A CHO cell, uses and methods of culturing viruses
By knocking out the BST-2 gene in CHO cells, the innate immune response was weakened, and the virus culture method was improved, thus solving the problem of low virus amplification efficiency in CHO cells and achieving efficient culture and isolation of influenza virus.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- STATION OF VIRUS PREVENTION & CONTROL CHINA DISEASES PREVENTION & CONTROL CENT
- Filing Date
- 2024-11-27
- Publication Date
- 2026-05-29
AI Technical Summary
Existing CHO cells exhibit low viral amplification efficiency during viral infection due to innate immune responses, making it difficult to efficiently culture and isolate viruses, especially influenza viruses.
By knocking out the bone marrow stromal cell antigen 2 (BST-2) gene in CHO cells, the innate immune response of cells is weakened, and the virus culture method is improved to increase the efficiency of virus amplification.
CHO cells with the BST-2 gene knocked out significantly improved the isolation efficiency and infection titer of influenza virus, increased the viral RNA copy number by 14 to 15 times, and significantly improved the culture effect.
Smart Images

Figure CN122104554A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of virus culture, specifically, it relates to a CHO cell, its uses, and a method for culturing viruses. Background Technology
[0002] A virus (biological virus) is a tiny, simple, non-cellular organism containing only one type of nucleic acid (DNA or RNA) that must replicate within living cells. Viral replication, transcription, and translation all occur within the host cell. Once inside a host cell, a virus utilizes the cell's resources and energy to perform its life activities, producing new generations of viruses according to the genetic information contained in its nucleic acid. The host infected by a virus suffers varying degrees of harm.
[0003] For example, the influenza virus is an RNA virus that causes influenza in humans and animals. Taxonomically, the influenza virus belongs to the Orthomyxoviridae family. It causes acute upper respiratory tract infections and spreads rapidly through the air, often resulting in periodic pandemics around the world. Influenza viruses can cause more severe symptoms, such as pneumonia or cardiopulmonary failure, in the elderly or children with weakened immune systems and in some patients with immune disorders.
[0004] In vitro isolation and culture of viruses are prerequisites for studying their infection and pathogenesis mechanisms, as well as the interaction between viruses and their hosts. Virus culture technology plays a crucial role in modern medicine and biotechnology, especially in vaccine development, virus research, and diagnostics.
[0005] Common virus culture methods include cell culture, chicken embryo culture, and animal model culture. Cell culture is one of the most common methods. However, to combat viral infection, humans and other mammals have evolved innate immune mechanisms. During viral infection of cells, the cell's immune mechanism plays a crucial role, prompting a strong antiviral immune response that inhibits viral infection and proliferation, ultimately leading to a significant reduction in viral amplification efficiency. Some viruses are difficult to isolate in vitro or have very low amplification titers. To improve viral amplification efficiency, researchers have conducted extensive studies on the virus itself, host cells, and culture conditions. For example:
[0006] Chinese patent application CN101260385A discloses a method for culturing influenza virus, using goat fetal kidney cells as the cell source for influenza virus culture. The influenza virus cultured in chicken embryos is pretreated with a cell freeze-thaw extract, which is a freeze-thaw extract of animal fibroblasts and epithelial-like differentiated cells of mouse embryonic stem cells. Chinese patent application CN102816732A provides an MDCK cell line adapted for serum-free suspension culture, named MDCK-ZL2012, and also provides a method for culturing influenza virus using the cell line. The method includes: (1) inoculating the MDCK cell line into a serum-free culture medium for suspension culture to obtain an MDCK cell suspension culture medium; (2) when the cell density in the MDCK cell suspension culture medium reaches 1.0 × 10⁻⁶ cells / mL... 6 ~7.0×10 7 When the virus concentration is 0.01-0.1, the influenza virus is inoculated at an MOI of 0.01-0.1; (3) the virus solution is cultured at 32°C for 3-4 days and the virus supernatant is harvested to obtain the influenza virus solution. Chinese patent application with publication number CN116731983A provides a method for continuous culture of canine parainfluenza virus in MDCK cells, including the following steps: Step 1: Continuously culture the domesticated MDCK suspension cells to a cell density of not less than 2.0×106 cells / ml, and inoculate canine parainfluenza virus at a dose of 1% to 3% v / v and add maintenance medium for culture, wherein the maintenance medium is CD MDCK SFM; Step 2: After culture for a preset time, harvest the virus solution for freezing and sample to determine cell viability, and then continue to add the maintenance medium for culture; repeat Step 2 until the cell viability is measured to be less than 90% and end the culture. In the aforementioned technology, improvements are made in terms of cell line and culture conditions in order to improve the amplification efficiency of the virus, but no improvements are made from the perspective of cell immunity.
