An engineered exosome loaded with cd63 transmembrane domain-matrix metalloproteinase fusion protein, and a preparation method and application thereof
By constructing engineered exosomes of CD63 transmembrane domain-matrix metalloproteinase fusion protein, the challenge of MMP delivery was solved, enabling efficient and stable delivery of MMPs to pathological scar tissue, reducing the risk of immune response and improving treatment efficacy.
Patent Information
- Application Number
- CN202610241956.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-28
- Publication Date
- 2026-05-29
AI Technical Summary
Existing technologies are difficult to effectively deliver matrix metalloproteinases (MMPs) to pathological scar tissue, and there are risks of immune reactions and non-specific damage. Traditional exosome loading methods are inefficient and unstable.
By constructing engineered exosomes of the CD63 transmembrane domain-matrix metalloproteinase fusion protein, the MMPs were stably anchored to the inner side of the exosome membrane using the cell's own exosome biogenesis pathway and existed in the exosome lumen as inactive zymogens. The MMPs were then efficiently loaded into MSC cells using lentiviral vectors.
This enables efficient and stable delivery of MMPs to target cells, avoiding non-specific damage and immune responses, and improving the efficacy and safety of treating pathological scars.
Smart Images

Figure CN122104598A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedicine and genetic engineering technology, specifically relating to a mesenchymal stem cell exosome loaded with CD63 transmembrane domain-matrix metalloproteinase fusion protein, its preparation method, and its application in the treatment of pathological scars. Background Technology
[0002] Pathological scars include hypertrophic scars and keloids, both caused by skin injury and irritation. They are products of abnormal skin tissue repair and may occur after skin injuries such as surgery, burns, acne, and shingles. Their pathological characteristics include excessive activation of fibroblasts during wound healing, abnormal transformation into myofibroblasts, leading to excessive deposition of the extracellular matrix (ECM), particularly an imbalance between the synthesis and degradation of type I and type III collagen, resulting in disordered collagen fiber arrangement. Pathological scars not only affect appearance but are also often accompanied by symptoms such as itching, pain, redness and thickening of the skin, and even limited mobility, severely impacting the patient's quality of life.
[0003] Currently, methods for treating pathological scars both domestically and internationally include surgical excision, injection, laser therapy, radiation therapy, cryotherapy, topical medications, and pressure therapy. In the early stages of wound healing and scar formation, the main treatment focus is on preventing scar hyperplasia and alleviating patient discomfort. Clinically, topical medications, PDL lasers, and radiotherapy are commonly used. During the mature stage of scarring, the primary goal is to reduce or eliminate scar thickness and area, often treated clinically with surgical excision, injection, and CO2 laser therapy. Topical medications have limited effectiveness; surgical procedures can directly remove the scar, are highly effective but have a high recurrence rate; injections offer significant short-term effects but have a long treatment cycle. Laser and radiation therapies are effective, but patients often experience poor tolerance, thus necessitating a new treatment approach.
[0004] Collagenases are a class of proteases that specifically hydrolyze the triple-helix domains of natural fibrous collagen. They are mainly divided into two categories: matrix metalloproteinases (MMPs) and bacterial collagenases. Early clinical trials attempted to use bacterial collagenases (derived from Clostridium histolyticum) for intralesional injection, but as a foreign protein, it has strong immunogenicity and easily causes allergic reactions; moreover, its enzyme activity is highly nonspecific, unable to distinguish between scar collagen and normal tissue collagen, easily leading to side effects such as damage to normal tissue and inflammatory reactions, resulting in unsatisfactory efficacy and safety.
[0005] MMPs are a family of endogenous zinc-dependent proteases in the human body, among which MMP1, MMP3, MMP8, MMP9, and MMP13 can specifically cleave the triple helix structure of collagen. Compared with bacterial collagenases, MMPs have high biocompatibility, extremely low immunogenicity, and strong substrate specificity. However, the direct application of free MMPs still faces bottlenecks: 1. They are easily neutralized: tissue inhibitors of metalloproteinases (TIMPs) highly expressed in the scar tissue microenvironment can rapidly inactivate them; 2. They cannot penetrate dense fibrous networks and are difficult to reach deep scar tissue.
[0006] Exosomes are nanoscale lipid bilayer vesicles (30-150 nm) secreted by cells, naturally carrying bioactive molecules such as proteins and nucleic acids, and playing a crucial role in intercellular communication. In particular, exosomes derived from mesenchymal stem cells (MSCs) are considered ideal carriers due to their natural nanoscale size, low immunogenicity, good biocompatibility, and inherent tissue repair capabilities, providing a new approach to solving the challenge of MMP delivery.
