon sources, allowing for targeted screening of bacteria capable of efficiently degrading TCP even with multiple carbon sources. RT8 was screened out from all five systems.
[0053] Example 2
[0054] This embodiment provides identification and preservation of RT8 strains.
[0055] The morphological characteristics of strain RT8 are as follows: Gram-negative bacteria (experimental method according to GB 4789.28-2023), colony size 0.1-0.2cm × 0.1-0.2cm, colonies are perfectly round, milky white, smooth, and semi-transparent with raised surfaces. A plate image of RT8 is shown below. Figure 1 .
[0056] The RT8 strain was propagated using LB liquid medium and cultured at 30°C and 150 rpm for 12 h in a shaker. DNA was extracted from the RT8 strain using the MPBiomedicals Fast DNA™ Spin Kit for Soil (purchased from Nanjing Wobo Biotechnology Co., Ltd., catalog number: 116560200). For detailed extraction procedures, please refer to the kit instructions.
[0057] The 16S region of RT8 was amplified using primers 27F and 1492R. The sequence of primer 27F is shown in SEQ ID NO.1; the sequence of primer 1492F is shown in SEQ ID NO.2.
[0058] SEQ ID NO.1: AGAGTTTGATCCTGGCTCAG;
[0059] SEQ ID NO. 2: GGTTACCTTGTTACGACTT.
[0060] The amplification process is as follows: Prepare the reaction system, total volume 20 μL, including 0.5 μL 27F, 0.5 μL 1492F, 1 μL DNA, 8 μL ddH2O, and 10 μL 2× Taq Master Mix. PCR amplification conditions: 94℃ pre-deformation for 4 min, 94℃ pre-deformation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 90 s, 35 cycles, 72℃ extension for 10 min, and incubation at 4℃.
[0061] The amplified sequence was sent to Sangon Biotech (Shanghai) Co., Ltd. for 16S rRNA sequencing. The RT8 gene sequence of the strain is shown in SEQ ID NO.3.
[0062] SEQ ID NO.3:
[0063]
[0064] The 16S rRNA gene sequences were compared with those in the NCBI database, and the strain with the highest similarity was found to be... Cupriavidus necator strain FDAARGOS 1030, with a similarity of 57%, confirms that this bacterium belongs to the genus *Cyclophorus*. The phylogenetic tree results are shown below. Figure 2 This bacterial species is classified and named... Cupriavidus sp. RT8.
[0065] The strain was deposited at the China Center for Type Culture Collection on December 19, 2025, with accession number CCTCCNO: M20252969.
[0066] Example 3
[0067] This embodiment tests the ability of Bacillus thuringiensis RT8 to degrade chlorophenol.
[0068] A single colony of *Bacillus thuringiensis* RT8 (the single colony obtained after purification in 1.3 of Example 1) was inoculated into LB liquid medium (formulation same as in Example 1) and cultured in a shaker at 30°C and 150 rpm for 24 h to obtain the seed culture of strain RT8. The bacterial cells were collected by centrifugation at 7000g for 3 min, resuspended in sterile phosphate buffer (PBS, pH 7.4) and washed 3 times to remove residual culture medium components, and *Bacillus thuringiensis* RT8 bacterial cells were obtained and stored for later use.
[0069] The bacterial cells were resuspended in a sterile inorganic salt solution (formulation same as the inorganic salt culture medium in Example 1), and the OD was adjusted. 600 To a concentration of 1.0, 5% (v / v) of the inoculum was added to the degradation system, which consisted of 200 ml of the inorganic salt culture medium from Example 1. Monochlorophenol, dichlorophenol, and trichlorophenol were added as contaminants, each at a concentration of 20 mg / L. A blank control system without functional bacteria was used. The experiment was repeated three times, with residual chlorophenol concentration measured in liquid chromatography at each test. Results are shown below. Figure 3 .
[0070] Figure 3 The degradation effect of RT8 on different chlorophenols was demonstrated, showing that RT8 exhibits excellent degradation ability for chlorophenols, completely degrading monochlorophenol and dichlorophenol within 48 hours and completely degrading trichlorophenol within 6 hours. Compared with existing degrading bacteria, such as the 2,4,6-TCP degrading bacterium Nocardioides sp. K44 (… Männistö MK, Tiirola MA, Salkinoja-Salonen MS, et al. Diversity of chlorophenol-degrading bacteria isolated from contaminated boreal groundwater [J]. Archives of Microbiology, 1999, 171(3): 189-197 It takes 12 hours to completely degrade 20 mg / L of 2,4,6-TCP. The ability of Bacillus thuringiensis RT8 in this invention to degrade chlorophenol is much greater than that.
[0071] Example 4
[0072] This embodiment examines the metabolic preference of Bacillus thuringiensis RT8 for 2,4,6-TCP in the presence of an additional carbon source.
[0073] A single colony of *Bacillus thuringiensis* RT8 (the single colony obtained after purification in 1.3 of Example 1) was inoculated into LB liquid medium (formula same as in Example 1) and cultured at 30°C and 150 rpm for 24 h to obtain the seed culture of strain RT8. The bacterial cells were collected by centrifugation at 7000g for 3 min, resuspended in sterile phosphate-buffered saline (PBS, pH 7.4) and washed three times to remove residual culture medium components. Finally, the cells were resuspended in sterile inorganic salt solution (formula same as the inorganic salt medium in Example 1) and the OD was adjusted. 600 To a concentration of 1.0, 5% (v / v) of the inoculum was added to an Erlenmeyer flask containing 200 ml of the inorganic salt medium from Example 1. Trichlorophenol and an additional carbon source were added separately, and a total of 6 groups of degradation experiments were conducted using trichlorophenol + additional carbon source, as shown in the table below:
[0074]
[0075] The concentrations of 2,4,6-TCP and additional carbon sources were detected during the degradation process, and the results are as follows: Figure 4 Adding any type or concentration of additional carbon source will not affect the degradation of 2,4,6-TCP.
[0076] In the initial stages of degradation, 2,4,6-TCP significantly inhibited glucose degradation. Only when the degradation rate of 2,4,6-TCP reached over 50% did glucose show relatively significant degradation. In the early stages of degradation, 2,4,6-TCP more significantly inhibited the degradation of sodium acetate. Specifically, in the low-concentration sodium acetate group, the sodium acetate concentration only began to decrease significantly after 2,4,6-TCP degradation reached 50%; in the high-concentration sodium acetate group, the sodium acetate concentration only began to decrease significantly when 2,4,6-TCP degradation reached 80%. Phenol had virtually no effect on the degradation of 2,4,6-TCP by RT8.
Claims
1. A strain of copper-loving fungus ( Cupriavidus sp. RT8 was deposited on December 19, 2025 at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO:M20252969, located at Wuhan University, Wuhan, China.
2. The copper-loving bacteria according to claim 1 ( Cupriavidus sp. RT8, characterized in that, The copper-loving bacteria ( Cupriavidus sp. The 16S rRNA gene sequence of RT8 is shown in SEQ ID NO.
3.
3. A biological agent, characterized in that, The microbial agent contains the copper-loving bacteria as described in claim 1 (… Cupriavidus sp. RT8.
4. The copper-loving bacteria as described in claim 1 or 2 ( Cupriavidus sp. Application of RT8 in the degradation of monochlorophenol, dichlorophenol and trichlorophenol pollutants.
Citation Information
Patent Citations
Pseudomonas aeruginosa strain separating, purifying and domesticating method and use
CN101857847A
Efficient 2, 4, 6-trichlorophenol degrading bacterial strain and separation method thereof
CN104388365A