Serratia marcescens for producing levorotatory-alpha-bisabolol and use thereof
By constructing the MVA pathway and expressing key enzymes in Serratia marcescens, the problems of low yield and high biotoxicity of levo-α-bisabolol in existing technologies were solved, achieving high-efficiency production with a yield of 73.4 g/L.
Patent Information
- Application Number
- CN202411627212.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-14
- Publication Date
- 2026-05-26
Smart Images

Figure CN122081184A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a strain of Serratia marcescens that produces levonorgestrel and its applications, belonging to the field of bioengineering technology. Background Technology
[0002] L-α-bisabolol, also known as (-)-α-bisabolol, is a monocyclic sesquiterpene alcohol with the molecular formula C2. 15 H 26 O, found in natural essential oils. (-)-α-bisabolol has analgesic and skin-soothing effects and is widely used in the cosmetics industry as a safe ingredient. Furthermore, (-)-α-bisabolol can specifically increase the permeability of bacterial cell membranes to antibiotics, a property that gives it great potential in the pharmaceutical industry as well.
[0003] Artichokes and chamomile are rich in (-)-α-bisabolol, so distillation of the extracted plant essential oils can yield (-)-α-bisabolol. However, this method has some drawbacks, such as the long growth cycle of the plants, low distillation extraction rate, and adverse environmental impact. Bisabolol has two chiral centers and four stereostructures, making its chemical synthesis difficult and resulting in low production specificity. Given the shortcomings of distillation and chemical synthesis, synthetic biology has shown significant advantages in constructing engineered strains for the production of (-)-α-bisabolol. Through genetic engineering and metabolic engineering, it has achieved increased yield, reduced costs, shorter production cycles, reduced environmental impact, enhanced process controllability, customized production, and improved sustainability, providing a new, efficient, economical, and environmentally friendly approach for the industrial production of (-)-α-bisabolol.
[0004] Microorganisms possess natural terpene synthesis pathways. Most eubacteria utilize the 2-C-methyl-D-erythritol-4-phosphate pathway (MEP pathway), while fungi such as yeast produce the C5 precursors isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP) via the mevalonate pathway (MVA pathway). Two molecules of isopentenyl pyrophosphate (IPP) and one molecule of dimethylallyl pyrophosphate (DMAPP) condense to form farnesyl pyrophosphate (FPP, C5). 15 The intermediate is a precursor of (-)-α-bisabolol, which is converted into the final product (-)-α-bisabolol by (-)-α-bisabolol synthase.
[0005] With the development of synthetic biology, *Saccharomyces cerevisiae* and *Escherichia coli*, as model strains, have become reliable hosts for terpene production. Kim et al. heterologously expressed MrBOS in *Saccharomyces cerevisiae* to enhance the endogenous MVA pathway, and then fed-batch fermented the DtEMA strain, ultimately producing 124 mg / L of (-)-α-bisabolol. Han et al. combined heterologous MVA pathway expression in *E. coli*, introducing exogenous FPPS and MrBOS genes, enabling engineered *E. coli* to produce 9.1 g / L of (-)-α-bisabolol in a 50 L fermenter via fed-batch fermentation. Lim et al. screened a novel (-)-α-bisabolol synthase from *Cynara cardunculus* var. *scolymus*, and by constructing a heterologous MVA pathway in *E. coli*, fed-batch fermentation of the strain resulted in a (-)-α-bisabolol yield of 23.4 g / L.
[0006] Currently, the modification of Escherichia coli strains for producing (-)-α-bisabolol has reached a bottleneck. At the same time, (-)-α-bisabolol is a terpenoid compound with certain biotoxicity, which can affect the growth and metabolic activity of microorganisms. The expression hosts used in the above-mentioned technologies, such as Escherichia coli and Saccharomyces cerevisiae, have poor tolerance, which further affects the fermentation yield of (-)-α-bisabolol.
[0007] Therefore, in order to further increase production, we can turn our attention to some non-model microorganisms, chassis strains that grow faster and have a longer steady state, to achieve efficient production of (-)-α-bisabolol. Summary of the Invention
[0008] To address the aforementioned problems, this invention provides a method for producing (-)-α-bisabolol using the halosaur MVA pathway in Serratia marcescens. The method achieves increased production and yield of (-)-α-bisabolol through pathway construction, enhanced soluble expression of (-)-α-bisabolol synthase, and knockout of endogenous phospholipase.
[0009] The first objective of this invention is to provide a genetically engineered *Serratia marcescens* strain that produces (-)-α-bisabolol, wherein the genetically engineered strain expresses exogenous acetyl-CoA thiolytic enzyme, 3-hydroxy-3-methylglutaryl-CoA synthase (HMG-CoA synthase), hydroxy-3-methylglutaryl-CoA reductase (HMG-CoA reductase), mevalonate kinase, mevalonate phosphate decarboxylase, isopentenyl phosphate kinase, isopentenyl pyrophosphate isomerase, farnesyl diphosphate synthase, and (-)-α-bisabolol synthase.
[0010] In one embodiment, illustrative examples of the nucleotide sequences of acetyl-CoA thiolytic enzyme (also known as acetyl-CoA acyltransferase) include, but are not limited to: NC_000913REGION:2326109..2327293 (Escherichia coli str.K-12substr.MG1655), GenBank: L20428 (Saccharomycescerevisiae), GenBank: AB120846 (Yarrowia lipolytica PAT1), GenBank: CP000673REGION:complement(3734524..3735705)(Clostridium kluyveri DSM 555) and GenBank: CP000926REGION:complement(2395644..2396828)(Pseudomonas putida GB-1).
[0011] In one embodiment, illustrative examples of HMG-CoA synthase nucleotide sequences include, but are not limited to: NC_001145 REGION:complement(19060..20535)(Saccharomyces cerevisiae S288C), GenBank: X96617(Saccharomyces cerevisiae HMGS), GenBank: KQ957425 REGION:17967..19133(Staphylococcus aureus strain PSS7673), GenBank: KQ971255 REGION:36726..37925(Streptococcus salivarius strain GED7778A) and GenBank: CP107570 REGION:631050..632207(Limosilactobacillus reuteri strain QS01).
[0012] In one embodiment, illustrative examples of HMG-CoA reductases, whose nucleotide sequences include, but are not limited to: NM_001182434 (Saccharomyces cerevisiae S288C), KQ957425 REGION:complement(16436..17713) (Staphylococcus aureus strain PSS7673), and CP053337 REGION:complement(1368799..1370073) (Lactiplantibacillus paraplantarum strain CK401).
[0013] In one embodiment, illustrative examples of mevalonate kinase, whose nucleotide sequences include, but are not limited to: NM_001182715 (Saccharomyces cerevisiae S288C), GenBank: CP021501 REGION:complement(1519619..1520557)(Lactiplantibacillus plantarum strainSRCM102022), NZ_JAJGVW010000060 REGION:10049..10999 (Limosilactobacillus reuteri strain Cor124_1_1scaffold60) and AP017922 REGION:598766..599686 (Staphylococcus aureus strain JP080).
[0014] In one embodiment, illustrative examples of the nucleotide sequences of mevalonate phosphate decarboxylase include, but are not limited to: NC_013967.1 REGION:complement(1285312..1286286)(Haloferax volcanii), NC_017941.2 REGION:complement(1400163..1401137)(Haloferax mediterranei), and NC_023013.1 REGION:complement(2004713..2005687)(Haloarcula hispanica N601).
[0015] In one embodiment, illustrative examples of isopentenyl phosphokinases, whose nucleotide sequences include, but are not limited to: NC_000909.1REGION:complement(45117-45899)(Methanocaldococcus jannaschiiDSM 2661), NC_002607.1REGION:complement(868199..868936)(Halobacteriumsalinarum NRC-1), and NC_003901.1REGION:complement(2102912..2103694)(Methanosarcina mazei Go1).