[0007] Currently, research on exosome delivery of small molecule drugs and nucleic acids has made progress, but there are still major technical challenges in delivering large functional proteins: Traditional physical loading methods have the following drawbacks: 1. Low efficiency: Electroporation, incubation, sonication, and other methods have low loading rates for large proteins (usually <20%) and easily damage the integrity of exosomes; 2. Poor loading stability: Physically loaded proteins are prone to leakage during cycling, making it impossible to guarantee that the effective dose reaches the target; 3. Limited mode of action: Existing strategies mostly focus on extracellular release and cannot achieve intracellular delivery, making it difficult to intervene in intracellular biosynthetic pathways.
[0008] Conventional gene transfection methods, which directly introduce the target gene into cells, cannot control the secretion pathway of its expression product. The product may remain in the cell or be released through the conventional secretion pathway, and cannot be effectively loaded into the exosome, resulting in low delivery efficiency. Summary of the Invention
[0009] To address the aforementioned technical problems, this invention provides an engineered exosome loaded with a CD63 transmembrane domain-matrix metalloproteinase fusion protein, along with its preparation method and applications.
[0010] First, this invention utilizes the cell's own protein synthesis and exosome biogenesis pathways to construct a fusion gene that stably loads the target protein onto the inner side of the exosome membrane. This fusion gene mainly consists of the following three parts:
[0011] Based on the anchoring domain of CD63: CD63 is one of the classic markers of exosomes, belonging to the tetraspanin family of proteins. It is widely distributed on the surface of late endosomes and exosome membranes, participating in exosome formation and release. The complete CD63 has four transmembrane domains, making its structure complex. Direct fusion with large protein molecules (MMPs) easily leads to misfolding and transport blockage. Therefore, truncation and modification are necessary to ensure correct membrane topology and efficient membrane anchoring. This invention selects the fourth transmembrane domain and the C-terminal cytoplasmic tail of CD63 as the anchoring domains of the exosome membrane. By utilizing the membrane anchoring properties of the fourth transmembrane domain TM4 of CD63, exogenous proteins can be stably anchored to the exosome membrane. Its C-terminal cytoplasmic tail is located on the cytoplasmic side (corresponding to the inner side of the exosome lumen) and also serves as a sorting signal for endosomes / multivesicular bodies, guiding the fusion protein into the exosome biogenesis pathway.
[0012] MMPs effector domains: MMPs are secreted proteases that naturally contain a signal peptide, a propeptide, and a catalytic domain. Direct expression of these domains often results in extracellular secretion, preventing loading into exosomes. Therefore, this invention removes the native N-terminal secretory signal peptide of MMPs to avoid conflict with the sorting signal at the C-terminal cytoplasmic tail of the CD63 domain. Simultaneously, it retains the complete propeptide region, as well as the subsequent catalytic domain, hinge region, and heme-binding protein-like domain. This ensures that the protease is loaded into exosomes in an inactive prozymogen form, thereby guaranteeing biosafety and specific activation within target cells.
[0013] Linker peptide: A flexible linker peptide sequence is inserted between the CD63 domain and the MMP1 domain to provide the necessary spatial freedom for the two functional domains, ensuring that they can fold independently and correctly and perform their functions without interfering with each other.
[0014] Based on this, the inventors introduced the fusion gene into MSC cells using a lentiviral vector. The fusion gene integrates into the host cell genome and is stably expressed as part of the host genome. Then, through the intracellular natural protein processing and transport system, the loading and release of exosomes is continuously completed (as shown in Figure 1), specifically including the following steps:
[0015] (1) Transcription and translation: The fusion gene integrated into the MSC genome is transcribed into messenger RNA (mRNA) in the nucleus. The mRNA is exported from the nucleus into the cytoplasm and translated on the ribosomes to generate the fusion protein (CD63_TM4 / CT-MMPs).
[0016] (2) Synthesis and intracellular transport of membrane proteins: Since the fusion protein contains the transmembrane domain of CD63, it is recognized by the cell as a membrane protein during translation and enters the endoplasmic reticulum membrane through signal recognition particles (SRP). In the endoplasmic reticulum, it completes transmembrane insertion, folding and preliminary modification, and then undergoes further processing and transport through the Golgi apparatus, following the classic secretion / membrane protein synthesis and transport pathway.
