P450 gene of digitaria sanguinalis and application thereof in conferring resistance of plants to carfentrazone-ethyl

Abstract

This invention discloses a P450 gene of crabgrass from paddy fields and its application in conferring resistance to cyhalofop-butyl in plants. The expression level of this gene in the resistant crabgrass biotype is significantly higher than that in the sensitive biotype. By constructing it into a plant expression vector and transforming it into maize, the resulting transgenic maize plants were sprayed with 11.25 g ai ha at the 3-4 leaf stage. ‑1 After treatment with cyhalofop-butyl, the maize exhibited significantly higher herbicide resistance and survival rate than wild-type maize. This invention confirms that the crabgrass P450 gene is directly related to herbicide resistance, providing a foundation for using this gene to breed transgenic crops resistant to ACCase inhibitor herbicides, and has broad application prospects in the field of agricultural biotechnology.

Description

Technical Field

[0001] This invention belongs to the fields of plant genetic engineering and agricultural biotechnology, specifically relating to the P450 gene of Digitaria sanguinalis in paddy fields and its application in conferring cyhalofop-butyl resistance to plants. Background Technology

[0002] Rice paddy crab ( Digitariasanguinalis Cyhalofop-P-ethyl is a globally prevalent and highly hazardous weed that severely damages the production of crops such as rice and corn. Cyhalofop-P-ethyl is an aryloxyphenoxypropionate (APP) herbicide that inhibits fatty acid synthesis by suppressing ACCase activity in plants, leading to plant death. It is widely used for weed control in paddy fields and dryland fields.

[0003] However, due to the long-term and singular use of herbicides, paddy field crabgrass has evolved resistance to cyhalofop-butyl, posing a significant challenge to weed control in farmland. The mechanisms of herbicide resistance in plants are complex, with enhanced herbicide metabolism mediated by cytochrome P450 monooxygenases being one important mechanism. P450 enzymes can catalyze reactions such as hydroxylation and dealkylation of herbicide molecules, inactivating them or making them more easily bound and excreted by subsequent enzyme systems, thereby reducing the toxicity of the herbicide.

[0004] Currently, although there have been some studies on barnyardgrass resistance, there are no reports on the functional verification and practical application of the specific P450 gene in paddy field barnyardgrass in conferring herbicide resistance to crops. Summary of the Invention

[0005] The purpose of this section is to outline some aspects of the embodiments of the present invention and to briefly describe some preferred embodiments.

[0006] In view of the problems existing in the above and / or prior art, the present invention is proposed.

[0007] Therefore, the purpose of this invention is to overcome the shortcomings of the prior art and provide a P450 gene for paddy field crabgrass.

[0008] To solve the above-mentioned technical problems, the present invention provides the following technical solution: a P450 gene for *Digitaria sanguinalis* in paddy fields, characterized in that: the P450 gene has the nucleotide sequence shown in SEQ ID NO: 1; and, It has the amino acid sequence shown in SEQ ID NO: 2.

[0009] Another objective of this invention is to overcome the shortcomings of the prior art and provide a recombinant vector containing the P450 gene. The nucleic acid molecule and the promoter that functions in the plant can be operatively linked into the vector to obtain a recombinant vector.

[0010] As a preferred embodiment of the recombinant vector of the present invention, the promoter is a CaMV35S enhanced promoter, the nucleotide sequence of which is shown in SEQ ID NO: 3; the vector includes the vector PC3300S-FLAG, the nucleotide sequence of which is shown in SEQ ID NO: 4.

[0011] Another object of the present invention is to overcome the shortcomings of the prior art and provide a host cell characterized in that it contains the said gene or the said recombinant vector; The host cell is a microbial cell or a plant cell.

[0012] Another object of the present invention is to overcome the shortcomings of the prior art and provide a method for cultivating herbicide-resistant plants, comprising introducing the gene or the recombinant vector into plant cells or tissues and obtaining regenerated transgenic plants; The transgenic plants showed higher resistance to cyhalofop-butyl than the wild-type plants.

