Streptomyces spinosisporus strain LZ-337 and application thereof

By using a microbial control agent prepared from Streptomyces nidus LZ-337, the problems of pathogen resistance and environmental pollution caused by chemical pesticides have been solved, achieving efficient biological control of rice sheath blight and protecting the ecological environment.

CN122104494APending Publication Date: 2026-05-29SHENYANG AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610171105.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-06
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing chemical pesticides have led to increased resistance in pathogens during the control of rice sheath blight, and the high cost of biological control agents has limited their large-scale promotion, causing serious environmental pollution. There is a lack of efficient, environmentally friendly and cost-effective microbial biocontrol agents.

Method used

Streptomyces clavifer (CGMCC No. 36504) LZ-337 was used as a microbial agent to antagonize rice sheath blight, rice blast fungus, and rice false smut fungus through fermentation broth and crude dichloromethane extract. By utilizing its complex life cycle and secondary metabolite synthesis capabilities, a non-toxic and harmless biological control agent was prepared.

Benefits of technology

It effectively inhibits the growth and reproduction of rice sheath blight pathogen, reduces rice yield loss, protects the ecological environment, and achieves a control efficacy of 80.35%. It also reduces the pollution of soil and water sources by chemical pesticides, meeting the requirements of green agriculture.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104494A_ABST
    Figure CN122104494A_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of agricultural biological control, and particularly relates to a streptomyces spinogriseus LZ-337 and application thereof. Streptomyces clavifer The classification name of the streptomyces spinogriseus LZ-337 is The preservation number is CGMCC No. 36504, the preservation center is Chinese General Microbiological Culture Collection Center, the preservation date is November 5, 2025, and the preservation address is No. 1, Yihuangyuan 3rd, Beichen West Road, Chaoyang District, Beijing, China. The streptomyces spinogriseus LZ-337 can be used for preventing and treating rice sheath blight, and also has certain antagonistic effect on rice blast fungus and rice smut fungus. The field test result shows that the fermentation liquor of the streptomyces spinogriseus LZ-337 has a prevention effect of 80.35% on rice sheath blight, effectively reduces the yield reduction of rice caused by diseases, and provides strong support for guaranteeing food security.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of agricultural biological control technology, and more specifically, to a Streptomyces thuringiensis LZ-337 and its applications. Background Technology

[0002] Rice sheath blight is caused by Rhizoctonia solani (… Rhizoctonia solani Rice sheath blight, a major disease caused by *Trichoderma*, results in a global annual rice yield reduction of approximately 10%–15% (FAO, 2021). Currently, chemical pesticides (such as thifluzamide) are the mainstream control method, but long-term use has led to a significant increase in pathogen resistance. Although specific data on pesticide resistance in *Trichoderma* in Liaoning Province is unavailable in recent years, the resistance index to thifluzamide in Jiangsu Province reached 8.2 times in 2022, forcing farmers to increase pesticide use and further exacerbating environmental pollution. Regarding the cost of biological control, *Trichoderma* (… Trichoderma Trichoderma (spp.) formulations have attracted attention due to their environmental friendliness, but the cost of commercially available Trichoderma products is as high as 15 yuan per mu, twice that of chemical pesticides, limiting their large-scale promotion. Therefore, developing a microbial biocontrol agent that is highly efficient, environmentally adaptable, and cost-effective has become a key requirement for the green control of rice sheath blight. Summary of the Invention

[0003] To address the above-mentioned problems, this invention provides a Streptomyces ventricosa LZ-337 and its applications.

[0004] To achieve the above objectives, the present invention is implemented through the following technical solution: In a first aspect, the present invention provides a Streptomyces ventricosa LZ-337, whose classification name is... Streptomyces clavifer The accession number is CGMCC No.36504. It is deposited at the China General Microbiological Culture Collection Center on November 5, 2025. The deposit address is Institute of Microbiology, Chinese Academy of Sciences, No.3, No.1 Beichen West Road, Chaoyang District, Beijing.

[0005] In a second aspect, the present invention provides a microbial inoculant containing the aforementioned Streptomyces ventricosa LZ-337.

[0006] In a third aspect, the present invention provides an application of the aforementioned Streptomyces ventricosa LZ-337.

[0007] In the preferred formulation, Streptomyces thuringiensis LZ-337 is used to control rice sheath blight pathogen ( Rhizoctonia solani Rice blast fungus ( Pyricularia oryzae ) and rice false smut ( Ustilaginoidea virens One or more of the following.