[0016] In one embodiment, illustrative examples of isopentenyl pyrophosphate isomerases, whose nucleotide sequences include, but are not limited to: NC_000913REGION:3033065..3033613 (Escherichia coli str.K-12substr.MG1655), NC_001148REGION:complement(327864..328730)(Saccharomycescerevisiae S288C), JGZB01000001REGION:183234..184370 (Bifidobacterium magnumstrain LMG 11591Contig01), AB047343 (Bacillus subtilis) and AB047344 (Staphylococcus aureus).
[0017] In one embodiment, illustrative examples of suitable nucleotide sequences for farnesyl pyrophosphate synthase include, but are not limited to: D00694 (Escherichia coli), YSCFPP (Saccharomyces cerevisiae), L46349 (Arabidopsis thaliana), JF273657 (Lilium longiflorum), D85317 (Oryza sativa), AF330036 (Zea mays), DQ087959 (Panax ginseng), AF048747 (Lycopersicon esculentum), and AF384040 (Mentha × piperita).
[0018] In one embodiment, illustrative examples of suitable nucleotide sequences for (-)-α-bisabolol synthase include, but are not limited to: (+)-α-bisabolol synthase LC106016 (Artemisia kurramensis)), (+)-α-bisabolol synthase LC106015 (Artemisia maritima)), (-)-α-bisabolol synthase KJ020282 (Matricaria recutita) and (-)-α-bisabolol synthase NC_037542 REGION:15218505..15222154 (Cynara cardunculus).
[0019] In one embodiment, the amino acid sequence encoding the acetyl-CoA thiolytic enzyme is shown in SEQ ID NO. 6;
[0020] The amino acid sequence of the HMG-CoA synthase is shown in SEQ ID NO.7;
[0021] The amino acid sequence of the HMG-CoA reductase is shown in SEQ ID NO. 8;
[0022] The amino acid sequence of the mevalonate kinase is shown in SEQ ID NO.9;
[0023] The amino acid sequence of the mevalonate phosphate decarboxylase is shown in SEQ ID NO.10;
[0024] The amino acid sequence of the isopentenyl phosphokinase is shown in SEQ ID NO.11;
[0025] The amino acid sequence of the isopentenyl pyrophosphate isomerase is shown in SEQ ID NO.12;
[0026] The amino acid sequence of the farnesyl diphosphate synthase is shown in SEQ ID NO.13 (ispA) or SEQ ID NO.14 (ERG20);
[0027] The amino acid sequence of the (-)-α-bisabolol synthase is shown in SEQ ID NO.15 (CcBOS) or SEQ ID NO.16 (MrBOS);
[0028] The overexpressed chaperone proteins IbpA and IbpB have the amino acid sequences shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.
[0029] The overexpressed chaperone proteins DnaK and DnaJ have amino acid sequences as shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.
[0030] The overexpressed chaperone protein trigger factor has the amino acid sequence shown in SEQ ID NO.5.
[0031] In one embodiment, the nucleotide sequence encoding the acetoacetyl-CoA thiolytic enzyme is shown in SEQ ID NO.17;
[0032] The nucleotide sequence encoding the HMG-CoA synthase is shown in SEQ ID NO.18;
[0033] The nucleotide sequence encoding the HMG-CoA reductase is shown in SEQ ID NO.19;
[0034] The nucleotide sequence encoding the mevalonate kinase is shown in SEQ ID NO.20;
[0035] The nucleotide sequence encoding the mevalonate phosphate decarboxylase is shown in SEQ ID NO.21;
[0036] The nucleotide sequence encoding the isopentenyl phosphokinase is shown in SEQ ID NO.22;
[0037] The nucleotide sequence of the isopentenyl pyrophosphate isomerase is shown in SEQ ID NO.23;
[0038] The nucleotide sequences encoding the farnesyl pyrophosphate synthase are shown in SEQ ID NO.24 (nucleotide sequence of ispA) and SEQ ID NO.25 (nucleotide sequence of ERG20);
[0039] The nucleotide sequences encoding the (-)-α-bisabolol synthase are shown in SEQ ID NO.26 (nucleotide sequence of CcBOS) and SEQ ID NO.27 (nucleotide sequence of MrBOS);
[0040] The overexpressed chaperone proteins IbpA and IbpB have nucleotide sequences as shown in SEQ ID NO.28 and SEQ ID NO.29, respectively.
[0041] The overexpressed chaperone proteins DnaK and DnaJ have nucleotide sequences as shown in SEQ ID NO.30 and SEQ ID NO.31, respectively.
[0042] The overexpressed chaperone protein, Trigger factor, has the nucleotide sequence shown in SEQ ID NO.32.
[0043] In one embodiment, the Serratia marcescens genetically engineered bacteria overexpresses any one of the following chaperone proteins: DnaK, DnaJ, IbpA, IbpB, or trigger factor.
[0044] The amino acid sequence of DnaK is shown in SEQ ID NO.3, and the amino acid sequence of DnaJ is shown in SEQ ID NO.4.
[0045] The amino acid sequence of IbpA is shown in SEQ ID NO.1, and the amino acid sequence of IbpB is shown in SEQ ID NO.2;
[0046] The amino acid sequence of the Trigger Factor is shown in SEQ ID NO.5.
[0047] In one embodiment, the Serratia marcescens genetically engineered strain has one or more of the following knockouts: YigL, spoT, phosphate histidine phosphatase SixA, and alkaline phosphatase phoA.
[0048] Optionally, the Serratia marcescens genetically engineered strain may have one or both of phosphate histidine phosphatase SixA and alkaline phosphatase phoA knocked out.
[0049] In one embodiment, the Serratia marcescens genetically engineered strain expresses the exogenous genes atoB (encoding acetoacetyl-CoA thiolytic enzyme), LamvaE (encoding HMG-CoA synthase from Lactobacillus casei), and LamvaS (encoding HMG-CoA reductase from Lactobacillus casei).
[0050] In one embodiment, the Serratia marcescens genetically engineered strain expresses exogenous genes atoB, LamvaE, LamvaS, McMK (encoding mevalonate kinase), HvPMD (encoding mevalonate phosphate decarboxylase), and MjIPK (encoding isopentenyl phosphate kinase).
[0051] In one embodiment, the Serratia marcescens genetically engineered strain expresses the exogenous genes atoB, LamvaE, LamvaS, McMk, HvPmd, MjIpk, Hpidi (encoding isopentenyl pyrophosphate isomerase from Haematococcus pluvialis), ispA (encoding farnesyl pyrophosphate synthase from Escherichia coli), and MrBOS (encoding (-)-α-bisabolol synthase from chamomile).
[0052] In one embodiment, the Serratia marcescens genetically engineered strain expresses exogenous genes atoB, LamvaE, LamvaS, McMk, HvPmd, MjIPK, Hpidi, ERG20 (encoding yeast-derived farnesyl pyrophosphate synthase), and MrBOS.
[0053] In one embodiment, the Serratia marcescens genetically engineered strain expresses the exogenous genes atoB, LamvaE, LamvaS, McMk, HvPmd, MjIpk, Hpidi, ispA, and CcBOS (encoding (-)-α-bisabolol synthase derived from Artichoke spicata).
[0054] In one embodiment, the Serratia marcescens genetically engineered bacteria express the exogenous genes atoB, LamvaE, LamvaS, McMk, HvPmd, MjIPK, Hpidi, ERG20, and CcBOS.
[0055] In one embodiment, the Serratia marcescens genetically engineered strain, in addition to expressing the exogenous genes atoB, LamvaE, LamvaS, McMk, HvPmd, MjIpk, Hpidi, ispA, and CcBOS, further overexpresses the chaperone proteins DnaK and DnaJ.
[0056] In one embodiment, the Serratia marcescens genetically engineered strain, in addition to expressing the exogenous genes atoB, LamvaE, LamvaS, McMk, HvPmd, MjIpk, Hpidi, ispA, and CcBOS, further overexpresses the chaperone proteins IbpA and IbpB.