[0017] (3) Endosome-multivesicular body sorting: In the late Golgi phase, the fusion protein is preferentially sorted and enriched on the restriction membrane of late endosomes and multivesicular bodies (MVBs) by the endosome sorting signal carried by the C-terminal cytoplasmic tail of CD63, rather than being randomly distributed on the cell membrane or secreted into the extracellular space.
[0018] (4) Exosome formation and target protein loading: During the formation of multivesicular bodies, the limiting membrane buds inward to generate intraluminal vesicles (ILVs). At this time, the fusion protein anchored to the multivesicular body membrane enters the intraluminal vesicles along with the membrane structure, wherein: the CD63-derived transmembrane domain is embedded in the vesicle membrane; and the MMPs linked by linker peptides are located in the internal space of the intraluminal vesicles. Thus, the targeted loading and spatial localization of the target protein are achieved during the exosome formation stage;
[0019] (5) Exosome release: After the multivesicular bodies fuse with the cell membrane, the small vesicles in the lumen are released into the extracellular space in the form of exosomes, and finally engineered MSC exosomes carrying MMPs are obtained.
[0020] Specifically, the present invention is achieved through the following scheme:
[0021] In a first aspect, the present invention provides an engineered exosome loaded with a CD63 transmembrane domain-matrix metalloproteinase fusion protein, characterized in that the exosome is derived from genetically engineered mesenchymal stem cells, the membrane structure of which is anchored with a CD63-derived transmembrane domain fusion protein, and the intraluminal space of which is loaded with matrix metalloproteinases (MMPs).
[0022] The engineered exosomes have the following structural features:
[0023] (1) The particle size ranges from 30 to 150 nm, and it expresses typical exosome membrane marker proteins;
[0024] (2) The fusion protein is located on the exosome membrane in a membrane-anchored manner, and the MMPs effector domain is located inside the exosome lumen;
[0025] (3) MMPs exist in the form of inactive zymogens with intact propeptide structures, and maintain an inhibited enzyme activity state during delivery.
[0026] The fusion protein contains the following functional domains from the N-terminus to the C-terminus:
[0027] (1) Targeting anchoring domain: derived from the fourth transmembrane domain (TM4) and its C-terminal cytoplasmic tail (CT) of human CD63 protein. The fourth transmembrane domain stably anchors the fusion protein to the phospholipid bilayer of the exosome membrane; the C-terminal cytoplasmic tail serves as an endosome / multivesicular body sorting signal, mediating the fusion protein's directional entry into the exosome biogenesis pathway.
[0028] (2) Flexible linker peptide: composed of (GGGGGS)n sequence, n is 2-5, used to separate the anchoring domain and the effector domain, ensuring that each folds independently and the spatial conformation is intact;
[0029] (3) MMPs effector domains: selected from human matrix metalloproteinases with the natural N-terminal secretory signal peptide and stop codon removed, while retaining the propeptide region, catalytic domain, hinge region and heme-binding protein-like domain; the effector domains are expressed in prozymogen form and located inside the exosome lumen.
[0030] Preferably, the MMPs are human matrix metalloproteinases with type I and / or type III collagen degradation activity, including but not limited to one or more of MMP1, MMP3, MMP8, MMP9, and MMP13.
[0031] The engineered exosomes constructed in this way can achieve targeted loading and protective delivery of functional proteins while maintaining the natural structure and biological characteristics of exosomes.
[0032] In a second aspect, the present invention provides a method for preparing the engineered exosomes described in the first aspect, characterized by comprising the following steps:
[0033] Step 1: Constructing the fusion gene
[0034] A nucleic acid molecule encoding the CD63-TM4 / CT-MMPs fusion protein was designed and synthesized, wherein the fusion protein is encoded by the following fragments from the N-terminus to the C-terminus:
[0035] (1) The coding sequence of the fourth transmembrane domain and C-terminal cytoplasmic tail of CD63: It is derived from human CD63 protein, corresponding to amino acid positions 201-238, and its coding DNA sequence is shown in SEQ ID NO:2;
[0036] (2) The coding sequence of the flexible linker peptide is (GGGGGS)n, where n=4, and its coding DNA sequence is shown in SEQ ID NO:5;
[0037] (3) MMPs effector domain coding sequence: selected from matrix metalloproteinase (MMP) family members, which have type I and / or type III collagen degradation activity, and have been modified to remove the natural N-terminal secretory signal peptide and stop codon, while retaining the propeptide region, catalytic domain, hinge region and heme binding protein-like domain, and can be localized and loaded into the exosome lumen in the form of zymogen.