[0007] Interferon production and its function are key mechanisms in the innate immune antiviral response. Interferon-induced host factors interfere with various steps of the viral replication cycle. Bone marrow stromal cell antigen 2 (BST-2) possesses unique molecular and structural features among these antiviral factors, enabling it to inhibit the budding of various enveloped viruses from the surface of infected cells, thereby preventing viral replication. BST-2 (also known as tetherin, CD317, or HM1.24) is a type II transmembrane protein highly expressed on plasmacytoid dendritic cells and induced by type I interferon, but it is also commonly found in various cell types and organs. It has a unique topological structure consisting of a short N-terminal cytoplasmic tail (CT), a single transmembrane region (TM), an extracellular domain (ED), and a second membrane anchor, a C-terminal glycosylphosphatidylinositol (GPI). Each of these structural features plays a crucial role in the antiviral activity of BST-2. For example, deletion of any membrane anchor (i.e., TM or GPI) results in BST2 failing to restrict viral budding. Deleting transmembrane domains or GPI anchors eliminates antiviral activity and retains BST-2 on the plasma membrane, suggesting that these anchors play a direct functional role in addition to proper positioning.
[0008] CHO cells (Chinese hamster ovary cell) are a transformed cell line derived from Chinese hamster ovary cells in 1957. CHO cells are currently the most commonly used non-human mammalian cell line in modern pharmaceutical companies for the research and production of biotherapeutic drugs (monoclonal antibodies, enzymes, kinases, and hormones, etc.). CHO cell lines exhibit high tolerance to viral infections and are capable of producing large quantities of recombinant proteins.
[0009] Modifying CHO cells to weaken the innate immune response induced by viral infection, thereby increasing the titer of amplified virus, has significant economic implications.
[0010] In view of this, the present invention is proposed. Summary of the Invention
[0011] The technical problem to be solved by the present invention is to overcome at least one of the shortcomings of the prior art and provide a CHO cell, its uses and a method for culturing viruses. The present invention utilizes CHO cells with the bone marrow stromal cell antigen 2 gene knocked out to culture and amplify viruses, thereby removing the restriction of virus budding by CHO cells and improving the efficiency of influenza virus isolation and the viral infection titer.
[0012] To solve the above-mentioned technical problems, the basic concept of the technical solution adopted by the present invention is as follows:
[0013] In a first aspect, the present invention provides a CHO cell in which the bone marrow stromal cell antigen 2 gene (BST-2) is inactivated.
[0014] This invention provides a bone marrow stromal cell antigen 2 (BST-2) inactivated CHO cell, which weakens the innate immune response induced by viral infection. Experiments have shown that, compared to wild-type CHO cells, BST-2 knockout CHO cells are more conducive to the culture and amplification of H1N1 influenza virus.
[0015] In a further embodiment, the inactivation is at least a partial deletion of the nucleic acid sequence of the bone marrow stromal cell antigen 2 gene;
[0016] Preferably, the inactivation refers to the complete deletion of the nucleic acid sequence of the bone marrow stromal cell antigen 2 gene.