[0008] In the preferred formulation, Streptomyces thuringiensis LZ-337 is used to control rice sheath blight pathogen ( Rhizoctonia solani ).

[0009] Beneficial effects of the present invention 1. The long-term use of traditional chemical pesticides has led to a continuous increase in pesticide resistance in rice sheath blight pathogens, resulting in a gradual decline in control efficacy. The strain of this invention, however, has not been reported in the field of biological control of rice sheath blight and can inhibit the growth and reproduction of the pathogen through multiple pathways. Experimental data show that, in plate culture, strain LZ-337 not only has a good antagonistic effect against rice sheath blight pathogens but also exhibits certain antagonistic effects against rice blast pathogens and rice false smut pathogens. In the field, the fermentation broth of this strain showed a control efficacy of 80.35% against rice sheath blight, effectively reducing yield losses caused by the disease and providing strong support for ensuring food security.

[0010] 2. The extensive use of chemical pesticides has caused serious pollution to soil, water sources, and the ecological environment, and may also harm human health through the food chain. The strain LZ-337 of this invention is derived from sclerotia of *Rhizoctonia solani*, the rice sheath blight pathogen, retrieved from paddy field debris. It is non-toxic and harmless, and will not adversely affect soil microbial communities or aquatic organisms. During use, it will not produce chemical residues, meeting the requirements of green agriculture and sustainable development, and helping to protect the ecological environment and promote the ecological balance of agriculture.

[0011] 3. Strain LZ-337 has a complex life cycle and a strong ability to synthesize secondary metabolites, and strain LZ-337 may have a wider range of agricultural applications. Attached Figure Description

[0012] Figure 1 This is a three-point confrontation diagram of strain LZ-337 against three rice pathogens; a: rice sheath blight fungus; b: rice blast fungus; c: rice false smut fungus.

[0013] Figure 2 The experiment showed the inhibitory effect of sterile fermentation broth of strain LZ-337 on the mycelial growth rate of rice sheath blight pathogen; Note: from left to right, the results are CK, 10% sterile fermentation broth of strain LZ-337, 20% sterile fermentation broth of strain LZ-337, and 30% sterile fermentation broth of strain LZ-337.

[0014] Figure 3 The experiment showed the inhibitory effect of the crude dichloromethane extract of strain LZ-337 on the mycelial growth rate of rice sheath blight pathogen. Figure 4 These are the TLC results of the crude dichloromethane extract from strain LZ-337.

[0015] Figure 5The inhibitory effects of strain LZ-337 on different pathogens are shown in the figures: a: CK; b: LZ-337; from left to right, the pathogens are: tomato gray mold, corn stalk rot, cucumber target spot, Fusarium oxysporum, and cucumber anthracnose.

[0016] Figure 6 This is a morphological diagram of strain LZ-337; Figure 7 This is a physiological and biochemical phenotype diagram of strain LZ-337; Figure 8 It is the 16S rDNA developmental tree of strain LZ-337.

[0017] Figure 9 The control effect of strain LZ-337 on rice sheath blight; a: CK; b: treatment group. Detailed Implementation

[0018] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention.

[0019] Unless otherwise stated, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Unless otherwise specified, the experimental methods used in the examples are conventional methods. Where specific conditions are not specified in the examples, they should be performed under conventional conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0020] Test materials 1. Test sclerotia Collected from rice paddies in Liaozhong District, Shenyang City, Liaoning Province.

[0021] 2. Test strains 2.1 Test pathogens Rice blast fungus ( Pyricularia oryzae Rice sheath blight pathogen ( Rhizoctonia solani Y-36, rice false smut ( Ustilaginoidea virens ), peanut white mold pathogen ( Sclerotium rolfsii ), potato early blight pathogen ( Alternaria solani ), corn stalk rot fungus ( Fusarium graminearum Tomato late blight ( Phytophthora infestans ), Corn Curvularia leaf spot pathogen ( Curvularia lunata All of these are preserved by the Rice Disease Research Laboratory of Shenyang Agricultural University.

[0022] 2.2 Tested biocontrol bacteria Streptomyces ventricosa LZ-337, classification name is Streptomyces clavifer It belongs to the genus Streptomyces and was deposited on November 5, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 36504. The deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

[0023] 3. Test culture medium The main culture media used in the experiment are shown in Table 1.