[0038] In one specific embodiment of the present invention, the MMPs effector domain is selected from human MMP1 (signal peptide removed), whose amino acid sequence is shown in SEQ ID NO:3 and whose encoding DNA sequence is shown in SEQ ID NO:4. The complete amino acid sequence of the corresponding fusion protein is shown in SEQ ID NO:6 and whose encoding DNA sequence is shown in SEQ ID NO:7.
[0039] As an extended embodiment of the present invention, the MMPs effector functional domain may also be selected from one or more of the following human MMP family members:
[0040] MMP3 (signal removal peptide), its amino acid sequence is shown in SEQ ID NO:10, and its encoding DNA sequence is shown in SEQ ID NO:11;
[0041] MMP8 (signal removal peptide), its amino acid sequence is shown in SEQ ID NO:12, and its encoding DNA sequence is shown in SEQ ID NO:13;
[0042] MMP9 (signal removal peptide), its amino acid sequence is shown in SEQ ID NO:14, and its encoding DNA sequence is shown in SEQ ID NO:15;
[0043] MMP13 (signal removal peptide), its amino acid sequence is shown in SEQ ID NO:16, and its encoding DNA sequence is shown in SEQ ID NO:17.
[0044] For each of the above MMP family members, the same fusion strategy as MMP1 can be used, that is, the corresponding MMP coding sequence after removing the signal peptide is spliced with the CD63-TM4 / CT coding sequence through the flexible linker peptide coding sequence to construct a fusion gene and express the fusion protein.
[0045] Based on the publicly available splicing rules and sequences, those skilled in the art can complete the corresponding fusion construction without creative effort.
[0046] Step 2: Constructing a recombinant lentiviral transfer plasmid vector
[0047] The nucleic acid molecule encoding the fusion protein obtained in step 1 was cloned into a lentiviral transfer plasmid vector to obtain the recombinant lentiviral transfer plasmid vector pLVX-CD63-TM4 / CT-MMPs.
[0048] The recombinant lentiviral transfer plasmid vector is characterized by:
[0049] (1) Vector backbone: Selected from pLVX series, pCDH series or pLenti series lentivirus transfer vector backbone;
[0050] (2) Promoter: Contains the cytomegalovirus immediate early promoter (CMV promoter), whose sequence is located downstream of the vector 5'LTR, driving high-level constitutive expression of the fusion protein;
[0051] (3) Fusion protein coding frame: located in the multiple cloning site region downstream of the promoter, containing the fusion gene sequence;
[0052] (4) Selection markers: containing the puromycin resistance gene (Puro) or the hygromycin resistance gene (Hygro), located downstream of the fusion protein coding frame, and co-expressed through the internal ribosome entry site (IRES) or self-cleaving peptide (P2A / T2A);
[0053] (5) Regulatory elements: including 5' long terminal repeat (5'LTR), 3' long terminal repeat (3'LTR), HIV-1 packaging signal (Ψ), Rev response element (RRE), central polypurine segment (cPPT / CTS) and marmot hepatitis virus posttranscriptional regulatory element (WPRE).
[0054] In one specific embodiment, the fusion gene sequence has been optimized by a human expression vector, and its sequence is shown in SEQ ID NO:8. The recombinant lentiviral transfer plasmid is the full sequence of pLVX-CD63-TM4 / CT-MMP1 shown in SEQ ID NO:9.
[0055] For other members of the MMP family, the same carrier skeleton can be used for replacement construction.
[0056] Step 3. Lentiviral Packaging
[0057] Recombinant lentiviral particles were obtained by co-transfecting packaging cell lines with a three-plasmid lentiviral packaging system, specifically including:
[0058] (1) Packaging system preparation: The following plasmids were co-transfected into 293T cells: recombinant transfer plasmid: pLVX-CD63-TM4 / CT-MMP1, 10 μg; packaging helper plasmid: psPAX2, 7.5 μg; envelope protein plasmid: pMD2.G, 2.5 μg; transfection reagent: polyethyleneimine (PEI) or liposome transfection reagent, mixed in the optimized ratio;
[0059] (2) Transfection operation: Slowly add the above plasmid-transfection reagent complex to the 293T cell culture system with a density of 70-80%, mix gently, and incubate at 37℃ and 5% CO2 for 6-8 hours before replacing with fresh complete culture medium.
