Application of PPR protein TaPPR13 and its encoding gene in regulating wheat drought resistance
By regulating the expression level and protein content of the gene encoding TaPPR13 protein in wheat and introducing it into wheat using a recombinant vector, the problem of insufficient drought resistance in wheat was solved, and the drought tolerance and yield of wheat were significantly improved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-26
- Publication Date
- 2026-05-26
AI Technical Summary
How to improve the drought resistance of wheat to cope with frequent drought stress, reduce yield loss, and ensure food security.
By regulating the expression level and protein content of the TaPPR13 protein encoding gene in wheat, the TaPPR13 gene was introduced into wheat using a recombinant vector to improve its drought resistance.
It significantly improved the drought tolerance of wheat, manifested in higher survival rate, higher chlorophyll content, higher antioxidant enzyme activity, and lower malondialdehyde and peroxide content, thus enhancing wheat growth performance and yield under drought conditions.
Smart Images

Figure FT_1 
Figure FT_2
Abstract
Description
Technical Field
[0001] This application belongs to the field of biotechnology, specifically relating to the application of PPR protein TaPPR13 and its encoding gene in regulating wheat drought resistance. Background Technology
[0002] Abiotic stress is a crucial factor affecting plant growth, development, and yield. To cope with these stresses, plants utilize interactions involving osmotic regulation, antioxidant systems, transcription factor regulation, and signal transduction pathways to adapt to various abiotic stress environments. Under abiotic stress, plants maintain cellular water balance and turgor pressure by accumulating osmotic regulators. Common osmotic regulators include proline, betaine, and soluble sugars. These substances can lower the osmotic potential of cells and enhance plant resistance. Furthermore, abiotic stress leads to the excessive production of reactive oxygen species (ROS) in plants, such as superoxide anions and hydrogen peroxide. Excessive ROS causes oxidative damage to cells. To eliminate ROS, plants activate antioxidant systems, including enzymatic and non-enzymatic antioxidant systems. Enzymatic antioxidant systems mainly include superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD), which can convert ROS into harmless substances.
[0003] With global climate change and the increasing frequency of extreme weather events, droughts, high temperatures, and floods pose significant challenges to wheat production. Discovering wheat stress-resistance genes can help breed wheat varieties with stronger drought, cold, and salt tolerance. When faced with frequent abiotic stresses such as drought, these varieties can better adapt to harsh environments, reducing yield losses caused by stress. Enabling wheat to better adapt to these changes is crucial for ensuring future food security and enabling agricultural production to better cope with the uncertainties brought about by climate change. Summary of the Invention
[0004] The technical problem this application aims to solve is how to regulate plant stress resistance. More specifically, the technical problem this application aims to solve is how to improve the drought resistance of wheat. The technical problem this application aims to solve is not limited to the described technical subject matter, and other technical subject matter not mentioned herein can be clearly understood by those skilled in the art through the following description.
[0005] To address the aforementioned technical problems, this application provides the use of TaPPR13 protein, a substance regulating the expression of the gene encoding TaPPR13 protein, or a substance regulating the content of TaPPR13 protein in any of the following: A1) Its application in regulating plant drought resistance; A2) Application in the preparation of products that regulate plant drought resistance; A3) Applications in plant breeding or plant-assisted breeding; A4) Application in the preparation of plant breeding or plant-assisted breeding products; The TaPPR13 protein is any of the following: a1) The amino acid sequence is that of the protein shown in SEQ ID No. 1; a2) Proteins obtained by substituting, deleting and / or adding amino acids to the amino acid sequence of the protein shown in a1), which have more than 90% identity with the amino acid sequence shown in a1) and are related to plant drought resistance. a3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of a1) or a2).
[0006] In this application, the protein may be derived from wheat.
[0007] In this application, SEQ ID No.1 consists of 610 amino acids.
[0008] a3) The connection can be formed via peptide bonds. Specifically, the C-terminus of the tag dehydrates and condenses with the N-terminal amino acid of the protein in a1) or a2) to form a peptide bond. Alternatively, the N-terminus of the tag dehydrates and condenses with the C-terminal amino acid of the protein in a1) or a2) to form a peptide bond.
[0009] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.
[0010] The protein tag refers to a polypeptide or protein fused with a target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag protein tag, His protein tag, MBP protein tag, HA protein tag, myc protein tag, GST protein tag, and / or SUMO protein tag, etc.
[0011] In this application, the regulation may be to increase, promote, or adjust.
[0012] In this application, the regulation may also be a reduction, suppression, or downregulation.
[0013] In this application, the purpose of plant breeding may be to obtain target plants with higher drought resistance than the parent plants and / or to obtain target plants with lower drought resistance than the parent plants.
[0014] In this application, the evaluation indicators for plant breeding include drought resistance of plants.
[0015] In this application, the substance that regulates the protein content may be a substance that increases the expression of the gene encoding the protein.