[0057] In one embodiment, the Serratia marcescens genetically engineered strain, in addition to expressing the exogenous genes atoB, LamvaE, LamvaS, McMk, HvPmd, MjIpk, Hpidi, ispA, and CcBOS, further overexpresses the chaperone protein TriggerFactor.
[0058] In one embodiment, the Serratia marcescens genetically engineered strain, in addition to expressing exogenous genes atoB, LamvaE, LamvaS, McMk, HvPmd, MjIpk, Hpidi, ispA, and CcBOS, further overexpresses chaperone proteins DnaK and DnaJ; and also knocks out one or more of genes YigL, spoT, SixA, and phoA;
[0059] Preferably, the Serratia marcescens genetically engineered strain, in addition to expressing exogenous genes atoB, LamvaE, LamvaS, McMk, HvPmd, MjIpk, Hpidi, ispA, and CcBOS, further overexpresses chaperone proteins DnaK and DnaJ; and also knocks out gene phoA;
[0060] Preferably, the Serratia marcescens genetically engineered strain, in addition to expressing exogenous genes atoB, LamvaE, LamvaS, McMk, HvPmd, MjIpk, Hpidi, ispA, and CcBOS, further overexpresses chaperone proteins DnaK and DnaJ; and also knocks out genes phoA and SixA.
[0061] In one embodiment, the host of the genetically engineered *Serratia fonticola* strain is *Serratia fonticola* ATCC 29845, *Serratia odorifera* ATCC 33077; *Serratia plymuthica* ATCC 15928, *Serratia liquefaciens* ATCC 27592, *Serratia rubidaea* ATCC 19279, *Serratia oryzae* ATCC 1011, *Serratia ureilytica* ATCC BAA-2620, *Serratia entomophila* ATCC 43705, *Serratia ficaria* ATCC 33105, *Serratia marcescens* ATCC 13880, *Serratia proteamaculans* ATCC 19323, *Serratia symbiotica* DSM 23270, or *Serratianematodiphila* DSM. Any one of the following: 21420, Serratia quinivorans DSM 4597, Serratia grimesi DSM30063, or Serratia marcescens HBQA7.
[0062] In one embodiment, Serratia marcescens HBQA7, taxonomically named Serratia marcescens HBQA7, was deposited on February 23, 2023, at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M 2023184, located at Wuhan University, Wuhan, China.
[0063] In one embodiment, the expression vectors used for the engineered Serratia marcescens strain include, but are not limited to, pBBR1MCS-2 and pBM1.
[0064] The second objective of this invention is to provide a method for producing (-)-α-bisabolol, wherein any of the above-mentioned Serratia marcescens genetically engineered bacteria is inoculated into a culture medium, an organic solvent is added, fermentation is performed, centrifugation is carried out, and the upper organic phase contains (-)-α-bisabolol.
[0065] In one embodiment, 10–20 g L of culture medium is added. -1 glucose or glycerol;
[0066] Optionally, the culture medium includes LB, M9, and TB media;
[0067] Preferably, the culture medium is TB medium.
[0068] In one embodiment, the fermentation conditions are 30–37°C, 180–600 rpm, and fermentation time of 72 hours or more.
[0069] In one embodiment, the amount of organic solvent added is 20-30% v / v of the fermentation broth;
[0070] Alternatively, the organic solvents include isopropyl myristate and pentane;
[0071] Preferably, the organic solvent is n-dodecane.
[0072] In one implementation, the pH during fermentation is 6–8.
[0073] In one embodiment, the composition of the culture medium is: 12 g·L -1 Peptone, 24 g·L -1 Yeast extract, 1 g·L -1 Defoamer, 2.2 g·L -1 K2HPO4, 9.4 g·L -1 KH2PO4, 30g·L -1 Glycerin, 1.5 g·L -1 MgSO4, 0.1% trace metal element mother liquor (27 g·L⁻¹) -1 FeCl3·6H2O, 2g·L -1 ZnCl2·4H2O, 2g·L -1 CoCl2·6H2O, 2g·L - 1 Na2MoO4·2H2O, 1g·L -1 CaCl2·2H2O, 1.3 g·L -1 CuCl2·6H2O and 0.5 g·L -1HBO3), 1% vitamin B1 solution (30g·L) -1 Vitamin B5, 50g / L -1 Citric acid, 30g·L -1 Vitamin B1) Kanamycin 50 mg / L -1 Spectinomycin 50 mg / L -1 The solvent is deionized water, and the pH is 7.0;
[0074] In one embodiment, feeding is also performed during fermentation, and the culture medium used for feeding includes K2HPO4 and KH2PO4. 4、 Glycerin, MgSO 4、 Trace metal elements, citric acid, and vitamins (vitamin B1 and vitamin B5).
[0075] A third object of the present invention is to provide the use of any of the above-described Serratia marcescens genetically engineered strains or any of the above-described methods in the preparation of (-)-α-bisabolol.
[0076] Beneficial effects of the present invention
[0077] This invention provides an engineered Serratia marcescens strain and method for producing (-)-α-bisabolol. The engineered Serratia marcescens strain constructed in this invention produces (-)-α-bisabolol using the halophilic archaea MVA pathway. Fermentation in 50 mL of culture medium for 48 h yields 2.90 g / L of (-)-α-bisabolol. -1 The above results show that after fermentation in a 30L fermenter (20L culture medium) for 180 hours, the yield of (-)-α-bisabolol reached 73.4 g·L⁻¹. -1 .
[0078] Preservation of biological materials
[0079] Serratia marcescens HBQA7, taxonomically named Serratia marcescens HBQA7, was deposited on February 23, 2023, at the China Center for Type Culture Collection (CCTCCNO: M 2023184), Wuhan University, Wuhan, China. Attached Figure Description
[0080] Figure 1 This is a diagram of the (-)-α-bisabolol synthesis metabolism in Serratia marcescens HBQA7 and a schematic diagram of some plasmids;
[0081] Figure 2 This study describes the accumulation of (-)-α-bisabolol and GC analysis of recombinant Serratia marcescens LMB2, LMB3, LMB4, and LMB5 in shake flasks after 48 hours of culture. Detailed Implementation
[0082] raw material
[0083] Fermentation medium: 10 g·L -1 Peptone, 5 g·L -1 Yeast extract, 10 g·L -1 Sodium chloride, 0.5 g·L -1 Magnesium sulfate, 20% (v / v) n-dodecane;
[0084] LB medium: 10 g·L -1 Peptone, 5 g / L -1 Yeast extract, 10 g·L -1 NaCl, 0.5 g·L -1 Magnesium sulfate and 20% (v / v) n-dodecane;
[0085] M9 medium: 6.78 g·L -1 Na2HPO4, 3g·L -1 KH2PO4, 0.5 g·L -1 NaCl, 1 g·L -1 NH4Cl, 0.0111 g·L -1 CaCl2, 0.1 g·L -1 Thiamine, 0.5 g·L -1 Magnesium sulfate and 20% (v / v) n-dodecane;
[0086] TB culture medium: 12 g·L -1 Tryptone, 24 g / L -1 Yeast extract, 9.4 g·L -1 K2HPO4, 2.2 g·L - 1 KH2PO4, 0.5 g·L -1 Magnesium sulfate and 20% (v / v) n-dodecane;
[0087] Fermentation medium for 30L fermenter: 12g·L -1 Peptone, 24 g·L -1 Yeast extract, 1 g·L -1 Defoamer, 2.2 g·L -1 K2HPO4, 9.4 g·L -1 KH2PO4, 30g·L -1 Glycerin, 1.5 g·L -1 MgSO4, 20% (v / v) n-dodecane, 0.1% trace metal element mother liquor (27 g·L⁻¹) -1 FeCl3·6H2O, 2g·L -1 ZnCl2·4H2O, 2g·L-1 CoCl2·6H2O, 2g·L -1 Na2MoO4·2H2O, 1g·L -1 CaCl2·2H2O, 1.3 g·L -1 CuCl2·6H2O and 0.5 g·L -1 HBO3), 1% vitamin B1 solution (30g·L) -1 Vitamin B5, 50g / L -1 Citric acid, 30g·L -1 Vitamin B1) Kanamycin 50 mg / L -1 Spectinomycin 50 mg / L -1 The solvent is deionized water, and the pH is 7.0.