[0013] Another objective of this invention is to overcome the shortcomings of the prior art and provide an application of nucleic acid molecules in the preparation of transgenic plants or in conferring resistance to herbicides containing acetyl-CoA carboxylase (ACCase) inhibitors.

[0014] As a preferred embodiment of the application described in this invention, the ACCase inhibitor herbicide is an aryloxyphenoxypropionate ester (APP) herbicide.

[0015] In a preferred embodiment of the application described in this invention, the ACCase inhibitor is cyhalofop-butyl.

[0016] In a preferred embodiment of the application described in this invention, the plant is a gramineous crop sensitive to cyhalofop-butyl, including corn, wheat or barley, sorghum, etc.

[0017] Beneficial effects of this invention: The rice paddy crabgrass P450 gene provided by this invention can effectively confer resistance to cyhalofop-butyl on transgenic maize. This gene can be used to breed new varieties of crops such as herbicide-resistant maize and wheat, and has important application value and market prospects. Attached Figure Description

[0018] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort. Wherein: Figure 1This is a graph showing the relative expression levels of the P450 gene in *Diospyros kurstica* from paddy fields at 0h, 3h, 6h, and 24h after treatment with cyhalofop-butyl, representing the resistance (R) and sensitivity (S) of this invention.

[0019] Figure 2 This is a gel electrophoresis image of the PCR amplification products of the P450 gene of Dioscorea opposita in paddy fields, which exhibits resistance (R) and sensitivity (S) according to this invention.

[0020] Figure 3 This is a schematic diagram of the plant overexpression vector structure of the P450 gene of this invention.

[0021] Figure 4 This invention relates to the application of cyhalofop-butyl (11.25 g ai ha) to genetically modified maize and wild-type (WT) maize. -1 Phenotypic comparison photos 5 days after the event.

[0022] Figure 5 This is the dose-response curve of the transgenic maize of this invention compared with wild-type (WT) maize 14 days after spraying with different concentration gradients of cyhalofop-butyl. Detailed Implementation

[0023] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below with reference to the examples in the specification.

[0024] Example 1 1. Seeds of various Digitaria species collected from paddy fields were sown separately into disposable plastic cups filled with soil for growth. When the seeds reached the 3-leaf stage, cyhalofop-butyl (105 g ai ha) was sprayed. -1 Plants that survive 21 days after application of the herbicide are classified as cyhalofop-butyl-resistant (R) crabgrass populations, while those that die are classified as cyhalofop-butyl-sensitive (S) crabgrass populations.

[0025] 2. Sow resistant and susceptible crabgrass seeds separately in disposable plastic cups filled with soil for growth. When the seeds reach the 3-4 leaf stage, spray with cyhalofop-butyl (105 g ai ha). -1 The first fully expanded leaf of resistant and susceptible plants was harvested at 0, 3, 6 and 24 hours after application, with each set of 3 leaves constituting one replicate. Three replicates were harvested at each time point. RNA was extracted from leaves of resistant and susceptible Digitaria pilosa at each treatment time using the FastPure Universal Plant Total Isolation Kit from Nanjing Novogene Biotechnology Co., Ltd. The RNA was then sent to Novogene for transcriptome sequencing (Illumina NovaSeq 6000 sequencer, paired-end sequencing). Differential gene expression analysis showed that the relative expression level of the P450 gene was higher in the R-type than in the S-type. Figure 1 ).

[0026] 3. Design specific primers: The forward primer 5'-ATGGCGTTATCCTGTTACTACTTCC-3' and the reverse primer 5'-GCACTTAGCTTACTAGTCTCTCTGT-3' were used as templates. PCR amplification products were subjected to 1% agarose gel electrophoresis. Figure 2 The PCR product was sent to Qingke Biotechnology Co., Ltd. for sequencing to obtain the full-length CDS sequence. The P450 gene has the nucleotide sequence shown in SEQ ID NO:1; and has the amino acid sequence shown in SEQ ID NO:2.