[0016] In this application, the substance regulating gene expression may be a substance that performs at least one of the following six types of regulation: 1) regulation at the gene transcription level; 2) post-transcriptional regulation of the gene (i.e., regulation of splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (i.e., regulation of mRNA transport of the gene from the nucleus to the cytoplasm); 4) regulation of gene translation; 5) regulation of mRNA degradation of the gene; and 6) post-translational regulation of the gene (i.e., regulation of the activity of the protein translated by the gene).
[0017] Furthermore, in the aforementioned application, the substance regulating the expression of the protein-coding gene or the substance regulating the protein content is a biological material, which may be any of the following: B1) The nucleic acid molecule encoding the TaPPR13 protein mentioned above; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3); B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3); B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3); B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2), or transgenic plant organs containing the recombinant vector described in B3).
[0018] The nucleic acid molecules mentioned in this article can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecules can also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA, or antisense RNA.
[0019] Furthermore, in the aforementioned applications, the nucleic acid molecule described in B1) may be as described in g1) or g2) below: g1) The coding sequence of the coding strand is the DNA molecule of SEQ ID No. 2; g2) is a DNA molecule that has more than 80% identity with the DNA molecule described in g1) and regulates plant drought resistance.
[0020] The nucleotide sequence shown in SEQ ID NO.2 is a protein. TaPPR13 The nucleotide sequence of the encoding gene (CDS). The protein TaPPR13 gene described in this application ( TaPPR13 The gene can be any nucleotide sequence that encodes the protein TaPPR13. Considering the degeneracy of codons and the codon preferences of different species, those skilled in the art can use codons suitable for expression in a specific species as needed.
[0021] B1) The nucleic acid molecule may also include a nucleic acid molecule obtained by codon preference modification based on the nucleotide sequence shown in SEQ ID No.2.
[0022] The vectors described herein are well-known to those skilled in the art and include, but are not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage), granules (i.e., Cosmids), Ti plasmids, or viral vectors. Specifically, they may be the pEasyblunt vector and / or the pWMB110 vector.
[0023] Existing plant expression vectors can be used to construct structures containing... TaPPR13 Recombinant gene expression vectors. These plant expression vectors include, but are not limited to, binary Agrobacterium vectors and vectors suitable for plant microbombardment. The plant expression vectors may also contain the 3' untranslated region of the exogenous gene, i.e., containing a polyadenylate signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylate signal can guide the addition of polyadenylate to the 3' end of the mRNA precursor; similar functions exist for the untranslated regions transcribed at the 3' end of genes including, but not limited to, Agrobacterium crown gall-inducing (Ti) plasmid genes (such as the Nos gene for lipase synthesis) and plant genes (such as the wheat storage protein gene).
[0024] use TaPPR13When constructing recombinant plant expression vectors, any type of enhancing promoter or constitutive promoter can be added before the transcription initiation nucleotide, including but not limited to the cauliflower mosaic virus (CAMV) 35S promoter and the maize ubiquitin promoter. These can be used alone or in combination with other plant promoters. Furthermore, when constructing plant expression vectors using the genes described in this application, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, but they must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are broad, and they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes.
[0025] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS genes, luciferase genes, etc.), antibiotic resistance markers (gentamicin markers, kanamycin markers, etc.), or chemical reagent resistance marker genes (such as herbicide resistance genes). From a safety perspective, transgenic plants can be screened directly under stress without adding any selective marker genes.
[0026] Using any vector capable of guiding the expression of exogenous genes in plants, the gene provided in this application can be expressed. TaPPR13 Introducing genes or gene fragments into plant cells or recipient plants can yield transgenic cell lines and transgenic plants with enhanced stress resistance. (Carrying...) TaPPR13 Gene expression vectors can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, and Agrobacterium-mediated transformation, and the transformed plant tissues can be cultured into plants.
[0027] In this application, the recombinant microorganisms may specifically be yeast, bacteria, algae, and fungi. Among them, bacteria may be derived from genera such as *Escherichia*, *Erwinia*, *Agrobacterium*, *Flavobacterium*, *Alcaligenes*, *Pseudomonas*, and *Bacillus*. Specifically, they may be *Escherichia coli* competent cells TOP10 and / or *Agrobacterium tumefaciens* EHA105.
[0028] The recombinant vector may specifically be the recombinant vector pEasyblunt-TaPPR13 and / or pWMB110-TaPPR13.
[0029] The recombinant vector pEasyblunt- TaPPR13 The method involves using blunt-end cloning to ligate a DNA fragment whose nucleotide sequence is SEQ ID No. 2 in the sequence listing into the pEasyblunt vector, while keeping the other sequences of the pEasyblunt vector unchanged, resulting in a recombinant vector.
[0030] The recombinant vector pWMB110- TaPPR13 It is in the carrier pWMB110 BamH The DNA molecule shown in SEQ ID No. 2 was inserted at the I restriction site.