[0088] strain
[0089] Illustrative examples of Serratia include, but are not limited to: Serratia fonticola ATCC 29845; Serratia odorifera ATCC 33077; Serratia plymuthica ATCC 15928; Serratia liquefaciens ATCC 27592; Serratia rubidaea ATCC 19279; Serratia oryzae ATCC 1011; Serratia ureilytica ATCC BAA-2620; Serratia entomophila ATCC 43705; Serratia ficaria ATCC 33105; Serratia marcescens ATCC 13880; and Serratia proteamaculans ATCC 19323, all purchased from the ATCC Culture Bank in the United States.
[0090] Serratia symbiotica DSM 23270; Serratianematodiphila DSM 21420; Serratia quinivorans DSM 4597 and Serratia grimesi DSM30063 were purchased from the DSMZ strain bank in Germany.
[0091] Serratia marcescens HBQA7, deposited at the China Center for Type Culture Collection, accession number CCTCC NO: M 2023184.
[0092] Halophyta MVA pathway
[0093] A schematic diagram of the MVA pathway in halophilic archaea is shown below. Figure 1 As shown, this approach includes seven steps:
[0094] In the first step, two acetyl-CoA molecules condense under the catalysis of an enzyme to form acetoacetyl-CoA.
[0095] An enzyme known to catalyze this step, such as acetyl-CoA thiolase (also known as acetyl-CoA acyltransferase), is known to have illustrative examples of its nucleotide sequence, including but not limited to: NC_000913REGION:2326109..2327293 (Escherichia coli str.K-12substr.MG1655), GenBank: L20428 (Saccharomycescerevisiae), GenBank: AB120846 (Yarrowia lipolytica PAT1), GenBank: CP000673REGION:complement(3734524..3735705)(Clostridium kluyveri DSM 555) and GenBank: CP000926REGION:complement(2395644..2396828)(Pseudomonas putida GB-1).
[0096] In the second step, the acetyl-CoA molecule condenses with another acetyl-CoA molecule under the catalysis of the enzyme to generate 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA).
[0097] An enzyme known to catalyze this step, such as HMG-CoA synthase, is known. Illustrative examples of its nucleotide sequence include, but are not limited to: NC_001145 REGION:complement(19060..20535)(Saccharomyces cerevisiae S288C), GenBank: X96617(Saccharomyces cerevisiae HMGS), GenBank: KQ957425 REGION:17967..19133(Staphylococcus aureus strain PSS7673), GenBank: KQ971255 REGION:36726..37925(Streptococcus salivarius strain GED7778A) and GenBank: CP107570 REGION:631050..632207(Limosilactobacillus reuteri strain QS01).
[0098] In the third step, HMG-CoA is converted into mevalonic acid under the catalysis of enzymes.
[0099] An enzyme known to catalyze this step, such as HMG-CoA reductase, is known. Illustrative examples of its nucleotide sequence include, but are not limited to: NM_001182434 (Saccharomyces cerevisiae S288C), KQ957425 REGION:complement(16436..17713)(Staphylococcus aureus strain PSS7673), and CP053337 REGION:complement(1368799..1370073)(Lactiplantibacillus paraplantarumstrain CK401).
[0100] In the fourth step, mevalonic acid is converted into mevalonic acid 5-phosphate under the catalysis of enzymes.
[0101] An enzyme known to catalyze this step, such as mevalonate kinase, is known. Illustrative examples of its nucleotide sequence include, but are not limited to: NM_001182715 (Saccharomyces cerevisiae S288C), GenBank: CP021501 REGION:complement(1519619..1520557)(Lactiplantibacillus plantarum strainSRCM102022), NZ_JAJGVW010000060 REGION:10049..10999 (Limosilactobacillus reuteri strain Cor124_1_1scaffold60) and AP017922 REGION:598766..599686 (Staphylococcus aureus strain JP080).
[0102] In the fifth step, mevalonic acid 5-phosphate is converted into IP under the catalysis of enzymes.
[0103] An enzyme known to catalyze this step, such as mevalonate phosphate decarboxylase, is known. Illustrative examples of its nucleotide sequence include, but are not limited to: NC_013967.1 REGION:complement(1285312..1286286)(Haloferaxvolcanii), NC_017941.2 REGION:complement(1400163..1401137)(Haloferaxmediterranei), and NC_023013.1 REGION:complement(2004713..2005687)(Haloarculahispanica N601).
[0104] In the sixth step, IP is converted into IPP under the catalysis of enzymes.
[0105] An enzyme known to catalyze this step, such as isopentenyl phosphokinase, is illustrative examples of its nucleotide sequence including, but not limited to: NC_000909.1REGION:complement(45117-45899)(Methanocaldococcusjannaschii DSM 2661), NC_002607.1REGION:complement(868199..868936)(Halobacterium salinarum NRC-1), and NC_003901.1REGION:complement(2102912..2103694)(Methanosarcina mazei Go1).
[0106] In the seventh step, IPP is converted into DMAPP under the catalysis of enzymes.
[0107] An enzyme known to catalyze this step, such as isopentenyl pyrophosphate isomerase, is illustrative examples of whose nucleotide sequences include, but are not limited to: NC_000913REGION:3033065..3033613 (Escherichia coli str.K-12substr.MG1655), NC_001148REGION:complement(327864..328730)(Saccharomycescerevisiae S288C), JGZB01000001 REGION:183234..184370 (Bifidobacterium magnumstrain LMG 11591Contig01), AB047343 (Bacillus subtilis) and AB047344 (Staphylococcus aureus).
[0108] (-)-α-bisabolol synthesis pathway
[0109] The present invention (-)-α-bisabolol (C 15 The compound is derived from IPP and DMPAA, and is derived from three isoprene units.
[0110] Illustrative examples of suitable nucleotide sequences for farnesyl pyrophosphate synthases include, but are not limited to: D00694 (Escherichia coli), YSCFPP (Saccharomyces cerevisiae), L46349 (Arabidopsis thaliana), JF273657 (Lilium longiflorum), D85317 (Oryza sativa), AF330036 (Zea mays), DQ087959 (Panax ginseng), AF048747 (Lycopersicon esculentum), and AF384040 (Mentha × piperita).
[0111] (-)-α-bisabolol, its structure is:
[0112]
[0113] (-)-α-bisabolol is produced by FPP via (-)-α-bisabolol synthase. Illustrative examples of suitable nucleotide sequences for (-)-α-bisabolol synthase include, but are not limited to: (+)-α-bisabolol synthase LC106016 (Artemisia kurramensis)), (+)-α-bisabolol synthase LC106015 (Artemisia maritima)), (-)-α-bisabolol synthase KJ020282 (Matricaria recutita) and (-)-α-bisabolol synthase NC_037542 REGION:15218505..15222154 (Cynara cardunculus).
[0114] Constructing terpene production pathways
[0115] This invention enables high-level production of (-)-α-bisabolol in host cells using the MVA pathway of halophilic archaea.
[0116] The nucleotide sequence can be expressed by one or two vectors. For example, an expression vector can contain at least two, three, four, five, six, or all sequences encoding enzymes of the halophilic MVA pathway. The number of vectors depends on the size of the heterologous sequence and the capacity of the vector, primarily on the yield of terpenoids when expressed in the selected host cell.