[0024] Table 1 Culture media and formulations culture medium formula PDA medium 1000mL distilled water, 200g potatoes, 20g glucose, 15g agar Gao's No. 1 culture medium <![CDATA[1000 mL of distilled water, 20 g of soluble starch, 1 g of potassium nitrate, 0.5 g of sodium chloride, 0.5 g of MgSO4·7H2O, 0.5 g of dipotassium hydrogen phosphate, 5 mL of a 2 mg / mL stock solution (2 g of FeSO4·7H2O dissolved in 100 mL of water), 20 g of agar powder]]> ISP2 liquid culture medium 1000mL distilled water, 10g malt extract, 4g yeast extract, 4g glucose NB culture medium 1000mL distilled water, 5g beef extract, 10g peptone Potato dextrose agar (PDA) medium is used for the preservation and confrontation culture of tested pathogens such as rice sheath blight, rice blast, rice bakanae disease, peanut white mold, potato early blight, rice anthracnose, maize stalk rot, tomato late blight, and maize curvularia leaf spot, as well as for the preparation of fermentation broth for biocontrol strains; Gao's No. 1 medium is used for the screening, purification, and preservation of strains. In addition, the culture media used in this invention include protease activity assay medium, cellulase activity assay medium, and a series of culture media for physiological and biochemical identification.

[0025] 4. Test primers The primers used for 16S rDNA genome sequencing of strain LZ-337 are shown in Table 2 (Reference: Relman DA, 1993). The primers used for sequencing were completed by Sangon Biotech (Shanghai) Co., Ltd.

[0026] Table 2 16S rDNA genome sequencing primers Primer name Primer sequence (5'-3') Serial Number Forward primer 27F AGAGTTTGATCCTGGCTCAG SEQ ID NO.1 Reverse primer 1492R GGTTACCTTGTTACGACTT SEQ ID NO.2 5. Test instruments The instruments used in the experiment are shown in Table 3.

[0027] Table 3 Basic Information of the Test Instruments Test instruments Manufacturer model PCR instrument Hangzhou Borui Technology Co., Ltd. TC-96 / G / H(b)C high-speed centrifuge Changsha High-tech Industrial Development Zone Xiangyi Centrifuge Instrument Co., Ltd. TGL-16 Gel Imaging Fuyue Biotechnology (Shanghai) Co., Ltd. UVPGEAlpha Three-hole electric heating constant temperature water bath Shanghai Yiheng Scientific Instruments Co., Ltd. DK-8D Electrophoresis apparatus Beijing Liuyi Biotechnology Co., Ltd. DYY-7C Clean bench Beijing Yatai Kelon Instrument Technology Co., Ltd. YT-CJ-2DH Vertical automatic pressure steam sterilizer Zhiwei (Xiamen) Instruments Co., Ltd. FD80A Electronic balance Kunshan Youkeweite Electronic Technology Co., Ltd. CN-LQC3003 pipette Dalong Xingchuang Experimental Instruments Co., Ltd. - Shaking incubator Shanghai Minquan Instrument Co., Ltd. MQL-61R SLR camera Nikon Imaging (China) Co., Ltd. D7500 Medical low temperature incubator Qingdao Haier Biomedical Co., Ltd. DW-25L262 Micro-wave oven Guangdong Midea Kitchen Appliances Manufacturing Co., Ltd. EM720KG1-PW microscope Nikon Precision Machinery (Shanghai) Co., Ltd. Nikon ECLIPSE 80i pH meter Mettler Toledo Instruments (Shanghai) Co., Ltd. FE28 Thermostatic oscillator Shanghai Yiheng Scientific Instruments Co., Ltd. HZQ-300AC Electric constant temperature drying oven Huai'an Longyue Experimental Instrument Equipment Co., Ltd. LD0-101-1 DNA extraction kit Sangon Biotech (Shanghai) Co., Ltd. Ezup Column-Based Bacterial Genomic DNA Extraction Kit Example 1

[0028] 1. Isolation and purification of bacterial strains Sclerotia of *Rhizoctonia solani* collected from rice paddies in Liaozhong District, Shenyang City, were isolated using the dilution plating method and the streak plating method. Diluents were prepared from the sclerotia samples to a concentration of 10⁻⁶. -3 10 -4 and 10 -5100 μL of each concentration dilution was spread onto Gao's No. 1 agar plates, with each treatment repeated three times. The isolation media were incubated at 28°C for 4–8 weeks. Afterward, the types and quantities of strains on the isolation media were counted, and different strains from various regions were selected based on single colony morphology. These strains were then purified by streaking on Gao's No. 1 agar plates and incubated at 28°C for subsequent use. A total of 5 plates of strains were isolated, including 2 bacterial strains and 3 actinomycete strains.