[0031] The recombinant microorganism may specifically be recombinant Agrobacterium EHA105 / pWMB110- TaPPR13 .
[0032] The recombinant Agrobacterium EHA105 / pWMB110- TaPPR13 Contains the encoded sequence SEQ ID NO.2 TaPPR13 The gene is the recombinant vector pWMB110- TaPPR13 Recombinant microorganisms obtained by introducing Agrobacterium EHA105.
[0033] Furthermore, in this application, the plant tissue may be derived from roots, stems, leaves, flowers, fruits, seeds, pollen, embryos, and anthers.
[0034] Furthermore, in this application, the genetically modified plant organs may be the roots, stems, leaves, flowers, fruits, and seeds of the genetically modified plant.
[0035] Furthermore, in this application, the transgenic plant cell lines, transgenic plant tissues, and transgenic plant organs may or may not include propagation material.
[0036] Furthermore, in the application, the plant or recipient plant may be selected from monocotyledonous plants.
[0037] Furthermore, in the application, the monocotyledonous plant may be selected from grasses.
[0038] Furthermore, in the application, the grass plant can be selected from wheat plants.
[0039] Furthermore, in the aforementioned application, the wheat species may be selected from wheat (Wheat (Wheat) Triticum aestivum L.).
[0040] To address the aforementioned technical problems, this application provides a method for regulating plant drought resistance. The method may include regulating the drought resistance of the recipient plant by controlling the expression level of the gene encoding the TaPPR13 protein and / or the content of the TaPPR13 protein in the recipient plant.
[0041] Furthermore, in the method described, the regulation may be to increase, promote, or upregulate.
[0042] Furthermore, in the method described, the regulation may also be a reduction, suppression, or downregulation.
[0043] Furthermore, the method can enhance the drought resistance of recipient plants by increasing the expression level of the gene encoding TaPPR13 protein and / or the content of TaPPR13 protein in the recipient plants.
[0044] Furthermore, in the method, the expression level of the protein-coding gene and / or the content of TaPPR13 protein in the recipient plant are increased by introducing the gene encoding the TaPPR13 protein into the recipient plant.
[0045] Furthermore, in the method, the encoding gene may be as described in g1) or g2): g1) The coding sequence of the coding strand is the DNA molecule of SEQ ID No. 2; g2) is a DNA molecule that has more than 80% identity with the DNA molecule described in g1) and regulates plant drought resistance.
[0046] Those skilled in the art can readily mutate the nucleotide sequence encoding the protein TaPPR13 of this application using known methods, such as directed evolution or point mutation. Any artificially modified nucleotides that possess 80% or more of the nucleotide sequence identity with the protein TaPPR13 isolated in this application, provided they encode and function as protein TaPPR13, are derived from and equivalent to the nucleotide sequence of this application.
[0047] Furthermore, in the method, the gene encoding the TaPPR13 protein is introduced into the recipient plant in the form of a vector.
[0048] In some embodiments of this application, the vector is pWMB110-TaPPR13. pWMB110-TaPPR13 contains a DNA molecule with the nucleotide sequence of SEQ ID No. 2 and can express the TaPPR13 protein with the amino acid sequence of SEQ ID No. 1.
[0049] To address the aforementioned technical problems, this application provides a method for cultivating target plants with enhanced drought resistance. This method can obtain target plants with higher drought resistance than the recipient plants by increasing the expression level of the gene encoding TaPPR13 protein and / or the content of TaPPR13 protein in the recipient plants.
[0050] Furthermore, the method increases the expression level of the TaPPR13 protein encoding gene and / or the content of TaPPR13 protein in the recipient plant by introducing the TaPPR13 protein encoding gene into the recipient plant.
[0051] Furthermore, in the method, the gene encoding the TaPPR13 protein may be as described in g1) or g2) below: g1) The coding sequence of the coding strand is the DNA molecule of SEQ ID No. 2; g2) is a DNA molecule that has more than 80% identity with the DNA molecule described in g1) and regulates plant drought resistance.
[0052] Furthermore, in the method, the gene encoding the TaPPR13 protein can be introduced into the recipient plant in the form of a vector.
[0053] In some embodiments of this application, the carrier may be pWMB110-TaPPR13.
[0054] Furthermore, in the method described, the plant is selected from monocotyledonous plants.
[0055] Furthermore, in the method, the monocotyledonous plant is selected from grasses.
[0056] Furthermore, in the method, the grass plant is selected from plants of the genus Triticum.
[0057] Furthermore, in the method, the rice plant is selected from wheat ( Triticum aestivum ).
[0058] In one embodiment of this application, the method for cultivating stress-resistant plants includes the following steps: (1) Construct a recombinant vector containing the DNA molecule shown in SEQ ID NO.2; (2) Transfer the recombinant vector constructed in step (1) into the target plant (such as crop or wheat); (3) Through screening and identification, stress-resistant plants with higher stress resistance than the target plant were obtained.