[0060] (3) Virus harvest: Cell culture supernatant was collected 48 hours and 72 hours after transfection, and cell debris was removed by filtration through a 0.45 μm filter membrane to obtain crude lentivirus solution;
[0061] (4) Virus concentration and purification: The virus solution was concentrated 100-200 times by ultracentrifugation or tangential flow filtration, resuspended in PBS buffer, aliquoted, and stored at -80℃ for later use; the resulting lentivirus titer was ≥1×10⁻⁶. 8 TU / mL.
[0062] Step 4: Preparation of genetically engineered mesenchymal stem cells
[0063] The recombinant lentiviral particles obtained in step 3 are used to infect mesenchymal stem cells, which are derived from human umbilical cord, skin, bone marrow, or adipose tissue. Genetically engineered mesenchymal stem cells stably expressing the fusion protein are obtained through resistance selection, specifically including:
[0064] (1) Cell preparation: Mesenchymal stem cells were seeded into 6-well plates and cultured to a density of 70-80%;
[0065] (2) Lentiviral infection: The lentivirus solution obtained in step 3 was added to the cell culture system at a multiplicity of infection (MOI) of 5-20. Polybrene was added to a final concentration of 5-8 μg / mL. After mixing, the mixture was placed in a 37°C, 5% CO2 incubator for 12-24 hours for infection.
[0066] (3) Screening of stable cell lines: 48 hours after infection, replace the culture medium with fresh culture medium containing screening antibiotics (puromycin final concentration 1-3 μg / mL or hygromycin final concentration 50-200 μg / mL). Replace the culture medium containing antibiotics every 2-3 days and continue screening for 7-14 days until the uninfected control group cells die completely.
[0067] (4) Single-clone selection and expansion: The selected surviving cells were seeded into 96-well plates by limiting dilution, and single-cell clones were selected and cultured gradually. The expression level of the fusion protein was verified by RT-qPCR to obtain genetically engineered mesenchymal stem cell lines with high expression of the target fusion protein.
[0068] Step 5: Isolation and purification of engineered exosomes
[0069] The supernatant of the genetically engineered mesenchymal culture obtained in step 4 was collected and purified by one or more combinations of differential centrifugation, ultracentrifugation, tangential flow filtration or size exclusion chromatography to obtain engineered exosomes loaded with CD63 transmembrane domain-matrix metalloproteinase fusion protein.
[0070] Specifically, it includes:
[0071] (1) Cell expansion and supernatant collection: Mesenchymal stem cells that stably express fusion protein are seeded into culture flasks and cultured in exosome-free serum-free medium for 48-72 hours. The cell culture supernatant is then collected.
[0072] (2) Differential centrifugation: The supernatant was centrifuged in sequence as follows: 500×g for 5 minutes to remove live cells; 2,000×g for 30 minutes to remove dead cells and large cell debris; 10,000×g for 45 minutes to remove subcellular organelles and larger microvesicles.
[0073] (3) Ultracentrifugation: After filtering the supernatant through a 0.22 μm filter membrane, the supernatant was ultracentrifuged at 100,000-150,000×g and 4℃ for 70-120 minutes. The supernatant was discarded and the precipitate was resuspended in pre-cooled PBS.
[0074] (4) Purification: Optionally, the crude exosome suspension may be further purified by size exclusion chromatography (SEC) or density gradient ultracentrifugation (OptiPrep™ or sucrose gradient) to remove protein aggregates and non-exosome vesicles;
[0075] (5) Identification: Optionally, the isolated exosomes can be identified by nanoflow cytometry, NTA, or TEM electron microscopy.
[0076] The exosomes prepared by the above method maintain typical exosome characteristics in terms of particle size distribution, membrane structure integrity and marker protein expression, while achieving efficient and stable intraluminal loading of MMPs.
[0077] Thirdly, the present invention provides a biomaterial comprising engineered exosomes as described in the first aspect and a biocompatible material. The biocompatible material includes, but is not limited to, collagen, hyaluronic acid, chitosan, alginate, hydrogel, or biodegradable polymers. The composite method includes physical mixing, encapsulation, adsorption, cross-linking, or in-situ gelation to achieve sustained release or local delivery of the exosomes.