[0029] 2. Screening of biocontrol bacterial strains This invention uses the plate confrontation method to initially screen five isolated strains, and selects strains with good inhibitory effects against rice sheath blight pathogens. Then, the strains initially screened are further screened using the mycelial growth rate method. The inhibitory effect of the fermentation broth prepared from the strains obtained in the initial screening on rice sheath blight is measured, and strains with better inhibitory effects are screened for identification.

[0030] 2.1 Test Methods 1) Activation of pathogens The rice sheath blight pathogen Y-36 (Rhizoctonia solani) and rice blast pathogen, which were preserved in the laboratory, were activated by inoculating them on PDA medium, while the rice false smut pathogen was activated by inoculating them on PSA medium. The samples were then incubated at 28°C for later use.

[0031] 2) Flat Standoff Method Rice sheath blight pathogen ( R. solani Using α as the target, the plate confrontation method was used to conduct confrontation culture on 5 isolated bacterial and actinomycete strains. 5 mm mycelial discs of the isolated and purified bacterial and actinomycete strains were placed symmetrically at three points 15 mm from the center of the culture medium. After 1 day and 3 days of culture, activated *Rhizoctonia solani* mycelial discs were inoculated into the center of the PDA medium. Each treatment was repeated three times. After incubation at 28℃ for 1-2 days, the inhibition zone was observed, and strains with good antibacterial effects were selected for identification.

[0032] At the same time, referring to the above experimental methods, rice blast fungus ( Pyricularia oryzae ) and rice false smut ( Ustilaginoidea virens Using α as the target, the antibacterial effect of the five isolated strains was tested.

[0033] 3) Mycelial growth rate method Biocontrol strains with good antibacterial effects were screened and inoculated into ISP2 medium. After 7 days of shaking culture at 180 rpm in a 28℃ incubator, the culture was centrifuged at 12000 rpm for 15 min. The supernatant was collected and filtered through a sterile filter (Φ=0.22μm) to obtain the sterile fermentation filtrate of the biocontrol strain. The sterile fermentation filtrate was thoroughly mixed with PDA medium at ratios of 1:9, 2:8, and 3:7 to prepare 10%, 20%, and 30% plates containing the fermentation filtrate. Two-day activated mycelial cakes of the test strain Y-36 were inoculated into the center of PDA medium, with sterile water as a control. Each treatment was repeated three times. After incubation at 28℃ for 2–8 days, the colony diameter was measured, and the mycelial growth inhibition rate was calculated.

[0034] (1) (2) 4) Preparation of crude dichloromethane extract from biocontrol strains A method for preparing crude dichloromethane extract from biocontrol bacteria strains includes the following steps: Cultivation of primary seed culture: Add 5 mL of ISP2 liquid culture medium to a 25 mL test tube and sterilize at 121 °C for 30 min. In a sterile operating table, use a pipette to inoculate the strain into the test tube and incubate at 28 °C with shaking at 180 rpm for 48 h.

[0035] Secondary seed culture cultivation: Add 100 mL of ISP2 liquid medium to a 250 mL Erlenmeyer flask and sterilize at 121 °C for 30 min. In a sterile operating room, transfer the primary seed culture into the Erlenmeyer flask and incubate at 28 °C with shaking at 180 rpm for 7 days.

[0036] Preparation of fermentation broth: For actinomycetes, ISP2 liquid medium was used. 100 mL of this liquid medium and 4% XAD-16 macroporous adsorption resin were added to each 250 mL Erlenmeyer flask. After sterilization, the primary seed culture was transferred to the Erlenmeyer flask and cultured at 28℃ with shaking at 180 rpm for 7 days. For bacteria, NB medium was used, and the same method was used as for actinomycetes, culturing at 25℃ with shaking at 180 rpm for 7 days.

[0037] After the strain has finished fermenting, the mycelium and fermentation broth are filtered out, the resin is washed with water, the resins are combined, and dried at a constant temperature of 30℃.