[0059] Furthermore, the target plant with enhanced drought resistance exhibits at least one of the following characteristics compared to the recipient plant under drought stress: (1) It has a relatively higher survival rate; (2) Increase the chlorophyll content of the target plant; (3) It has relatively higher antioxidant enzyme activity; (4) It has a relatively lower malondialdehyde content; (5) It has a relatively lower peroxide content; (6) It has a relatively higher output performance.
[0060] In this application, the target plant is understood to include not only the plant described above. TaPPR13 The first generation of transgenic plants obtained from the target plant through gene transformation, including its progeny. The gene can be propagated within the species, or transferred into other varieties of the same species, particularly commercial varieties, using conventional breeding techniques. The stress-resistant plants include seeds, callus tissue, intact plants, and cells.
[0061] Furthermore, in this application, the expression level of the protein-coding gene in plants or the content of the protein can be increased by introducing an expression vector containing the TaPPR13 protein-coding gene, thereby improving the drought resistance of plants.
[0062] In this application, identity refers to the identity of amino acid sequences or nucleotide sequences. The identity of amino acid sequences (or nucleotide sequences) can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences, the identity value (%) can be obtained.
[0063] The aforementioned 90% or higher degree of identity can be interpreted as 90% or 95% or higher degree of identity.
[0064] The aforementioned 80% or higher degree of identity can be 80%, 85%, 90%, or 95% or higher degree of identity.
[0065] The 80% or more identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 85% or more identity can be at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 90% or more identity can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 95% or more identity can be at least 95%, 96%, 97%, 98%, or 99% identity.
[0066] This application will use wheat ( Triticum aestivum ) Regulation of plant stress resistance TaPPR13 The genes were introduced into the recipient control plant, wild-type wheat (Fielder), and transgenic plants were obtained. TaPPR13 Homozygous wheat lines ( TaPPR13 -1 strain and TaPPR13 -2 strains). Experiments showed that, compared with the non-transgenic receptor control, under drought stress, overexpression of the receptor strain... TaPPR13 The survival rate of transgenic wheat plants was significantly higher than that of the recipient control, and their growth was also significantly better than that of the recipient control, indicating that... TaPPR13 Overexpression of genes can significantly improve the drought resistance of plants, specifically through overexpression... TaPPR13 The transgenic wheat with the gene showed significantly increased chlorophyll content and antioxidant enzyme activity, and significantly decreased malondialdehyde and peroxide content, with all physiological indicators significantly better than the recipient control. Therefore, under drought stress conditions, overexpression of the gene is effective. TaPPR13 Wheat varieties that inherited the TaPPR13 gene showed stronger tolerance, indicating that the TaPPR13 protein and its encoding gene described in this application... TaPPR13 It can regulate plant drought resistance by increasing the content and / or activity of TaPPR13 protein in the target plant (e.g., through overexpression). TaPPR13 Genes can significantly improve the drought resistance of target plants.
[0067] This application has identified a novel gene that can regulate plant stress resistance under drought stress conditions, which is of great significance and application value for breeding new stress-resistant plant varieties and improving plant stress resistance. Attached Figure Description
[0068] Figure 1 For the transfer TaPPR13 Analysis of drought tolerance in the seedling stage of genetically modified wheat. Figure 1In the middle row, A represents the phenotypes of transgenic wheat and the wild-type recipient control under normal conditions and drought treatment. The first row represents normal conditions, and the second row represents drought stress treatment. Figure 1 B represents the PCR detection of genetically modified wheat; Figure 1 C represents genetically modified wheat. TaPPR13 Expression level analysis of the target gene; Figure 1 D represents the survival rate of transgenic wheat and wild-type wheat under normal growing conditions and drought stress; Figure 1 Figure E shows the results of malondialdehyde (MDA) content determination in leaves of transgenic wheat and recipient control during the seedling stage under normal growth conditions and drought stress. Figure 1 Figures F and G show the results of leaf peroxidase (POD) and catalase (CAT) activities in transgenic wheat seedlings and recipient controls under normal growth conditions and drought stress, respectively. Figure 1 Figure H shows the results of total chlorophyll content measurement in leaves of transgenic wheat and recipient control during the seedling stage under normal growth conditions and drought stress. Figure 1 I and J represent the superoxide anion (O2) concentrations in leaves of transgenic wheat seedlings and the recipient control under normal growth conditions and drought stress, respectively. ·- The results of the determination of ) and hydrogen peroxide (H2O2) are shown in the figure.