[0078] Fourthly, the present invention provides a biological agent comprising the engineered exosomes described in the first aspect and a pharmaceutically acceptable carrier. The agent may be an injectable formulation, a spray, a cream, or a gel, and can be prepared using conventional pharmaceutical methods, achieving stable administration without affecting the structural integrity and biological activity of the exosomes.
[0079] Fifthly, the present invention provides the use of the engineered exosomes described in the first aspect in the preparation of medicaments for the prevention or treatment of pathological scars.
[0080] The pathological scars include, but are not limited to: hypertrophic scars, keloids, post-burn scars, post-surgical scars, and post-traumatic fibrosis.
[0081] The engineered exosomes deliver MMPs via a process:
[0082] 1. Exosome Transport Phase: Within MSC cells and in the exosomes they release, the MMPs exist as pro-MMPs containing a propeptide. The "cysteine switch" in the propeptide structure coordinates with zinc ions at the catalytic center, blocking the activity of the catalytic domain and thus maintaining the inactive state of the MMPs, preventing untargeted proteolytic reactions. Simultaneously, because the MMPs are anchored within the exosome lumen, they do not interact with TIMPs or other soluble inhibitors in scar tissue; this design significantly improves the stability and safety of the MMPs during delivery.
[0083] 2. Take-up of exosomes by myofibroblasts: When the engineered MSC exosomes reach pathological scar tissue, they can be taken up by scar-associated fibroblasts or myofibroblasts through various mechanisms, including but not limited to: receptor-mediated endocytosis, macropinocytosis, lipid raft-dependent endocytosis, and partial fusion with the cell membrane. In the target cell, the exosomes or their membrane structures gradually dissociate during the maturation of endosomes, and the MMPs carried inside are exposed to a specific intracellular microenvironment. In this environment, the propeptides of MMPs can be cleaved through one or more of the following mechanisms, thereby completing the activation: (1) propeptide cleavage mediated by endogenous proteases of fibroblasts / myofibroblasts (such as furin proteases, serine proteases or other activating proteases); (2) the weakly acidic environment in the endosome / lysosome induces a conformational change in the propeptide, enhancing its cleavage by proteases; (3) the high oxidative stress state in scar tissue fibroblasts / myofibroblasts leads to the inactivation of the "cysteine switch", relieving the inhibition of the catalytic site. After being cleaved by the propeptide, MMPs are transformed into mature enzymes with proteolytic activity.
[0084] Activated MMPs can exert their anti-scarring effects through the following pathways:
[0085] 1. Degrades abnormally accumulated collagen and other extracellular matrix-related proteins within myofibroblasts or in their juxtamembranous region;
[0086] 2. Through exocytosis or local release, it acts on the surrounding matrix microenvironment to achieve targeted and localized matrix remodeling;
[0087] 3. It regulates the phenotype of myofibroblasts, promotes their transformation into resting fibroblasts or apoptotic cells, and inhibits their continuous activation state.
[0088] Since the activation of MMPs mainly occurs within the target cells or their proximal microenvironment, its mechanism of action greatly reduces the influence of the high TIMPs environment in scar tissue on the inhibition of MMP activity.
[0089] In addition to the direct effects of the MMPs, MSC exosomes themselves can also inhibit profibrotic signaling pathways such as TGF-β / Smad through their contained miRNA, protein and lipid components, reduce the abnormal proliferation of fibroblasts and myofibroblasts, and promote the orderly remodeling and functional repair of scar tissue. The above synergistic effects further enhance the overall effect of the present invention in the treatment of pathological scars.
[0090] The sequence information of this invention is as follows:
[0091] SEQ ID NO:1: The fourth transmembrane domain and C-terminal cytoplasmic tail amino acid sequence of CD63;
[0092] SEQ ID NO:2: The DNA sequence encoding the fourth transmembrane domain and C-terminal cytoplasmic tail of CD63;
[0093] SEQ ID NO:3: Human MMP1 (signal peptide removed) amino acid sequence;
[0094] SEQ ID NO:4: Nucleotide sequence encoding human MMP1 (signal peptide removed);
[0095] SEQ ID NO:5: (GGGGS)4 flexible linker peptide encodes a DNA sequence;
[0096] SEQ ID NO:6: Amino acid sequence of CD63-TM4 / CT-MMPs fusion protein;
[0097] SEQ ID NO:7: DNA sequence encoding the CD63-TM4 / CT-MMPs fusion protein;
[0098] SEQ ID NO:8: DNA sequence of CD63-TM4 / CT-MMPs fusion protein optimized for human expression;
[0099] SEQ ID NO.9: Full sequence of recombinant lentiviral transfer plasmid pLVX-CD63-TM4 / CT-MMP1.