[0117] The nucleic acid sequence can be codon-optimized according to the selected host to achieve high expression in the host. For example, in some embodiments, the acetyl-CoA thiodiolase gene atoB derived from Escherichia coli is codon-optimized to target the codon preference of Serratia marcescens.
[0118] Nucleic acids can be prepared using a variety of conventional techniques and methods, including but not limited to direct extraction from cells and synthesis.
[0119] The transcription level of nucleic acids in host microorganisms can be improved by a variety of methods, including but not limited to: (1) increasing the promoter strength of the nucleotide sequence that encodes the enzyme; (2) dividing the operon into individual genes controlled by individual promoters; and (3) increasing the transcription level by increasing the copy number of the nucleotide sequence that encodes the enzyme (e.g., introducing additional copies of the nucleotide sequence that encodes the enzyme into the genome of the host microorganism or expressing the nucleotide sequence that encodes the enzyme using a plasmid with a high copy number in the host microorganism).
[0120] The translation level of nucleic acids in host microorganisms can be improved by a variety of methods, including but not limited to: (1) modifying the ribosome binding site sequence; (2) optimizing the sequence before the ribosome binding site and the start codon; and (3) improving the stability of mRNA.
[0121] The activity of MVA pathway enzymes in the host can be altered by a variety of methods, including but not limited to: (1) expressing enzymes with high kJ / k ... cat Or lower K m (1) Express enzymes that are not subject to positive / negative feedback regulation; (2) Change enzyme activity through site-directed or random mutations.
[0122] In embodiments of the present invention, the expression vectors used include, but are not limited to, pBBR1MCS-2, pBbA5c-RFP, and pUCP18.
[0123] In embodiments of the present invention, the promoter used in the expression vector is a constitutive promoter. One or more nucleic acid sequences are effectively linked to the constitutive promoter.
[0124] In embodiments of the present invention, suitable constitutive promoters for host cells include, but are not limited to, Serratia marcescens endogenous promoters and Anderson promoters (BBa_J23100, BBa_J23112, and BBa_J23119, etc.).
[0125] The expression vector contains one or more selective marker genes for screening and identifying host cells carrying the expression vector. Examples of suitable selective markers for Serratia marcescens include, but are not limited to, resistance to ampicillin, kanamycin, chloramphenicol, streptomycin, and spectinomycin.
[0126] The expression vector can be introduced into host cells using various techniques. One such technique is electroporation. Electroporation uses electrical pulses to create temporary pores in the cell membrane, allowing substances such as nucleic acids to pass through and enter the cell.
[0127] After transformation, several methods can be used to confirm that the plasmid has been introduced into the host cell. One method is to screen the transformed host cells using an antibiotic resistance-selective marker gene, and then verify the result by PCR using specific primers on a single colony.
[0128] The enzyme activity in the pathway can be determined by a variety of methods known in the art. Typically, enzyme activity can be determined based on the amount of substrate consumed or the amount of product generated. The reaction can be performed in vivo or in vitro. For example, the activity of HMG-CoA reductase can be determined in vitro by the amount of NADH consumed. HMG-CoA reductase uses HMG-CoA and NADH as substrates to generate mevalonic acid. NADH has an absorption peak at 340 nm; the activity of HMG-CoA reductase is detected by measuring the decrease in NADH absorbance at 340 nm.
[0129] Table 1. Construction of plasmids
[0130]
[0131] Note: LamvaE refers to the mvaE gene from Lacticaseibacillus casei, where La is the abbreviation for strain Lacticaseibacillus casei; Mc is the abbreviation for Methanothrix soehngenii; Hv is the abbreviation for Haloferax volcanii; Mj is the abbreviation for Methanocaldococcus jannaschii; Hp is the abbreviation for Haematococcus lacustris; Mr is the abbreviation for Matricaria chamomilla; and Cc is the abbreviation for Cynaracardunculus.
[0132] Example 1: Construction of plasmids
[0133] 1. Constructing a plasmid expressing an enzyme from the MVA pathway in halophilic archaea.
[0134] The expression plasmid encodes enzymes in the MVA pathway of halophilic archaea. The enzyme genes in the MVA pathway of halophilic archaea are derived from Escherichia coli, Lactobacillus casei, Methanobacterium synoviae, Halophilic halophilic bacteria, Methanococcus japonicus, Haematococcus pluvialis, Saccharomyces cerevisiae, Artichoke, and Chamomile.
[0135] (1) Construction of expression plasmid pBBR-M
[0136] The expression plasmid pBBR-M was generated by inserting the AES operon into the pBBR1MCS-2 vector.
[0137] The AES operon contains the atoB gene (Gene ID: 946727, encoding acetyl-CoA thiolytic enzyme) from Escherichia coli str. K-12substr. MG1655, the LamvaS gene (Gene ID: 45548925, encoding HMG-CoA synthase) from Lactobacillus casei DSM 20011, and the LamvaE gene (Gene ID: 45548926, encoding HMG-CoA reductase) from Lactobacillus casei DSM 20011.
[0138] The genes were directly synthesized into the KpnI and XhoI restriction sites of the pBBR1MCS-2 vector in the order of atoB, LamvaE, and LamvaS, and the Serratia marcescens endogenous promoter P was introduced before atoB. 12 (nucleotide sequence: TATTAACTCAGTTGGCAGAGTGATTGGTTTTATAATGGCTTGTTTTGGCTTGAAAATTGATAGACGCGGGTTCGAGTCCTGCATAGCGCGCCAGCTTTCTTTCCCTTCACCTCACCGCGTTTACCGTAAAGCGCACCCGGGTTGATTTGCACTATCGGCTCCTCGTTGGGATTTTCGGGTGTGCTTTACCGTAACCGCTGGCTTTCCTTCCTCTTTCTCTTTCGATCCTTTGCTAAACTGTAATCAGGCAGGCTTGCTGCCCGGCAACAGGAGGTCGAT; SEQ ID NO.33) Ribosome binding site BBa_B0034 (AAAGAGGAGAAA; SEQ ID NO.34), terminator rrnB T1 terminator (nucleotide sequence is...)
[0139] The expression plasmid pBBR-M was obtained by (SEQ ID NO.35).
[0140] (2) Construction of expression plasmid pBBR-M1
[0141] The expression plasmid pBBR-M1 was generated by inserting the MPI operon into the pBBR-M vector prepared above.
[0142] The MPI operon contains the McMk gene (Gene ID: 10461936, encoding mevalonate kinase) from *Methanothrix soehngenii* GP6, the HvPmd gene (Gene ID: 8926402, encoding mevalonate phosphate decarboxylase) from *Haloferax volcanii* DS2, and the MjIpk gene (Gene ID: 8926402, encoding mevalonate phosphate decarboxylase) from *Methanocaldococcus jannaschii* DSM 2661. ID:1450882, encoding isopentenyl phosphokinase, these three genes were synthesized and inserted before the AES operator of the pBBR-M vector in the order McMk, HvPmd, MjIpk, and introduced before McMk, HvPmd, MjIpk. The Serratia marcescens endogenous promoter P6 (nucleotide sequence: TGTTTTTATCTTGTTTGTTAATGGTTTTTTATCCTGTGTTTTGGCTTTTTTATTTCCATGTTTAACTAGAATGAATCATGTGGCTGGTAAATGAAGGGGAGCGGTGCTTCTTAAGGTGAAGGGAGCATCAGCCAGAAAAACTTCTGGTTAACCCCGGCCGGCAACAGGGATCACTGATTCACCACAGGTTAACGGAGAGACT; SEQ ID NO.36) and the ribosome binding site BBa_B0034 (AAAGAGGAGAAA) were introduced before McMk, HvPmd, MjIpk, and the terminator rrnB T1 was introduced. The terminator was used to obtain the expression plasmid pBBR-M1.
[0143] 2. Construct plasmids expressing enzymes in the archaea MVA pathway and enzymes in the (-)-α-bisabolol synthesis pathway.