[0069] Figure 2 for TaPPR13 Identification of drought resistance in genetically modified wheat during the grain-filling stage. Figure 2 Figures A and B show the phenotypic characteristics of transgenic wheat and the recipient control plants after drought stress. Figure 2 The middle section (C) shows the yield measurement results of transgenic wheat and the recipient control in plots under drought stress. Figure 2 The diagram in Figure D shows the phenotypic characteristics of transgenic wheat and the recipient control after drought stress. The first row represents normal conditions, and the second row represents drought stress treatments. Figure 2 Figure E shows the results of grain number measurement in transgenic wheat and recipient control under normal growth conditions and high temperature stress; Figure 2 Figures F and G show the results of grain length and width measurements of transgenic wheat and recipient control after grain filling under normal growth conditions and drought stress, respectively. Figure 2 The figure in middle H shows the results of measuring the thousand-grain weight of transgenic wheat and the recipient control after grain filling under normal growth conditions and drought stress. Detailed Implementation
[0070] The present application will now be described in further detail with reference to specific embodiments. The embodiments given are merely illustrative of the present application and are not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the present application in any way.
[0071] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0072] The wheat varieties “Fielder” and “Jinhe 991” in the following examples are described in the following references: Qiu Yuliang. Study on the improvement of wheat HMW-GS composition and structure by chromosome engineering and genetic engineering [D]. Chinese Academy of Agricultural Sciences, 2023; and Ru JN, Hou ZH, Zheng L, Zhao Q, Wang FZ, Chen J, Zhou YB, Chen M, Ma YZ, XiYJ, Xu ZS. Genome-Wide Analysis of DEAD-box RNA Helicase Family in Wheat (Triticum aestivum) and Functional Identification of TaDEAD-box57 in AbioticStress Responses. Frontiers in Plant Science, 2021, 12: 797-76. These are available to the public from the Institute of Crop Science, Chinese Academy of Agricultural Sciences.
[0073] The Agrobacterium tumefaciens EHA105 used in the following examples was purchased from Beijing Zhuangmeng International Biotechnology Co., Ltd.
[0074] The vector pWMB110 in the following embodiments is described in the following literature: Liu, Y., Yu, TF, Li,YT, Zheng, L., Lu, ZW, Zhou, YB, Chen, J., Chen, M., Zhang, JP, Sun,GZ, Cao, XY, Liu, YW, Ma, YZ,&Xu, ZS (2022). Mitogen-activated protein kinase TaMPK3 suppresses ABA response by destabilizing TaPYL4 receptor in wheat. The New Phytologist, 236(1), 114–131. The public may obtain this material from the applicant. The obtained material may only be used for the verification of the technical solution of this application and may not be used for other purposes.
[0075] The following examples used GraphPad Prism statistical software to process the data. The experimental results are expressed as mean ± standard deviation. Two-way ANOVA was used, and different lowercase letters represent that the samples have significant differences under the same treatment conditions (p < 0.05).
[0076] Example 1: Obtaining the TaPPR13 protein and its encoding gene Jinhe 991 seedlings, which have grown for about 2 weeks under normal conditions, were subjected to drought treatment for 2 hours, then flash-frozen with liquid nitrogen and stored at -80 ℃ for later use.
[0077] Total RNA was extracted from wheat leaves using the Trizol method (TianGen), and first-strand cDNA was synthesized using reverse transcriptase XL (AMV). ds cDNA was synthesized using the SMART method, and the PCR products were detected by 1.0% agarose gel electrophoresis.
[0078] The DNA molecule shown in SEQ ID No. 2 was obtained by 5' RACE and 3' RACE methods, and then ligated into a vector using the pEasyblunt kit to form the pEasyblunt-TaPPR13 plasmid. The DNA molecule shown in SEQ ID No. 2 encodes the protein shown in SEQ ID No. 1.
[0079] The plant stress resistance-related protein gene isolated and cloned from the wheat variety "Jinhe 991" was named TaPPR13 Gene. TaPPR13 The coding sequence (CDS) of the gene is SEQ ID No. 2, and the protein encoding the amino acid sequence is SEQ ID No. 1 is named TaPPR13 protein.
[0080] Example 2: Effects of TaPPR13 protein on wheat stress resistance I. Construction of Recombinant Expression Vectors 1. Using the plasmid (pEasyblunt-TaPPR13) obtained in Example 1 as a template, PCR amplification was performed using primer pairs composed of TaPPR13-110F and TaPPR13-110R to obtain PCR amplification products, and the PCR products were then recovered from the gel.
[0081] TaPPR13-110F:5'-CGACTCTAGAggatccATGGCCAAATGCTACTCCGAC-3'; TaPPR13-110R:5'-CGGTACCCGGggatccTCAGGTTTTCTCCTCCACGG-3'.
[0082] 2. Using restriction endonucleases BamH I digested the vector pWMB110 with enzyme I and recovered the vector backbone.
[0083] 3. The PCR product recovered in step 1 and the vector backbone from step 2 were ligated using In-Fusion technology to obtain the recombinant plasmid pWMB110-TaPPR13. After confirmation by the company's sequencing, the plasmid was extracted from the positive bacterial culture for later use.