[0100] SEQ ID NO:10: Human MMP3 (signal peptide removed) amino acid sequence;
[0101] SEQ ID NO:11: Human MMP3 (signal peptide removed) encoding DNA sequence;
[0102] SEQ ID NO:12: Human MMP8 (signal peptide removed) amino acid sequence;
[0103] SEQ ID NO:13: Human MMP8 (signal peptide removed) encoding DNA sequence;
[0104] SEQ ID NO:14: Human MMP9 (signal peptide removed) amino acid sequence;
[0105] SEQ ID NO:15: Human MMP9 (signal peptide removed) encoding DNA sequence;
[0106] SEQ ID NO:16: Human MMP13 (signal peptide removed) amino acid sequence;
[0107] SEQ ID NO:17: Human MMP13 (signal peptide removed) encoding DNA sequence.
[0108] Compared with the prior art, the present invention has at least the following beneficial effects:
[0109] 1. Utilizing the cell's own exosome biogenesis pathway for endogenous loading, and through transmembrane domain protein structure anchoring, the fusion protein is efficiently sorted into the exosome pathway, with an efficiency far exceeding that of conventional gene transfection methods. This achieves active and specific loading of MMPs into the exosome lumen. Simultaneously, it avoids damage to the exosome membrane caused by physical methods such as in vitro electroporation.
[0110] 2. Human MMPs are used, which have extremely low immunogenicity compared to bacterial collagenases. Moreover, MMPs exist in the form of inactive zymogens in exosomes and are only activated after being cleaved by proteases inside cells. This avoids non-specific diffusion, rapid inactivation, and potential side effects caused by direct administration of collagenases.
[0111] 3. By delivering MMPs to target cells via exosomes and utilizing the protective effect of the exosome membrane, the high TIMP environment of scar tissue effectively shields the inhibitory effect on MMP activity.
[0112] 4. Utilizing the nanoscale penetration ability and natural targeting properties of exosomes, MMPs can be delivered to fibroblasts / myofibroblasts in scar tissue.
[0113] 5. MSC-derived exosomes themselves have anti-inflammatory, anti-fibrotic, and tissue repair effects, forming a synergistic therapeutic effect with MMPs;
[0114] 6. It is suitable for various types of pathological scars and has good application prospects. Attached Figure Description
[0115] The accompanying drawings are provided to further illustrate the invention and form part of the specification. They are used together with the embodiments of the invention to explain the invention and do not constitute a limitation thereof.
[0116] Figure 1 This is a diagram illustrating the mechanism of the present invention.
[0117] Figure 2 This is a schematic diagram of the transfer plasmid vector in Example 2;
[0118] Figure 3 This is a diagram showing the mRNA identification results of the stable transgenic strain in Example 2;
[0119] Figure 4 The results of nanoflow cytometry detection of labeled proteins in exosome samples in Example 3;
[0120] Figure 5 The results of NTA detection in the exosome sample from Example 3;
[0121] Figure 6 Electron micrographs of the exosome sample from Example 3;
[0122] Figure 7 This is a comparison of pro-MMP1 levels in each group in Example 4;
[0123] Figure 8 The expression level of MMP1 after myofibroblasts took up engineered exosomes in Example 5;
[0124] Figure 9 The expression levels of COL1A1, COL3A1, and ACTA2 mRNA in each group in Example 5;
[0125] Figure 10 The results of type I and type III collagen expression detection in each group in Example 5;
[0126] Figure 11 The phase transition temperature curves are for the engineered exosome hydrogels with different weight percentages prepared in Example 6.
[0127] Figure 12 The release rate curve of the engineered exosome hydrogel exosomes prepared in Example 6;
[0128] Figure 13 This is an NTA detection image of exosomes released from the engineered exosome hydrogel exosomes prepared in Example 6;
[0129] Figure 14 The image shows an electron micrograph of the exosomes released from the engineered exosome hydrogel exosomes prepared in Example 6. Detailed Implementation
[0130] To facilitate understanding of the present invention, a more comprehensive description is provided below. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired implementation. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of the present invention to implement and apply the technology of the present invention.
[0131] The technical route of this invention is as follows: fusion gene construction → construction of genetically engineered mesenchymal stem cells → exosome extraction → specific loading experiment of MMP zymogens (verifying that MMPs are loaded into exosomes in the form of zymogens) → comparative experiment (verifying the anti-collagen deposition effect of engineered exosomes in a high TIMP microenvironment).