[0144] This embodiment describes a method for preparing expression plasmids that encode enzymes of the MVA pathway in haloarchaea and enzymes of the (-)-α-bisabolol synthesis pathway.
[0145] (1) Construction of plasmid pBBR-MiM
[0146] The expression plasmid pBBR-MiM is derived from the expression plasmid pBBR-M1 constructed in step 1.
[0147] The Hpidi gene (GenBank: AAC32209.1, encoding isopentenyl pyrophosphate isomerase) from Haematococcus lacustris, the ispA gene (Gene ID: 945064, encoding farnesyl pyrophosphate synthase) from Escherichia coli str. K-12substr. MG1655, and the MrBOS gene (GenBank: AIG92846.1, encoding (-)-α-bisabolol synthase) from Matricaria chamomilla var. recutita were inserted into plasmid pBBR-M1. The nucleotide sequences of Hpidi, ispA, and MrBOS are shown in SEQ ID NO. 23, SEQ ID NO. 24, and SEQ ID NO. 25, respectively. As shown in NO.27, these three genes, MrBOS, ispA, and Hpidi, were synthesized and inserted before the MPI operon of the expression plasmid pBBR-M1 in the order of MrBOS, ispA, and Hpidi. The Serratia marcescens endogenous promoter P5 (nucleotide sequence: GCTAGAAAAAACCGTAAATTGTTCTAATCTTTAATCAGCAAGACAACATCATTCCGACAG TGGCTAAGGAGTTCGAA; SEQ ID NO.37) and the ribosome binding site BBa_B0034 (AAAGAGGAGAAA) were introduced before MrBOS, and the terminator rrnB T1 was used to obtain the expression plasmid pBBR-MiM.
[0148] (2) Construction of plasmid pBBR-MEM
[0149] The expression plasmid pBBR-MEM was derived from the expression plasmid pBBR-M1 prepared in step 1.
[0150] The Hpidi gene (GenBank: AAC32209.1, encoding isopentenyl pyrophosphate isomerase) from Haematococcus pluvialis, the ERG20 gene (Gene ID: 853272, encoding farnesyl pyrophosphate synthase) from Saccharomyces cerevisiae S288C, and the MrBOS gene (GenBank: AIG92846.1, encoding (-)-α-bisabolol synthase) from Chamomile were inserted into plasmid pBBR-M1. The nucleotide sequences of Hpidi, ERG20, and MrBOS are shown in SEQ ID NO. 23, SEQ ID NO. 25, and SEQ ID NO. 26, respectively. As shown in NO.27, these three genes, MrBOS, ERG20, and Hpidi, were synthesized and inserted before the MPI operon of the expression plasmid pBBR-M1. The Serratia marcescens endogenous promoter P5 (nucleotide sequence: GCTAGAAAAAACCGTAAATTGTTCTAATCTTTAATCAGCAAGACAACATCATTCCGACAGTGGCTAAGGAGTTCGAA) and the ribosome binding site BBa_B0034 (AAAGAGGAGAAA) were introduced before MrBOS, and the terminator rrnB T1terminator was used to generate the expression plasmid pBBR-MEM.
[0151] (3) Construction of plasmid pBBR-MiC
[0152] The expression plasmid pBBR-MiC was derived from the expression plasmid pBBR-M1 prepared in step 1.
[0153] The Hpidi gene (GenBank: AAC32209.1, encoding isopentenyl pyrophosphate isomerase) from Haematococcus pluvialis, the ispA gene (Gene ID: 945064, encoding farnesyl pyrophosphate synthase) from Escherichia coli, and the CcBOS gene (Gene ID: 112527994, encoding (-)-α-bisabolol synthase) from Cynara cardunculus subsp. cardunculus were inserted into plasmid pBBR-M1. The nucleotide sequences of Hpidi, ispA, and CcBOS are shown in SEQ ID NO. 23, SEQ ID NO. 24, and SEQ ID NO. 25, respectively. As shown in NO.26, these three genes, CcBOS, ispA, and Hpidi, were synthesized and inserted before the MPI operon of the expression plasmid pBBR-M1. The Serratia marcescens endogenous promoter P5 (nucleotide sequence: GCTAGAAAAAACCGTAAATTGTTCTAATCTTTAATCAGCAAGACAACATCATTCCGACAG TGGCTAAGGAGTTCGAA) and the ribosome binding site BBa_B0034 (AAAGAGGAGAAA) were introduced before CcBOS, and the terminator rrnB T1terminator was used to generate the expression plasmid pBBR-MiC.
[0154] (4) Constructing plasmid pBBR-MEC
[0155] The expression plasmid pBBR-MEC is derived from the expression plasmid pBBR-M1 prepared in step 1.
[0156] The Hpidi gene (GenBank: AAC32209.1, encoding isopentenyl pyrophosphate isomerase) from Haematococcus pluvialis, the ERG20 gene (Gene ID: 853272, encoding farnesyl pyrophosphate synthase) from Saccharomyces cerevisiae, and the CcBOS gene (Gene ID: 112527994, encoding (-)-α-bisabolol synthase) from Artichoke spp. were inserted into plasmid pBBR-M1. The nucleotide sequences of Hpidi, ERG20, and CcBOS are shown in SEQ ID NO. 23, SEQ ID NO. 25, and SEQ ID NO. 26, respectively. These three genes were synthesized and inserted before the MPI operon of expression plasmid pBBR-M1 in the order of CcBOS, ERG20, and Hpidi. The Serratia marcescens endogenous promoter P5 (nucleotide sequence: GCTAGAAAAAACCGTAAATTGTTCTAATCTTTAATCAGCAAGACAACATCATTCCGACAG) was introduced before CcBOS. The expression plasmid pBBR-MEC is generated by combining the TGGCTAAGGAGTTCGAA and ribosome binding sites BBa_B0034 (AAAGAGGAGAAA) with the rrnB T1 terminator.
[0157] 3. Constructing a plasmid encoding a chaperone protein
[0158] (1) Construction of plasmid pMB1-I
[0159] The expression plasmid pMB1-I was generated by inserting the chaperone proteins IbpA / B into the pMB1 vector.
[0160] The nucleotide sequences of the chaperone proteins IbpA / B are shown in SEQ ID NO.28 and SEQ ID NO.29. These nucleotide sequences were copied from the genome of Serratia marcescens HBQA7 using PCR and inserted into the NdeI and SacI restriction enzyme sites of the pMB1 vector to produce the expression plasmid pMB1-I.
[0161] (2) Construction of plasmid pMB1-D
[0162] The expression plasmid pMB1-D was generated by inserting the chaperone protein DnaK / J into the pMB1 vector.
[0163] The nucleotide sequence of the chaperone protein DnaK / J is shown in SEQ ID NO.30 and SEQ ID NO.31. The nucleotide sequence was copied from the genome of Serratia marcescens HBQA7 by PCR and inserted into the NdeI and SacI restriction enzyme sites of the pMB1 vector to produce the expression plasmid pMB1-D.
[0164] 3. Construct plasmid pMB1-T
[0165] The expression plasmid pMB1-T was generated by inserting the chaperone protein trigger factor into the pMB1 vector.
[0166] The nucleotide sequence of the chaperone protein trigger factor is shown in SEQ ID NO.32. The nucleotide sequence was copied from the genome of Serratia marcescens HBQA7 by PCR and inserted into the NdeI and SacI restriction enzyme sites of the pMB1 vector to generate the expression plasmid pMB1-T.
[0167] The primers used in Example 1 are shown in Table 2.
[0168] Table 2 Primers for plasmid construction
[0169]
[0170]
[0171]
[0172] Example 2: Construction of genetically engineered bacteria
[0173] The expression plasmids pBBR-M, pBBR-MiM, pBBR-MEM, pBBR-MiC, pBBR-MEC, pBBR-MiC, pMB1-I, pMB1-D, and pMB1-T obtained in Example 1 were introduced into Serratia marcescensHBQA7 to construct the genetically engineered bacterial strain.