[0017] Secondly, the present invention provides an application of CHO cells as described above in the culture and amplification of viruses;
[0018] Preferably, the virus is an influenza virus;
[0019] Preferably, the influenza virus is the H1N1 influenza virus.
[0020] The bone marrow stromal cell antigen 2 gene-inactivated CHO cells of the present invention can be used to culture and amplify influenza virus, which can improve the efficiency of influenza virus isolation and the viral infection titer.
[0021] Thirdly, the present invention provides a method for culturing a virus, comprising the following steps:
[0022] (1) Construct CHO cells with inactivated bone marrow stromal cell antigen 2 gene and perform sequencing identification;
[0023] (2) Detect the proliferation activity of CHO cells with inactivated bone marrow stromal cell antigen 2 gene;
[0024] (3) Culture CHO cells with inactivated bone marrow stromal cell antigen 2 gene and then infect them with the virus;
[0025] (4) Detect viral nucleic acid proliferation and viral titer.
[0026] Compared with culturing viruses using wild-type CHO cells, the method of culturing viruses in this invention utilizes CHO cells with inactivated bone marrow stromal cell antigen 2 (BST-2) to culture and amplify the virus. This results in an increased influenza virus RNA copy number, and the virus titer in the cell supernatant is 14 to 15 times that in wild-type cells, thus greatly promoting virus amplification and culture.
[0027] In this invention, the method for knocking out the bone marrow stromal cell antigen 2 gene in CHO cells can be any conventional method in the prior art, and there are no restrictions.
[0028] As an alternative, step (1) involves knocking out the bone marrow stromal cell antigen 2 gene in CHO cells using the RNP method.
[0029] A further step, step (3), is to describe the virus as an influenza virus;
[0030] Preferably, the influenza virus is the H1N1 influenza virus.
[0031] In a further step, in step (3), CHO cells with inactivated bone marrow stromal cell antigen 2 gene were cultured, inoculated with H1N1 influenza virus, with an infection multiplicity of 0.1, and incubated at 35°C for 1 hour; then the cells were washed once with PBS, and cell maintenance medium was added, and incubated at 35°C for observation.
[0032] In a further embodiment, the cell maintenance medium comprises DMEM medium, 100 U / mL penicillin, 100 μg / mL streptomycin, 0.2% bovine serum albumin fraction V, and 25 mM HEPES buffer.
[0033] In a further step, step (4) involves using quantitative real-time PCR to measure the viral RNA proliferation level.
[0034] In a further step, step (4) uses the half-tissue culture infection dose assay to detect the viral titer in the supernatant of infected cells and the freeze-thaw lysate.
[0035] By adopting the above technical solution, the present invention has the following beneficial effects compared with the prior art.
[0036] 1. This invention provides a bone marrow stromal cell antigen 2 (BST-2) inactivated CHO cell, which weakens the innate immune response induced by viral infection. Experiments have shown that, compared with wild-type CHO cells, BST-2 knockout CHO cells are more conducive to the culture and amplification of H1N1 influenza virus.
[0037] 2. The bone marrow stromal cell antigen 2 gene-inactivated CHO cells of the present invention can be used to culture and amplify influenza virus, which can improve the efficiency of influenza virus isolation and the viral infection titer.
[0038] 3. Compared with the method of culturing viruses using wild-type CHO cells, the method of culturing and amplifying viruses using CHO cells with inactivated bone marrow stromal cell antigen 2 gene (BST-2) increases the number of influenza virus RNA copies, and the virus titer in the cell supernatant is 14 to 15 times that in wild-type cells, thus greatly promoting the amplification and culture of viruses.