[0038] The dried resin was placed in a 250 mL separatory funnel, and methanol was added until it covered the resin. The mixture was shaken and allowed to stand for 3 hours. This process was repeated four times. The methanol eluent was collected, concentrated by rotation, and the crude methanol extract was weighed and set aside. The crude methanol extract was then subjected to four extractions using a dichloromethane-distilled water-methanol system (V0.05). 二氯甲烷 V 蒸馏水 V 甲醇 =2:1:1, V总 =1200mL), combined with dichloromethane eluent, concentrated under reduced pressure to obtain crude dichloromethane extract, weighed and recorded (Anran, 2022).

[0039] 5) Thin-layer chromatography detection of crude extract The types and polarities of compounds in the crude dichloromethane extract were preliminarily determined. Thin-layer chromatography results were observed using staining and fluorescence methods to determine the required eluent system and ratio for silica gel column chromatography.

[0040] The operating steps are as follows: Dissolve the crude dichloromethane extract completely in a small amount of dichloromethane-methanol mixed solution. Cut a silica gel plate to a suitable size. Draw a straight line 1 cm from the bottom of the silica gel plate as a baseline. Mark the corresponding sample spots on the baseline. When dealing with multiple samples, the spacing between the spots should be approximately 0.8–1 cm. Label each sample spot with its name. Depending on the sample concentration, use a capillary tube to apply an appropriate amount of sample, applying small amounts multiple times to avoid affecting the chromatographic effect due to sample diffusion. After spotting, allow the solvent on the silica gel plate to evaporate completely before proceeding with chromatography.

[0041] In a clean, dry glass chromatography tank, prepare developing solvents of dichloromethane:methanol = 95:5. Place the spotted silica gel plate into the chromatography tank and allow it to stand in a sealed container. When the solvent line moves to 1 cm from the top of the silica gel plate, remove it, blow dry the organic reagents on the silica gel plate, and observe the UV absorption of the silica gel plate at different wavelengths. Stain with concentrated sulfuric acid vanillin staining agent, and then heat the silica gel plate with a hair dryer until the solvent line shows obvious color. Measure the relative migration of each colored spot and calculate the relative migration rate. Analyze the abundance of compounds in the crude extract using thin-layer chromatography to screen for target bacterial strains.

[0042] The system and ratio of eluent used in primary silica gel column chromatography were determined based on the results of thin-layer chromatography.

[0043] (3) The antibacterial activity of crude dichloromethane extract of the biocontrol strain against rice sheath blight was determined by the mycelial growth rate method. A plate containing 100 μg / mL of crude dichloromethane extract of the biocontrol strain was prepared, and the inhibitory effect of crude dichloromethane extract on rice sheath blight was determined.

[0044] 2.2 Test Results A strain with good inhibitory effect against *Rhizoctonia solani* was obtained by screening using the plate confrontation method and mycelial growth rate method. This strain is designated LZ-337. The plate confrontation culture results of this strain are shown in Table 4. Figure 1 As shown, the test results of the mycelial growth rate method are as follows: Figure 2 As shown.

[0045] Table 4. Antibacterial effects of strain LZ-337 against three different rice pathogens.

[0046] like Figure 1 As shown in Table 4, the plate confrontation results indicate that strain LZ-337 is effective against rice sheath blight pathogen (… R. solani The inhibition zone diameter of the strain was 33.97±1.32 mm, indicating a good inhibitory effect on rice sheath blight pathogen. Furthermore, this strain showed good inhibition against rice blast pathogen (…). Pyricularia oryzae ) and rice false smut ( Ustilaginoidea virens It also has a certain inhibitory effect, with inhibition zone diameters of 29.13±1.05mm and 28.44±0.94mm, respectively.

[0047] Table 5. Inhibitory effect of biocontrol bacteria fermentation broth on rice sheath blight pathogen.

[0048] like Figure 2 As shown in Table 5, the mycelial growth rate results indicate that the fermentation broth of strain LZ-337 has an inhibitory effect on rice sheath blight pathogens, with the 30% fermentation broth of strain LZ-337 achieving an inhibition rate of 71.44%.