[0027] Example 2 Construction of plant expression vectors: The P450 gene CDS fragment was recombined into the plant expression vector PC3300S-FLAG (nucleotide sequence of the vector is shown in SEQ ID NO: 4) containing the CaMV35S enhanced promoter (nucleotide sequence shown in SEQ ID NO: 3) via HindIII and XbaI double digestion and ligation, thus constructing the recombinant plasmid PC3300S-P450-FLAG. Figure 3 Its nucleic acid sequence is shown in SEQ ID NO: 5.

[0028] Example 3 Cyhalofop-butyl resistance identification in genetically modified maize: 1. The recombinant plasmid PC3300S-P450-FLAG was introduced into Agrobacterium tumefaciens EHA105 (derived from Sangon Biotech (Shanghai) Co., Ltd.) by electroporation.

[0029] The specific process conditions for the electric shock method are as follows: (1) Melting competent cells: Take out a tube (about 50 μL) of EHA105 competent cells from the -80℃ freezer and place it on ice immediately to allow it to thaw slowly.

[0030] (2) Mixing plasmids with cells: Add 1-5 μL (about 50-100 ng) of plasmid DNA PC3300S-P450-FLAG to the thawed competent cells and mix gently with a pipette tip (avoiding the formation of air bubbles).

[0031] (3) Incubation on ice: Place the mixture on ice for 5-10 minutes.

[0032] (4) Electric shock: Transfer the entire mixture to a pre-cooled, sterile electroporation cup, ensuring the liquid is at the bottom of the cup and the outer wall of the cup is dry.

[0033] Set the parameters for the electroporation apparatus. For Agrobacterium EHA105, commonly used parameters are: Voltage: 2.0 - 2.5 kV; Capacitance: 25 μF; Resistance: 200 - 400 Ω; Time constant: typically 4-5 milliseconds (this is the result, no need to set). Wipe the outer wall of the electric shock cup dry, place it steadily into the slot of the electric shock device, start the electric shock, and you will hear a beep, indicating that the electric pulse has been released.

[0034] (5) Recovery: Immediately add 500 μL to the electroshock cup - 1 mL of antibiotic-free YEB or SOC liquid culture medium.

[0035] Gently pipette the mixture to mix, and then transfer the bacterial culture to a sterile 1.5 mL centrifuge tube.

[0036] Place the centrifuge tubes in a shaker at 28°C and 100-150 rpm for 2-4 hours to allow the cells to recover and express the resistance gene.

[0037] (6) Spreading on plates: Spread the revived bacterial culture (which can be concentrated by centrifugation as appropriate) evenly on YEB solid plates containing rifampicin (used to inhibit contaminating bacteria) and plasmid-resistant antibiotics (such as kanamycin, used to screen positive transformants).

[0038] 2. Infecting maize embryonic callus tissue using Agrobacterium-mediated transformation.

[0039] Using freshly peeled corn embryos of about 1 mm as material, the peeled corn embryos were placed in a 2 ml plastic centrifuge tube containing 1.8 mL of suspension. Approximately 150 immature embryos were processed within 30 minutes. Remove the suspension, leaving the corn germ in the tube. Then add 1.0 ml of Agrobacterium suspension and let stand for 5 min. After suspending the immature embryos in the centrifuge tubes, they were poured onto co-culture medium, and excess Agrobacterium tumefaciens culture was aspirated from the surface using a pipette. The embryos were then co-cultured in the dark at 23°C for 3 days. After co-culture, the immature embryos were transferred to resting medium and incubated in the dark at 28°C for 6 days. They were then placed on selection medium containing diammonium phosphate for two weeks of selection culture, followed by two weeks of selection culture on a fresh selection medium.

[0040] The resistant callus was transferred to differentiation medium and cultured at 25°C, 5000 lx, under light for 3 weeks; the differentiated seedlings were then transferred to rooting medium and cultured at 25°C, 5000 lx, under light until rooting occurred.

[0041] 3. Resistant callus was screened, differentiated, and rooted on a medium containing the herbicide Basta (selection marker gene) to obtain transgenic seedlings.