[0039] The specific embodiments of the present invention will now be described in further detail with reference to the accompanying drawings. Attached Figure Description
[0040] The accompanying drawings, as part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments and descriptions of the invention are used to explain the invention, but do not constitute an undue limitation of the invention. Obviously, the drawings described below are merely some embodiments, and those skilled in the art can obtain other drawings based on these drawings without creative effort. In the drawings:
[0041] Figure 1 Wild-type CHO cells (left) and CHO-k1-BST-2 - / - (Right) Comparison of cell morphology;
[0042] Figure 2 Wild-type CHO cells (top) and CHO-k1-BST-2 - / - (Below) Sequencing alignment;
[0043] Figure 3 CHO-k1-BST-2 - / - Proliferation activity detection;
[0044] Figure 4 For CHO-k1-WT and CHO-k1-BST-2 - / - H1N1 virus nucleic acid copy number in supernatant;
[0045] Figure 5 For CHO-k1-WT and CHO-k1-BST-2 - / - Copy number of H1N1 viral nucleic acid in freeze-thaw lysis buffer;
[0046] Figure 6 For CHO-k1-WT and CHO-k1-BST-2 - / - Virus titer in cell supernatant infected with H1N1.
[0047] It should be noted that these accompanying drawings and textual descriptions are not intended to limit the scope of the invention in any way, but rather to illustrate the concept of the invention to those skilled in the art by referring to specific embodiments. Detailed Implementation
[0048] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments will be clearly and completely described below with reference to the accompanying drawings. The following embodiments are used to illustrate the present invention, but are not intended to limit the scope of the present invention.
[0049] Example 1
[0050] 1. Main Experimental Methods
[0051] 1.1 Culture and identification of BST-2 gene knockout CHO cells
[0052] BST-2 gene knockout CHO cells were constructed using the RNP method. BST-2 gene knockout and wild-type CHO cells were cultured in T75 cell culture flasks using 10% FBS basal medium (OriCell), with each T75 cell culture flask seeded at 5 × 10⁶ cells / flask. 6 Add 15 mL of basal medium (10% FBS) to each cell culture flask and incubate at 37°C in a 5% CO2 cell culture incubator. When the cell density reaches 80%–90%, discard the waste liquid, wash twice with approximately 2–3 mL of PBS, then add 2–3 mL of trypsin containing 0.25% EDTA and incubate at room temperature for 1–2 minutes. Observe under a microscope after the cells become rounded, then aspirate and discard the trypsin. Add an appropriate amount of basal medium (10% FBS), pipette and mix the cells. Pass the desired number of cells into a new T75 cell culture flask, add fresh basal medium (10% FBS) to a final volume of 15 mL, gently pipette and mix, and finally incubate at 37°C in a 5% CO2 cell culture incubator to observe the cell growth status.
[0053] Design PCR identification primers; primer sequences are shown in Table 1.
[0054] Table 1 Primer sequences
[0055] name Sequence (5′→3′) Fragment size (bp) BST2CXF CCCACTTTCTACCACTATCACC 22 BST2CXR AATGTTTCCAGCCTTACCAC 20
[0056] Genomic DNA was extracted from single-clonal cell lines, and the target gene fragment was amplified by PCR. The PCR products were identified by 1% agarose gel electrophoresis and then sequenced.
[0057] 1.2 Detection of BST-2 gene knockout CHO cell proliferation activity
[0058] CHO-k1 and CHO-k1-BST-2 - / - Cells are arranged at 5 × 10 4 Cells were seeded per well in a 96-well plate, with 3 replicates per group and 1 blank control. The plates were incubated at 37°C in a 5% CO2 incubator for 24 hours. After incubation, the cell culture medium in each well was discarded, and 100 μL of basal medium was added. 10 μL of CCK-8 reagent was added to each well. The plate was gently tapped to ensure thorough mixing. The plates were incubated at 37°C in a 5% CO2 incubator for 1 hour, and then the OD was measured. 450nm value.
[0059] 1.3 BST-2 gene knockout CHO cells infected with H1N1 influenza virus
[0060] Prepare CHO-k1 and CHO-k1-BST-2 one day in advance. - / - Cells were seeded into 24-well plates at a density of 2.5 × 10⁻⁶ cells / well. 5 One per well; the next day, the H1N1 influenza virus was removed and thawed at room temperature.