[0084] The recombinant plasmid pWMB110-TaPPR13 is based on the vector pTF101. BamH A DNA molecule as shown in SEQ ID No. 2 was inserted between the I restriction sites. The recombinant plasmid pWMB110-TaPPR13 can express the protein with the amino acid sequence shown in SEQ ID No. 1.
[0085] II. Obtaining Genetically Modified Wheat 1. The recombinant plasmid pWMB110-TaPPR13 was introduced into Agrobacterium EHA105 to obtain Agrobacterium EHA105 / pWMB110-TaPPR13 containing the recombinant plasmid.
[0086] (1) Agrobacterium EHA105 / pWMB110-TaPPR13 containing recombinant plasmid was inoculated into YEP liquid medium and cultured at 28 ℃ and 3000 rpm for about 18 hours.
[0087] (2) Draw the bacterial culture obtained in step (1) into YEP solid medium (containing 50 μg / L rifampin and 50 μg / L kanamycin) and incubate at 28°C for about 2 days.
[0088] 2. After disinfecting wheat seeds (Fielder) with sodium hypochlorite for 15 minutes, cut off the immature embryos and then sow them evenly in sterilized callus growth medium and culture until callus formation.
[0089] 3. After completing step 2, the callus tissue was infected with Agrobacterium EHA105 (EHA105 / pWMB110-TaPPR13) containing the recombinant vector. After culture, the transformed tissue was obtained. TaPPR13 Genetically modified wheat (T0 generation genetically modified wheat).
[0090] 4. Harvesting wheat seeds and screening homozygous lines: DNA was extracted from T0 generation transgenic wheat plants, and PCR was used to verify transgenic positive plants (those containing the coding sequence SEQ ID NO.2). TaPPR13The detection principle is based on the specificity of the UBI promoter on the overexpression vector pWMB110. The UBI promoter is derived from maize and is not present in the genome of the recipient wheat. Therefore, the target band can be amplified in the DNA of transgenic wheat plants, but not in the DNA of recipient plants. The primer pairs (5' to 3') used for PCR verification were pWMB110ZTF: AACACTGGCAAGTTAGCAAT; and pWMB110ZTR: CCGTAATAAATAGACACCC. Plants that amplified 315bp were T0 generation transgenic positive plants.
[0091] T0 generation transgenic positive plants were self-pollinated to obtain T1 generation transgenic events, and T1 transgenic positive plants were screened using the same method as for T0 generation transgenic positive screening. Self-pollination and positive screening continued until stable T3 generation homozygous lines that could grow normally were obtained, which were named TaPPR13-OE1 and TaPPR13-OE2 lines, respectively.
[0092] III. Testing TaPPR13 Relative expression level of genes After completing step two, wheat leaves from T3 generation homozygous lines were collected, total RNA was extracted and reverse transcribed to obtain cDNA, and qRT-PCR was performed using the cDNA as a template. Actin Genes used as internal reference genes for detection TaPPR13 The relative expression level of genes.
[0093] Used for detection TaPPR13 The primers for the gene are as follows: TaPPR13-RTF: 5'-ATGGCCAAATGCTACTCCGACTG-3', TaPPR13-RTR: 5'-CTTCTTTGTCCGGCCGGAACTCGG-3'.
[0094] Used for detection Actin The primers for the gene are as follows: Actin-F: 5'-AGGAGAAGCTCGCTTACGTG-3', Actin-R: 5'-GGGCACCTGAACCTTTCTGA-3'.
[0095] The results showed that the transformation TaPPR13 In genetically modified wheat TaPPR13 The gene expression level was 4-6 times higher than that of wild-type (recipient control) wheat, and the difference was statistically significant. (Exogenous gene) TaPPR13 The gene has not only been successfully integrated into the wheat genome, but it can also be transcribed and expressed normally in transgenic wheat.
[0096] IV. Identification of drought resistance in wheat 1. Identification of drought resistance in transgenic wheat seedlings The transfer was identified TaPPR13 Drought resistance of genetically modified wheat under soil cultivation conditions during the seedling stage.
[0097] The strain to be tested was: the two-week-old transgenic strain obtained in step two. TaPPR13 T3 generation homozygous line ( TaPPR13 -OE1 strain, and TaPPR13 -OE2 strain wheat) and wild-type wheat (WT, Fielder).
[0098] On the left and right sides of the same flowerpot, 20 seeds of the recipient control wheat Fielder and 20 seeds of transgenic wheat were sown respectively. TaPPR13 -OE1 and TaPPR13 -OE2. A total of 12 pots were planted and managed normally until the seedlings reached the three-leaf stage. After the seedlings reached the three-leaf stage, drought resistance experiments were conducted. The experiment was divided into two groups: a drought stress group (DT) and a normal group (CK), with 6 pots randomly selected from each group.