[0042] Live callus was screened out using N6+2,4-D+Basta, seedlings were grown using MS+6-BA+Basta, roots were grown using 1 / 2 MS+NAA, and finally transgenic seedlings were obtained.

[0043] The specific training conditions are as follows: (1) Screening culture medium (for callus growth) Formula: N6 + 2,4-D (2 mg / L) + Basta (5 mg / L); Specifically, N6 basal medium was used, with 2 mg / L 2,4-D and 5 mg / L Basta added as screening agents; Culture in the dark at 25°C until the explants produce pale yellow callus tissue with a diameter of about 0.5-1.0 cm, which usually takes 4-8 weeks; All culture media should be adjusted to pH 5.8 and solidified with agar.

[0044] (2) Differentiation medium (for seedling growth) Formula: MS + 6-BA (2 mg / L) + Basta (5 mg / L); Specifically, MS basal medium was used, supplemented with 2 mg / L 6-BA and 5 mg / L Basta; Cultured at 25℃ and under 16 hours of light to promote the differentiation of resistant callus into green seedlings; All culture media should be adjusted to pH 5.8 and solidified with agar.

[0045] (3) Rooting medium (for root growth) Formula: 1 / 2 MS + NAA (0.2 mg / L); Specifically, use 1 / 2 MS basal medium (with macro-elements reduced by half) and add 0.2 mg / L NAA; Cultivate at 25℃ with 16 hours of light per day. Once the seedlings have developed a robust root system, they are ready for transplanting. All culture media should be adjusted to pH 5.8 and solidified with agar.

[0046] 4. T0 generation transgenic positive plants were identified by Basta herbicide screening strips, and T1 generation seeds were harvested.

[0047] 5. Transgenic maize T1 generation positive plants and wild-type (WT) maize were planted in a greenhouse.

[0048] 6. When the plants have grown to the 3-4 leaf stage, use a spray tower to evenly spray 7.5 mL of 10% cyhalofop-butyl OD, which means the effective dose of cyhalofop-butyl is 11.25 g ai ha⁻¹.

[0049] 7. Observe and record the symptoms of damage to the plants (yellowing, wilting, death, etc.) 5 days after application of the pesticide, and calculate the survival rate.

[0050] 8. Results are as follows Figure 4 As shown, five days after application, wild-type maize was almost completely dead, while the transgenic maize that overexpressed MYB had a 100% survival rate and showed no signs of phytotoxicity, which was significantly better than the wild-type control.

[0051] Example 4 Resistance levels of genetically modified maize to cyhalofop-butyl: T1 generation genetically modified corn and wild-type corn seeds were planted individually in 35 disposable plastic cups filled with nutrient soil and placed in a greenhouse for cultivation.

[0052] When the plant reaches the 3-leaf stage, spray different concentrations of cyhalofop-butyl (0, 5.070, 6.075, 7.290, 8.745, 10.500, 12.600 g ai ha) in a spray tower. -1 ), spray 5 cups for each concentration and repeat.

[0053] Fresh weight of the aboveground parts of the plants was collected 14 days after application. This was used to calculate the herbicide concentration that would reduce aboveground biomass by 50% (GR). 50 The logistic regression model for y is as follows (implemented using SigmaPlot 15.0 software): y = C + (D - C) / [1 + (x / GR)] 50 )^b]. Where y represents the percentage reduction in aboveground biomass, x is the herbicide dosage, C and D represent the lower and upper asymptotes of the model, respectively, and b is the GR. 50The slope of the nearby curve. The resistance index (RI) is measured using the GR (grafting rate) of genetically modified maize. 50 Compared with wild-type corn GR 50 The ratio is calculated from this.

[0054] The results are as follows Figure 5 As shown, the GR of transgenic maize to cyhalofop-butyl 50 20.238 g ai ha -1 GR of wild-type maize to cyhalofop-butyl 50 7.399 g ai ha -1 The resistance index (RI) of genetically modified corn is 2.7 times higher.