[0061] Prepare cell maintenance medium and virus growth medium:
[0062] Cell maintenance medium:
[0063] Add the following to 500 mL of DMEM medium:
[0064] (1) 5 mL of penicillin and streptomycin stock solution (final concentration: 100 U / mL penicillin; 100 μg / mL streptomycin);
[0065] (2) Bovine serum albumin fraction V 12.5 mL (final concentration: 0.2%);
[0066] (3) 12.5 mL of HEPES buffer (final concentration: 25 mM);
[0067] Virus growth medium:
[0068] Add 0.5 mL of TPCK-trypsin (stock solution concentration of 2 mg / mL) to every 500 mL of cell maintenance medium to bring the final concentration of TPCK-trypsin to 2 μg / mL.
[0069] Influenza H1N1 virus was inoculated into 24-well plates with a multiplicity of infection (MOI) of 0.1 and incubated at 35°C for 1 h. After 1 h, the cells were washed once with PBS, and 500 μl of maintenance medium was added to each well for incubation at 35°C. RNA was extracted from the supernatant and freeze-thaw lysis buffer at 2 h, 24 h, 48 h, and 72 h after H1N1 infection.
[0070] 1.4 Quantitative Real-Time PCR for Gene Copy Number Measurement
[0071] The viral RNA level in the extracted RNA was detected using the QuantiTect Probe RT-PCR Kit (200).
[0072] 1.5 Half-maximal dose for tissue culture infection (TCID50)
[0073] CHO-k1 and CHO-k1-BST-2 were cultured in DMEM medium. - / -Cells diluted to 5×10 5 Cells / mL; plate 96-well plates (100 μL / well) and incubate at 37°C in a 5% CO2 incubator for 24 h. Add CHO-k1 and CHO-k1-BST-2 from the 96-well plates. - / - Discard the cell culture medium, carefully wash the cells three times with PBS using a pipette, serially dilute the supernatant of infected cells with virus growth medium, seed 100 μL / well into a 96-well plate, and incubate at 37°C in a 5% CO2 incubator. Observe the cytopathic effect daily.
[0074] 2. Statistical Analysis
[0075] Statistical analysis was performed using GraphPad Prism software, and t-tests were used to analyze data differences. A p-value < 0.05 was considered statistically significant.
[0076] 3 Results
[0077] 3.1 Culture and identification of BST-2 knockout CHO cells
[0078] Observation of CHO-k1-BST-2 under a microscope - / - There were no significant differences in cell morphology, size, and growth status between the cells and CHO-k1 cells (see [link]). Figure 1 CHO-k1-BST-2 - / - Cell gene sequencing results differed from wild-type; further analysis of the peak diagram revealed: CHO-k1-BST-2 - / - The cells showed two homozygous clones with overlapping peaks, confirming a frameshift mutation in the BST-2 gene. Sequencing results are shown below. Figure 2 .
[0079] 3.2 Detection of proliferation activity in BST-2 gene knockout CHO cells
[0080] For CHO-k1-BST - / - OD detection with CHO-k1 450nm After adjusting the values, a t-test was used for difference analysis. The results showed no significant difference, indicating that BST-2 gene knockout had no significant effect on the proliferation activity of CHO-k1 cells. (See attached results). Figure 3 .
[0081] 3.3 Results of nucleic acid copy number analysis by real-time PCR
[0082] CHO-k1 wild type and CHO-k1-BST-2 - / -Viral RNA was extracted from supernatants and freeze-thaw lysis buffers at 2 h, 24 h, 48 h, and 72 h after infection with influenza virus H1N1. RT-qPCR was performed, and the nucleic acid copy number in each well was analyzed statistically. Results showed that CHO-k1 wild-type and CHO-k1-BST-2 viral RNA were present in the supernatants at 24 h, 48 h, and 72 h. - / - A p-value < 0.05 indicates a significant difference in influenza virus RNA levels (see [link to relevant documentation]). Figure 4 ); In the freeze-thaw lysis solutions at 24h and 48h, CHO-k1 wild type and CHO-k1-BST-2 - / - A p-value < 0.05 indicates a significant difference in influenza virus RNA levels (see [link to relevant documentation]). Figure 5 Prove CHO-k1-BST-2 - / - The cell line facilitated the efficient culture and proliferation of influenza virus.