[0049] like Figure 3 As shown, liquid fermentation was carried out using ISP2 liquid medium, and adsorption was performed using macroporous adsorption resin. Crude fermentation extracts of the strains were obtained by methanol extraction and dichloromethane extraction. The antibacterial activity of the crude dichloromethane extracts of the actinomycete strains with good antibacterial effects against *Rhizoctonia solani* was determined using the mycelial growth rate method. Further screening was performed. The antibacterial activity results showed that at a concentration of 100 μg / mL, the drug-containing plates showed the following results: Figure 2 The strain LZ-337 showed an inhibition rate of 51.23% against rice sheath blight pathogen.

[0050] Thin-layer chromatography (TLC) was performed on the crude dichloromethane extract of strain LZ-337 using a dichloromethane:methanol ratio of 95:5. The TLC results are shown below. Figure 4 .

[0051] 3. Identification of the antibacterial spectrum of biocontrol strain LZ-337 After activating the tested pathogenic fungal strains and biocontrol strains, 5 mm diameter mycelial discs of the tested pathogenic fungal strains were placed in the center of PDA plates, and the biocontrol strains were placed at three symmetrical points 20 mm away. Each treatment was repeated three times. After incubating the plates at 28℃ for 2–7 days, the diameter of the inhibition zone was measured, and the mycelial growth rate was calculated. The results are shown in Table 6. Figure 5 As shown.

[0052] Table 6. Inhibition rate of strain LZ-337 against different pathogens

[0053] 4. Identification of biocontrol strain LZ-337 The experiment employed morphological characteristics, physiological and biochemical properties, and molecular biological identification, including the identification of biocontrol bacteria using 16S rDNA gene sequences.

[0054] 4.1 Morphological characteristics The biocontrol strain LZ-337, which showed inhibitory effects against rice blast fungus, rice sheath blight fungus, and rice false smut fungus, was streaked on Gao's No. 1 medium. After 5-7 days, the morphological characteristics of the biocontrol strain were described according to the "Handbook of Systematic Identification of Common Bacteria". Figure 6 As shown, the colonies of strain LZ-337 are round, with a flat surface, and are pale yellow. The spore masses are white and do not produce any soluble pigments.

[0055] 4.2 Physiological and Biochemical Characteristics Physiological and biochemical tests were performed on strain LZ-337 according to the *Handbook of Systematic Identification of Common Bacteria*. The results are as follows: Figure 7 As shown in Table 7, strain LZ-337 was positive in starch hydrolysis test, cellulase activity test, motility test and citrate utilization test, and negative in methyl red test. It can ferment glucose, but cannot ferment sucrose and mannitol.

[0056] Table 7. Results of physiological and biochemical characteristics determination of strain LZ-337

[0057] Note: "+" indicates a positive reaction or that the plant can grow and be utilized; "-" indicates a negative reaction or that the plant cannot grow and be utilized.

[0058] 4.3 Molecular biological characteristics The extraction of 16S rDNA genomic DNA from strain LZ-337 was performed according to the kit instructions. Molecular identification of the biocontrol strain LZ-337 was performed using universal primers 27F / 1492R for bacterial 16S rDNA gene analysis. The PCR reaction system and amplification conditions are as follows: The PCR reaction system for 16S rDNA is shown in Table 8.

[0059] Table 8. PCR reaction system for 16S rDNA of strain LZ-337

[0060] The amplification conditions for 16S rDNA are shown in Table 9 below.

[0061] Table 9. PCR reaction conditions for 16S rDNA of strain LZ-337

[0062] After the PCR amplification was completed, the PCR products were spotted onto a 1% agarose gel containing Goldview type I nucleic acid staining agent and electrophoretically detected for 26 min (200V). The PCR products were then sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.

[0063] After obtaining the sequencing results of the PCR products, the 16S rDNA amplification sequences of the screened biocontrol strains were aligned to NCBI using BLAST. A phylogenetic tree was then constructed using MEGA7 software and the Neighbor-Joining method with the sequenced sequences and strains exhibiting similar homology.

[0064] The 16S rDNA amplification sequence of the screened biocontrol strain LZ-337 was compared using BLAST on NCBI. A phylogenetic tree was constructed using MEGA7 software. Combined with the physiological and biochemical identification results and morphological characteristics analysis of the biocontrol strain, strain LZ-337 was compared with Streptomyces ventricosa. Streptomyces clavifer The similarity was the highest, reaching 99%.