[0099] After the seedlings reached the three-leaf stage, the drought stress group (DT) was subjected to drought treatment for 10 consecutive days without watering until the leaves showed slight wilting. Then, the drought stress was continued for another 3 days. Phenotyps were observed and various physiological indicators such as survival rate and chlorophyll content were measured.
[0100] Normal group (CK): with normal watering and management, and its survival rate and chlorophyll content and other physiological indicators were measured simultaneously with the drought stress group.
[0101] The drought-stressed group and the normal group were identical in all experimental conditions except for the amount of water applied. Three replicate experiments were conducted, with 15 plants of each test line observed and statistically analyzed in each replicate. Survival rate and chlorophyll content, among other physiological indicators, were also measured.
[0102] Determination of chlorophyll content in samples: 0.2 g of leaves from both the treated and untreated transgenic and control wheat plants (three replicates per sample) were taken from each plant at the same time and growth period. The leaves were cut into strips approximately 1 cm long and placed in corresponding 10 mL centrifuge tubes. 5 mL of 80% acetone was added to each tube, and the tubes were incubated overnight at room temperature in the dark. The chlorophyll content was then measured using a microplate reader.
[0103] The determination of malondialdehyde (MDA) in the sample should be performed according to the specific operating procedures of the kit: Malondialdehyde (MDA) content detection kit (Beijing Solarbio Science & Technology Co., Ltd., Beijing). Hydrogen peroxide (H2O2) content detection kit (Suzhou Keming Biotechnology Co., Ltd., Suzhou), superoxide anion (O2) ·- Content assay kit (Suzhou Keming Biotechnology Co., Ltd., Suzhou), Catalase (CAT) activity assay kit (Suzhou Keming Biotechnology Co., Ltd., Suzhou), and Peroxidase (POD) activity assay kit (Suzhou Keming Biotechnology Co., Ltd., Suzhou). The results are as follows Figure 1 As shown, Figure 1 WT represents the recipient control wild-type Fielder wheat; OE1 represents... TaPPR13 -OE1 wheat strain; OE2 indicates TaPPR13 -OE2 strain wheat: Figure 1 Photograph A shows the phenotypic images of transgenic wheat seedlings and the recipient control under normal conditions and drought treatment, respectively. Figure 1 (A)
[0104] Figure 1 D represents the survival rates of transgenic wheat seedlings and the recipient control under normal conditions and drought treatment, respectively. Figure 1 (D).
[0105] Figure 1 The results of the study in EJ represent the determination of various physiological indicators of transgenic wheat seedlings and recipient control seedlings under normal conditions and drought treatment.
[0106] The results showed that after drought stress, the recipient control group exhibited severe wilting, while the transformed group... TaPPR13 The genetically modified wheat plants grew significantly better than the control group. TaPPR13 The survival rate of the genetically modified wheat plants was significantly higher than that of the control, and their physiological indicators under drought treatment were significantly better than those of the recipient control. These results further indicate that... TaPPR13 Overexpression of genes can significantly improve drought tolerance in plants.
[0107] 2. Identification of drought resistance during the grain-filling stage of transgenic wheat To further verify the overexpression under soil cultivation TaPPR13 Whether genes can improve the yield performance of transgenic wheat was determined in a field setting. TaPPR13 Drought tolerance of genetically modified wheat during the grain-filling stage under field cultivation conditions. Following a randomized block design, three replicates were established, with 9 rows of wheat planted in separate rows, each with 35 plants, a row spacing of 30 cm, and a plant spacing of 5.7 cm. The plant lines to be tested were: the genetically modified wheat obtained in step two. TaPPR13 Genetically modified wheat plants ( TaPPR13 -OE1 strain and TaPPR13 -OE2 wheat), wild-type wheat (WT, Fielder).
[0108] Specific treatment method: Under field cultivation conditions, transgenic wheat and recipient control with the same number of grains were sown according to the above randomized block design. After the seedlings grew to the grain-filling stage, normal growth treatment and drought stress treatment were respectively applied.
[0109] Drought treatment (DT): Wheat is irrigated once during the grain-filling stage, and then irrigated again. It is also protected from rain by using a rain shelter for 3 consecutive weeks. After harvest, various yield indicators are measured.
[0110] Normal conditions (CK): Wheat was irrigated once during the grain-filling stage, the same as the drought treatment group, and grew normally for 3 weeks, during which it was irrigated twice to ensure that the relative soil moisture content was above 65%. After harvest, various yield indicators were measured.
[0111] Three replicate experiments were set up, with phenotypic observations and statistics performed on 10 representative plants of each test line in each replicate experiment. Simultaneously, the number of grains per ear, grain length, grain width, and thousand-grain weight were recorded. After harvesting all plants, the plot yield was calculated by weighing.