[0055] The sequences involved in the embodiments of the present invention are as follows: SEQ ID NO: 1 SEQ ID NO: 2 MALSCYYFQELAISVLLAVSLCIFIKCWRLRNPLYLYPMDWPVVGMVPPLVTRLHNFHDELTAVLAASRCNFKSQGPLASGLRFFITADPENVRHIFTSNHANYPKGEELADIFDIVSGSLLTVDGEASRQHRALFQNTLGNPRLLAMMACCCRDKVNGLLLLLTSMASTRTPFDMQDLIARLVFDLTVTPIFGVDPGCLSTNMPPTHGAAAMDTVMEVAFFRHTMPASLWKVMRWLNIGLEKKLAVAHTVLHGFVRERIEKRKGRCADHDDVFGMDFISADPVCSDDDDFLLRLLIFYMIAGRDTIGTTIPWVFYNLAKNPRIVSCVRKELAPMAAALASNGSSSMTVFDQEETKDLVYLKAALLESLRLYPLGPIERKNGSPVGQRLISEDGAMLRYVPSHKFMAFNTGPRMCLGKDIAMAQMKTIVAAVVWNYDMEVVEGQTIEPKLSCLLQLKNGLMMMVKQRD SEQ ID NO: 3 TGAGACTTTTCAACAAAGGGTAATATCGGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTCATCAAAAGGACAGTAGAAAAGGAAGGTGGCACCTACAAATGCCATCATTGCGATAAAGGAAAGGCTATCGTTCAAGATGCCTCTGCCGACAGTGGTCCC AAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGAACATGGTGGAGCACGACACTCTCGTCTACTCCAAGAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCTATTGAGACTTTTCAA CAAAGGGTAATATCGGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTCATCAAAAGGACAGTAGAAAAGGAAGGTGGCACCTACAAATGCCATCATTGCGATAAAGGAAAGGCTATCGTTCAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCC CACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCAACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATAAGGAAGTTCATTTCATTTGGAGAGGACACGCTGA In summary, this invention provides the first functional verification of the novel function of the P450 gene derived from resistant paddy field barnyardgrass in conferring cyhalofop-butyl resistance to crops, providing important genetic resources and technical means for the genetic improvement of crop herbicide resistance.

[0056] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the present invention.

Claims

1. A P450 gene of Digitaria sanguinalis in paddy fields, characterized by: The P450 gene has the nucleotide sequence shown in SEQ ID NO: 1; and, It has the amino acid sequence shown in SEQ ID NO:

2.

2. A recombinant vector, characterized in that: Includes the P450 gene as described in claim 1; The nucleic acid molecule and the promoter that functions in the plant can be operatively linked into the vector to obtain a recombinant vector.

3. The recombinant vector as described in claim 2, characterized in that: The promoter is a CaMV35S enhanced promoter, the nucleotide sequence of which is shown in SEQ ID NO: 3; the vector includes the vector PC3300S-FLAG, the nucleotide sequence of which is shown in SEQ ID NO:

4.

4. A host cell, characterized in that: Contains the gene as described in claim 1 or the recombinant vector as described in claim 2 or 3; The host cell is a microbial cell or a plant cell.

5. A method for cultivating herbicide-resistant plants, characterized in that: This includes introducing the gene of claim 1 or the recombinant vector of claim 2 or 3 into plant cells or tissues and obtaining regenerated transgenic plants; The transgenic plants showed higher resistance to cyhalofop-butyl than the wild-type plants.

6. The application of the P450 gene according to claim 1 in the preparation of transgenic plants, characterized in that: The P450 gene confers resistance to herbicides that inhibit acetyl-CoA carboxylase (ACCase) in plants.

7. The application as described in claim 6, characterized in that: The ACCase inhibitor herbicide is an aryloxyphenoxypropionate ester (APP) herbicide.

8. The application as described in claim 7, characterized in that: The ACCase inhibitor is cyhalofop-butyl.

9. The application as described in claim 7, characterized in that: The plants mentioned are grasses that are sensitive to cyhalofop-butyl, including corn, wheat, barley, and sorghum.

Images