[0174] Taking plasmid pBBR-M as an example, plasmid pBBR-M was transformed into Serratia marcescens HBQA7. Successfully introduced Serratia marcescens strains were screened on LB agar plates containing antibiotics. A single colony was inoculated into 3 mL of liquid LB medium containing antibiotics and cultured overnight at 30°C and 200 rpm to construct a genetically engineered bacterium expressing plasmid pBBR-M, named LMB1. 500 μL of the bacterial culture was placed in a sterilized preservation tube containing 500 μL of 60% glycerol and stored at -80°C.
[0175] The genetically engineered bacteria LMB2, LMB3, LMB4, LMB5, LMB6, LMB7, and LMB8 were constructed using the same method. The strains and expression plasmids are shown in Table 3.
[0176] Table 3 Construction of strains
[0177]
[0178] Example 3: Detection of the yield of genetically engineered bacteria
[0179] The yield of (-)-α-bisabolol was measured using the genetically engineered bacteria LMB2, LMB3, LMB4, and LMB5 prepared in Example 2.
[0180] Genetically engineered bacteria LMB2, LMB3, LMB4, and LMB5 were streaked onto LB agar. Single colonies of each strain were picked and cultured in 3 mL of LB liquid medium for 12 h. Then, 1% (v / v) of the culture was inoculated into 50 mL of medium containing 20 g·L⁻¹ of LB broth. -1 The glycerol fermentation medium was cultured in a 250 mL shake flask at 30 °C and 200 rpm for 48 h.
[0181] The OD values were measured at 600 nm using a spectrophotometer. The OD values of the fermentation broths of strains LMB2, LMB3, LMB4, and LMB5 were 9.55, 10.4, 9.75, and 10.7, respectively. The upper organic phase of the fermentation broth was collected and centrifuged at 12000 rpm for 10 min to obtain the supernatant, which was used to determine the yield of (-)-α-bisabolol (GC).
[0182] The results showed that the (-)-α-bisabolol yields of strains LMB2, LMB3, LMB4, and LMB5 were 1.84 g·L⁻¹. -1 1.50 g·L -1 2.10 g·L -1 and 1.75 g·L -1 Comparing yields, strain (LMB4) expressing FPPS from *E. coli* and BOS from *Artichoke salvia* yielded higher yields of (-)-α-bisabolol, which was superior to the combination of FPPS from *E. coli* and BOS from chamomile (LMB2), FPPS from *Saccharomyces cerevisiae* and BOS from *Artichoke salvia* (LMB5), and FPPS from *Saccharomyces cerevisiae* and BOS from chamomile (LMB3).
[0183] Example 4: Comparison of culture medium yield
[0184] The LMB4 strain prepared in Example 2 was used to detect the yield of (-)-α-bisabolol in different culture media.
[0185] Strawberry strain LMB4 was streaked onto LB agar. Single colonies of LMB4 were picked and cultured in 3 mL of LB liquid medium for 12 h. Then, a 1% (v / v) inoculum was added to 250 mL shake flasks containing 50 mL of medium and incubated at 30 °C and 200 rpm for 48 h. The medium used contained 20 g·L⁻¹ of LB liquid medium. -1 Glycerin or 20g·L -1 LB fermentation medium for glucose, containing 20 g / L -1 Glycerin or 20g·L -1 M9 fermentation medium for glucose and containing 20 g·L -1 Glycerin or 20g·L -1 TB fermentation medium for glucose (all fermentation media contain 0.5 g·L⁻¹) -1 Magnesium sulfate and 20% (v / v) n-dodecane). After fermentation, the upper organic phase of the fermentation broth was collected and centrifuged at 12,000 rpm for 10 min to obtain the supernatant, which was used for the determination of (-)-α-bisabolol yield (GC, gas chromatography).
[0186] The results showed that the LMB4 strain was effective in 20 g·L⁻¹ of [a certain substance]. -1 The yield of (-)-α-bisabolol under glucose culture conditions in LB, M9, and TB media was 1.34 g·L⁻¹. -1 0.57 g·L -1 and 1.86 g·L -1 LMB4 strain in 20 g·L -1 The yield of (-)-α-bisabolol under glycerol culture conditions in LB, M9, and TB media was 2.10 g·L⁻¹. -1 0.84 g·L -1 and 2.53 g·L -1 It can be seen that the LMB4 strain, when added to 20 g·L⁻¹, [experienced adverse reactions]. -1 Glycerol-containing TB medium produces more (-)-α-bisabolol than LB and M9 mediums containing the same carbon source.
[0187] Example 5: Optimization of endogenous chaperone proteins
[0188] The genetically engineered bacteria LMB6, LMB7, and LMB8 obtained in Example 2 were used to detect the effect of endogenous chaperone proteins on the yield of (-)-α-bisabolol.
[0189] Strains LMB6, LMB7, and LMB8 were streaked onto LB agar. Single colonies of each strain were picked and inoculated into 3 mL of TB liquid medium, and incubated overnight at 30°C and 200 rpm. The culture was then inoculated at a volume of 1% to a 50 mL container containing 20 g·L⁻¹ of TB liquid medium. -1 Glycerol was cultured in 250 mL shake flasks of TB fermentation medium at 30 °C and 200 rpm for 48 h.
[0190] After fermentation, the OD value was measured at 600 nm using a spectrophotometer. The OD values of the fermentation broths of strains LMB6, LMB7, and LMB8 were 9.32, 9.65, and 10.1, respectively. The upper organic phase of the fermentation broth was centrifuged at 12000 rpm for 10 min to obtain the supernatant, which was used to determine the yield of (-)-α-bisabolol (GC).
[0191] The results showed that the yields of (-)-α-bisabolol from LMB6, LMB7, and LMB8 were 2.75 g·L⁻¹. -1 2.81 g·L -1 and 2.64 g·L -1 It is evident that LMB7 produced higher (-)-α-bisabolol production compared to strains LMB6 and LMB8, indicating that the expression of the endogenous chaperone protein DnaK / J was more effective in increasing production than IbpA / B and the trigger factor.
[0192] Example 6: Knocking out endogenous genes to further increase yield
[0193] Using plasmid pTarget as a vector, the genes YigL, spoT, SixA, and phoA, each 1500 bp upstream and downstream of the gene, were amplified from the genome of Serratia marcescens HBQA7 using corresponding primers. These genes were then ligated into the linearized plasmid vector pTarget to obtain plasmids pTarget-L, pTarget-s, pTarget-S, and pTarget-P.
[0194] Primers were designed to insert the N20 sequence corresponding to the knockout gene into the above plasmids, resulting in plasmids pTarget-L1, pTarget-s1, pTarget-S1, and pTarget-P1. The primers in the plasmid components are shown in Table 4. Plasmids pTarget-L1, pTarget-s1, pTarget-S1, and pTarget-P1 were electroporated into Serratia marcescens HBQA7 containing the pCas plasmid, and recombinants were screened on LB plates containing 50 μg / mL spectinomycin and 50 μg / mL kanamycin.
[0195] Table 4 Primer sequences
[0196]
[0197]
[0198] The pTarget plasmid was eliminated by adding 10 mM rhamnose. The pCas plasmid was also eliminated by adding 10 mM sucrose to LB medium and incubating overnight at 37°C and 200 r / min, resulting in Serratia marcescens with the YigL, spoT, SixA, and phoA genes knocked out, respectively.
[0199] Plasmids pBBR-MiC and pMB1-D were electroporated into the above-mentioned knockout strains to obtain strains LMB 9-12; subsequently, the SixA gene was knocked out in the phoA gene knockout strains, and plasmids pBBR-MiC and pMB1-D were electroporated into them to obtain strain LMB13.
[0200] Table 5 shows the LMB9–13 strains and their expression plasmids.