[0065] The sequencing splice sequence of the 16S rDNA of strain LZ-337 is as follows: Example 2: Field trial of biocontrol bacteria for the control of rice sheath blight The biocontrol strain LZ-337, selected for its good antibacterial effect, was inoculated into ISP2 liquid medium and cultured at 28℃ with shaking at 180 rpm for 7 days. After centrifugation at 12000 rpm for 15 minutes, the supernatant was filtered through a sterile filter (Φ=0.22μm) to obtain the sterile fermentation filtrate of biocontrol strain LZ-337. Field inoculation of rice sheath blight pathogens was performed using the toothpick method. Sterilized toothpicks (approximately 1 cm long) were evenly spread on PDA medium. Two-day activated rice sheath blight pathogen Y-36 mycelial cakes were inoculated into the center of the PDA medium and cultured at 28℃ for 3 days. During inoculation, the toothpicks were inserted from top to bottom into the leaf sheath of the third leaf from the top of the tillering stage of the rice plant using tweezers. Protective treatment: 24 hours after spraying the sterile fermentation filtrate of biocontrol strain LZ-337, the inoculated toothpicks were inoculated. Treatment: 24 hours after inoculation with infected toothpicks, spray with sterile fermentation filtrate of biocontrol strain LZ-337. Control group (CK): 24 hours after spraying with ISP2 medium, inoculated with infected toothpicks. Protective treatment: The control agent was 20% jinggangmycin soluble powder. 15 rice plants were planted in each plot, with 3 replicates per treatment. Each group was sprayed with 20-30 mL of the solution. The incidence of rice sheath blight was investigated 15 days after application, and the disease index and control efficacy were calculated. The grading standard for rice sheath blight was based on the method of Pan Xuebiao et al. (1997). The formula for calculating control efficacy is as follows: (4) (5) Two-year field efficacy trials of the fermentation filtrate of biocontrol strain LZ-337 showed that, in the field trials, the efficacy of the protective treatment was 66.57%, slightly lower than that of jinggangmycin; in the therapeutic treatment, the efficacy of strain LZ-337 was 74.14%, with no significant difference from that of jinggangmycin.

[0066] Table 10 Field control efficacy of bacterial fermentation broth against rice sheath blight

[0067] Example 3: Application of aseptic fermentation broth of strain LZ-337 A field trial was conducted in a rice-growing area of ​​Tieling City, Liaoning Province, with two treatment groups: a treatment group treated with the aseptic fermentation broth of the biocontrol strain LZ-337 of this invention, and a blank control group (CK). Each treatment covered 1 acre, with three replicates. The pesticide was applied at the early stage of rice sheath blight. The fermentation broth treatment group was sprayed according to the application method provided in Example 2 above, while the blank control group received no pesticide. During the experiment, the growth of rice and the occurrence of disease were observed regularly. After the experiment, the incidence of rice sheath blight in each treatment group was statistically analyzed, and the results are as follows: Figure 9As shown in Table 11, the experimental data indicate that strain LZ-337 achieved a control efficacy index of 80.35% against rice sheath blight, which is close to that of jinggangmycin. The incidence rate was reduced by 11.24 percentage points compared to the control group, demonstrating significant control efficacy and effectively inhibiting the growth and reproduction of rice sheath blight pathogens.

[0068] Table 11 Field control efficacy of strain LZ-337 against rice sheath blight in Tieling area

[0069] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. A Streptomyces ventricosa LZ-337, characterized in that, Its category name is Streptomyces clavifer The accession number is CGMCC No.36504. It is deposited at the China General Microbiological Culture Collection Center on November 5, 2025. The deposit address is Institute of Microbiology, Chinese Academy of Sciences, No.3, No.1 Beichen West Road, Chaoyang District, Beijing.

2. A microbial inoculant containing Streptomyces ventricosa LZ-337 as described in claim 1.

3. The application of the Streptomyces ventricosa LZ-337 as described in claim 1.

4. The application of Streptomyces ventricosa LZ-337 according to claim 3, characterized in that, Streptomyces nidus LZ-337 is used to control rice sheath blight pathogen ( Rhizoctonia solani Rice blast fungus ( Pyricularia oryzae ) and rice false smut ( Ustilaginoidea virens One or more of the following.

5. The application of Streptomyces ventricosa LZ-337 according to claim 4, characterized in that, Streptomyces nidus LZ-337 is used to control rice sheath blight pathogen ( Rhizoctonia solani ).