[0083] 3.4 TCID50 Results
[0084] Based on daily observation of cytopathic effects, the viral titer in the supernatant 48 hours after cell infection with H1N1 influenza virus was calculated to be 2.15 × 10⁻⁶ for CHO-K1 cells. 2 TCID50 / mL, CHO-k1-BST-2 - / - The cell count was 3.16 × 10⁻⁶. 3 TCID50 / mL, CHO-k1-BST-2 - / - The viral titer in the cell supernatant was 14–15 times that of CHO-k1 wild-type cells, as shown in the results below. Figure 6 .
[0085] In summary, the results of this invention demonstrate that:
[0086] Compared to wild-type CHO cells, the influenza virus culture titer of the BST-2 knockout CHO cell line was significantly higher, demonstrating that knocking out the BST-2 gene in CHO cells resolved the limitation of virus budding in CHO cells, providing a powerful approach to improve influenza virus isolation efficiency and viral infection titer.
[0087] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the above-described technical content to create equivalent embodiments without departing from the scope of the present invention. Any simple modifications, equivalent changes, and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.
Claims
1. A CHO cell, characterized in that, In CHO cells, the bone marrow stromal cell antigen 2 gene is inactivated.
2. The CHO cells according to claim 1, characterized in that, The inactivation refers to at least a partial deletion of the nucleic acid sequence of the bone marrow stromal cell antigen 2 gene; Preferably, the inactivation refers to the complete deletion of the nucleic acid sequence of the bone marrow stromal cell antigen 2 gene.
3. An application of CHO cells as described in claim 1 or 2 in the culture and amplification of viruses; Preferably, the virus is an influenza virus; Preferably, the influenza virus is the H1N1 influenza virus.
4. A method for culturing viruses, characterized in that, Includes the following steps: (1) Construct CHO cells with inactivated bone marrow stromal cell antigen 2 gene and perform sequencing identification; (2) Detect the proliferation activity of CHO cells with inactivated bone marrow stromal cell antigen 2 gene; (3) Culture CHO cells with inactivated bone marrow stromal cell antigen 2 gene and then infect them with the virus; (4) Detect viral nucleic acid proliferation and viral titer.
5. The method for culturing viruses according to claim 4, characterized in that, Step (1): The bone marrow stromal cell antigen 2 gene in CHO cells was knocked out using the RNP method.
6. The method for culturing viruses according to claim 4, characterized in that, Step (3), the virus mentioned is an influenza virus; Preferably, the influenza virus is the H1N1 influenza virus.
7. The method for culturing viruses according to claim 6, characterized in that, In step (3), CHO cells with inactivated bone marrow stromal cell antigen 2 gene were cultured, inoculated with H1N1 influenza virus with a multiplicity of infection of 0.1, and incubated at 35°C for 1 h; then the cells were washed once with PBS, cell maintenance medium was added, and the cells were incubated at 35°C for observation.
8. The method for culturing viruses according to claim 7, characterized in that, The cell maintenance medium includes DMEM medium, 100 U / mL penicillin, 100 μg / mL streptomycin, 0.2% bovine serum albumin fraction V, and 25 mM HEPES buffer.
9. The method for culturing viruses according to claim 4, characterized in that, In step (4), the viral RNA proliferation level is measured using quantitative real-time PCR.
10. The method for culturing viruses according to claim 4, characterized in that, In step (4), the viral titer in the infected cell supernatant and freeze-thaw lysate was detected by the half-tissue culture infection dose assay.
Citation Information
Patent Citations
CN101260385A
CN102816732A
CN116731983A