[0201] Table 5. Strains Construction
[0202] strain name Serratia parent strain Expression plasmids; knockout status LMB9 Serratia marcescens HBQA7 pBBR-MiC, pMB1-D; knockout of YigL LMB10 Serratia marcescens HBQA7 pBBR-MiC, pMB1-D; knockout of spoT LMB11 Serratia marcescens HBQA7 pBBR-MiC, pMB1-D; Knockout SixA LMB12 Serratia marcescens HBQA7 pBBR-MiC, pMB1-D; phoA knockout LMB13 Serratia marcescens HBQA7 pBBR-MiC, pMB1-D; knockout phoA, SixA
[0203] Strains LMB9, LMB10, LMB11, LMB12, and LMB13 were streaked onto LB agar. Single colonies of each strain were picked and inoculated into 3 mL of liquid TB medium, and incubated overnight at 30°C and 200 rpm. The culture was then inoculated at a 1% (v / v) rate into 50 mL of fresh medium supplemented with 20 g·L⁻¹. -1 The glycerol was cultured in TB medium at 30°C and 200 rpm for 48 h.
[0204] The OD value was determined at 600 nm using a spectrophotometer; (-)-α-bisabolol in the dodecane layer was detected by gas chromatography.
[0205] The results showed that the OD values of strains LMB9, LMB10, LMB11, LMB12, and LMB13 were 10.78, 9.45, 11.11, 10.44, and 10.74, respectively; and the yields of (-)-α-bisabolol were 2.96 g·L⁻¹. -1 3.15 g·L -1 2.90 g·L -1 3.21 g·L -1 and 3.20 g·L -1It is evident that LMB12 produced higher (-)-α-bisabolol production compared to strains LMB9, LMB10, LMB11, and LMB13, indicating that knocking out the endogenous phospholipase gene phoA in Serratia marcescens HBQA7 resulted in a greater increase in (-)-α-bisabolol production than knocking out other endogenous phospholipase genes.
[0206] Example 7: Preparation of (-)-α-bisabolol by Scale-up Culture
[0207] The strain LMB12 prepared in Example 6 was cultured in a 30L fermenter.
[0208] Strawberry strain LMB12 was streaked onto LB agar. A single colony of LMB12 was picked and inoculated into 3 mL of TB medium, and cultured at 30°C and 200 rpm for 12 h to obtain primary seed culture. The primary seed culture was transferred at a 1% (v / v) inoculation rate to a 500 mL shake flask containing 100 mL of TB medium, and cultured under the same conditions for 12 h to obtain secondary seed culture. The secondary seed culture was then transferred at a 5% (v / v) inoculation rate to a 5 L fermenter containing 1 L of TB medium to obtain tertiary seed culture.
[0209] The culture was carried out in a 30L fermenter with an initial culture medium of 20L and an initial glycerol concentration of 60g·L⁻¹. -1 The initial pH was 7.0, the culture temperature was 30℃, the initial rotation speed was 200 rpm, and the aeration rate was 1 vvm. At this time, the dissolved oxygen (DO) in the tank was calibrated to 100%. The tertiary seed culture was inoculated into a 30L fermenter at a volume ratio of 5% (OD value 23.54). In order to control the dissolved oxygen in the fermenter to not be lower than 30%, the dissolved oxygen and rotation speed needed to be coupled throughout the fermentation process.
[0210] When the batch fermentation was underway for about 8 hours, dissolved oxygen rebound occurred. At this point, the carbon source in the initial culture medium was basically depleted, and feeding was started in a dissolved oxygen-linked feeding manner. Feeding was started when the dissolved oxygen was greater than 80% and feeding was stopped when the dissolved oxygen dropped to less than 60%. Throughout the fermentation process, 5M ammonia and 1M HCl were added to adjust the pH and maintain the pH of the fermentation broth in the tank at around 7.0. The fermentation time was 180 hours.
[0211] (-)-α-bisabolol in the dodecane layer was detected by gas chromatography. The final yield of (-)-α-bisabolol from strain LMB12 with an OD value of 89.2 was 73.4 g·L⁻¹. -1 .
[0212] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.
Claims
1. A genetically engineered Serratia marcescens strain for producing L-α-bisabolol, characterized in that, The genetically engineered bacteria express exogenous acetyl-CoA thiolytic enzyme, 3-hydroxy-3-methylglutaryl-CoA synthase, hydroxy-3-methylglutaryl-CoA reductase, mevalonate kinase, mevalonate phosphate decarboxylase, isopentenyl phosphate kinase, isopentenyl pyrophosphate isomerase, farnesyl diphosphate synthase, and (-)-α-bisabolol synthase.
2. The Serratia marcescens genetically engineered bacterium according to claim 1, characterized in that, The Serratia marcescens genetically engineered strain overexpresses any one of the following chaperone proteins: IbpA, IbpB, DnaK, DnaJ, or Trigger Factor. The amino acid sequence of IbpA is shown in SEQ ID NO.1, and the amino acid sequence of IbpB is shown in SEQ ID NO.
2. The amino acid sequence of DnaK is shown in SEQ ID NO.3, and the amino acid sequence of DnaJ is shown in SEQ ID NO.4; The amino acid sequence of the Trigger Factor is shown in SEQ ID NO.
5.
3. The Serratia marcescens genetically engineered strain according to any one of claims 1 to 2, characterized in that, The Serratia marcescens genetically engineered strain has one or more of the following knockouts: sugar / pyridoxal phosphatase YigL, bifunctional GTP-bisphosphate kinase / guanosine-3′,5′-bisphosphate pyrophosphate 3′-pyrophosphate hydrolase spoT, phosphohistidine phosphatase SixA, and alkaline phosphatase phoA. Optionally, the Serratia marcescens genetically engineered strain may have one or both of phosphate histidine phosphatase SixA and alkaline phosphatase phoA knocked out.
4. The Serratia marcescens genetically engineered strain according to any one of claims 1 to 3, characterized in that, The hosts of the genetically engineered *Serratia fonticola* strains are *Serratia fonticola* ATCC 29845, *Serratia odorifera* ATCC 33077; *Serratia plymuthica* ATCC 15928, *Serratia liquefaciens* ATCC 27592, *Serratia rubidaea* ATCC 19279, *Serratia oryzae* ATCC 1011, *Serratia ureilytica* ATCC BAA-2620, *Serratia entomophila* ATCC 43705, *Serratia ficaria* ATCC 33105, *Serratia marcescens* ATCC 13880, *Serratia proteamaculans* ATCC 19323, *Serratia symbiotica* DSM 23270, and *Serratia nematodiphila* DSM. Any one of the following: 21420, Serratia quinivorans DSM 4597, Serratia grimesi DSM 30063, and Serratia marcescens HBQA7.
5. A method for producing levo-α-bisabolol, characterized in that, The Serratia marcescens genetically engineered strain according to any one of claims 1 to 4 is inoculated into a culture medium, an organic solvent is added, fermentation and centrifugation are carried out, and the upper organic phase contains levorotatory-α-bisabolol.
6. The method according to claim 5, characterized in that, Add 10–20 g L to the culture medium -1 glucose or glycerol; Optionally, the culture medium includes LB, M9, and TB media.
7. The method according to any one of claims 5 to 6, characterized in that, Fermentation conditions are 30-37℃, 180-200 rpm, and fermentation time of 48 hours or more.
8. The method according to any one of claims 5 to 7, characterized in that, The amount of organic solvent added is 20-30% v / v of the fermentation broth; Alternatively, the organic solvent may include n-dodecane, isopropyl myristate, or pentane.
9. The method according to any one of claims 5 to 8, characterized in that, The pH during fermentation is 6–8.
10. The use of the genetically engineered Serratia marcescens strain according to any one of claims 1 to 4 or the method according to any one of claims 5 to 9 in the preparation of levorotatory-α-bisabolol.