[0112] The results are as follows Figure 2 As shown, Figure 2 WT represents the recipient control wild-type wheat; OE1 represents... TaPPR13 -OE1 wheat strain; OE2 indicates TaPPR13 -OE2 strain wheat. Among them: Figure 2 Photographs A and B show the phenotypic characteristics of transgenic wheat and the recipient control under normal conditions and drought treatment, respectively.
[0113] Figure 2 In Figure C, the yields of transgenic wheat and the recipient control plots were measured under normal conditions and drought treatment, respectively.
[0114] Figure 2 Photograph D shows the phenotypic characteristics of grain traits in transgenic wheat and the recipient control under normal conditions and drought treatment. Figure 2 E represents the results of grain number measurement in transgenic wheat and recipient control under normal conditions and drought treatment.
[0115] Figure 2 The results of grain length measurements for transgenic wheat and the recipient control under normal conditions and drought treatment are shown in Figure F.
[0116] Figure 2 G represents the grain width measurements of transgenic wheat and the recipient control under normal conditions and drought treatment.
[0117] Figure 2 In the figure, H represents the results of the thousand-grain weight determination of transgenic wheat and the recipient control under normal conditions and drought treatment.
[0118] The results showed that after three weeks of drought treatment, the conversion... TaPPR13 The grain traits of the genetically modified wheat plants were superior to those of the control. In the drought-treated plots, the yield, number of grains per ear, grain length and width, and thousand-grain weight were all significantly higher than those of the recipient control.
[0119] Therefore, overexpression TaPPR13 Experimental results on wheat containing the TaPPR13 protein and its encoding gene, as described in this application, all indicate that... TaPPR13 It can regulate plant stress resistance (such as drought tolerance) by increasing the content and / or activity of TaPPR13 protein in the target plant (such as through overexpression). TaPPR13 Genes can significantly improve the stress resistance of target plants.
[0120] The present application has been described in detail above. Those skilled in the art will recognize that the present application can be implemented in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments are given in this application, it should be understood that further modifications can be made to the present application. In summary, in accordance with the principles of this application, this application is intended to include any changes, uses, or improvements to the present application, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.
Claims
1. The use of the TaPPR13 protein, or a substance that regulates the expression of the gene encoding the TaPPR13 protein, or a substance that regulates the content of the TaPPR13 protein, in any of the following: A1) Its application in regulating plant drought resistance; A2) Application in the preparation of products that regulate plant drought resistance; A3) Applications in plant breeding or plant-assisted breeding; A4) Application in the preparation of plant breeding or plant-assisted breeding products; The TaPPR13 protein is any of the following: a1) The amino acid sequence is that of the protein shown in SEQ ID No. 1; a2) Proteins obtained by substituting, deleting and / or adding amino acids to the amino acid sequence of the protein shown in a1), which have more than 90% identity with the amino acid sequence shown in a1) and are related to plant drought resistance. a3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of a1) or a2).
2. The application according to claim 1, characterized in that: The substance that regulates the expression of the protein-coding gene or the substance that regulates the content of the protein is a biological material, and the biological material is any one of the following: B1) The nucleic acid molecule encoding the TaPPR13 protein mentioned above; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3); B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3); B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3); B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2), or transgenic plant organs containing the recombinant vector described in B3).
3. The application according to claim 2, characterized in that: B1) The nucleic acid molecule described in g1) or g2) is as follows: g1) The coding sequence of the coding strand is the DNA molecule of SEQ ID No. 2; g2) is a DNA molecule that has more than 80% identity with the DNA molecule described in g1) and regulates plant drought resistance.
4. A method for regulating drought resistance in plants, the method comprising regulating drought resistance in recipient plants by regulating the expression level of the gene encoding the TaPPR13 protein and / or the content of the TaPPR13 protein in the recipient plant.
5. The method according to claim 4, characterized in that: The method improves the drought resistance of recipient plants by increasing the expression level of the gene encoding TaPPR13 protein and / or the content of TaPPR13 protein.
6. The method according to claim 5, characterized in that: The expression level of the gene encoding the TaPPR13 protein and / or the content of the TaPPR13 protein in the recipient plant are increased by introducing the gene encoding the TaPPR13 protein into the recipient plant.
7. The method according to claim 6, characterized in that: The encoding gene is as described in g1) or g2) below: g1) The coding sequence of the coding strand is the DNA molecule of SEQ ID No. 2; g2) is a DNA molecule that has more than 80% identity with the DNA molecule described in g1) and regulates plant drought resistance.
8. The method according to any one of claims 4-7, characterized in that: The plant in question is a monocotyledonous plant.
9. A method for cultivating target plants with improved drought resistance, characterized in that: The method obtains a target plant with higher drought resistance than the recipient plant by increasing the expression level of the gene encoding the TaPPR13 protein and / or the content of the TaPPR13 protein in the recipient plant.
10. The TaPPR13 protein of claim 1 and / or the biomaterial of claim 2 or 3.