[0132] Unless otherwise specified in the examples, the procedures should be performed under standard conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.
[0133] Example 1: Construction of fusion gene This embodiment provides a method for constructing a fusion gene by directionally loading matrix metalloproteinases (MMPs) into the exosome cavity. In this embodiment, MMP1 is used as an example of the selection of the effector functional domain of MMPs. Those skilled in the art will know that, based on the same principle, members of the MMP family with similar functions, such as MMP3, MMP8, and MMP9, can be used to replace them, and all can achieve the purpose of this invention.
[0134] 1. Determining and obtaining the sequence of each functional domain
[0135] 1.1 CD63 transmembrane anchoring domain (TM4+C-terminal tail) amino acid and DNA sequence
[0136] Based on the amino acid sequence of human CD63 (UniProt ID: P08962), the amino acids corresponding to positions 204 to 238 of its fourth transmembrane domain (TM4) and C-terminal cytoplasmic tail were determined, as shown in SEQ ID NO: 1.
[0137] To obtain the coding DNA sequence encoding the above amino acid sequence, its corresponding standard sequence, numbered NM_001257389.2, was obtained through NCBI. The coding region (CDS) of this sequence is located at nucleotides 404 to 1120. Using the coordinates of the coding region, the start and end positions of the DNA fragment encoding amino acids 204 to 238 were determined as follows:
[0138] Starting position = CDS starting position + (target amino acid starting sequence number - 1) × 3 = 404 + (204 - 1) × 3 = 1013
[0139] End position = Start position + (Number of amino acids × 3) - 1 = 1013 + (35 × 3) - 1 = 1117
[0140] Accordingly, nucleotides 1013 to 1117 were extracted from the gene sequence to obtain the DNA sequence encoding the CD63 transmembrane anchoring domain, as shown in SEQ ID NO:2.
[0141] 1.2 MMP domain amino acids and DNA sequences (taking MMP1 as an example)
[0142] Based on the amino acid sequence of human MMP1 (UniProt ID: P03956), its N-terminal signal peptide was confirmed to be the sequence of positions 1-19. The amino acid sequence of its mature zymogen form begins with phenylalanine (F) at position 20. The amino acid sequence of MMP1 from position 20 to 469 is shown in SEQ ID NO: 3.
[0143] To obtain the DNA encoding the above amino acid sequence, its corresponding standard sequence, numbered NM_002421.4, was retrieved using NCBI. The CDS of this sequence is located at nucleotides 69 to 1478. Using the coding region coordinates, the start and end positions of the DNA fragment encoding amino acids 20 to 469 were determined as follows:
[0144] Starting position = CDS starting position + (target amino acid starting number - 1) × 3 = 69 + (20 - 1) × 3 = 126
[0145] End position = Start position + (Number of amino acids × 3) - 1 = 126 + (450 × 3) - 1 = 1475
[0146] Accordingly, nucleotides 126 to 1475 were extracted from the mRNA sequence to obtain the DNA sequence encoding the signal-free peptide human MMP1 maturation proenzyme, as shown in SEQ ID NO: 4.
[0147] 1.3 Flexible linker peptide amino acid sequence and DNA sequence
[0148] The classic flexible joint (GGGGS) composed of glycine (Gly) and serine (Ser) is used. n In this embodiment, n=4 is preferred, and its amino acid sequence is shown in SEQ ID NO: 5.
[0149] 2. Assembly of fusion genes
[0150] The DNA sequences of the above three parts were spliced together in the order of CD63_TM4 / CT–(GGGGS)4–MMP1, and the amino acid sequence of the resulting fusion protein was: SEQ ID NO: 6, which constitutes the coding sequence of the fusion gene: SEQ ID NO: 7.
[0151] Example 2: Construction of genetically engineered mesenchymal stem cells
[0152] Based on the fusion gene constructed in Example 1, this example illustrates how to use a lentiviral system to introduce the fusion gene into human mesenchymal stem cells, thereby constructing genetically engineered MSCs that can stably produce and secrete exosomes carrying MMP1.
[0153] 1. Codon optimization
[0154] To improve the expression efficiency of this fusion gene in human mesenchymal stem cells (MSCs), the human expression codons of the directly spliced DNA sequence SEQ ID NO: 7 were optimized. The optimization goals were to increase the codon fitness index (CAI) and adjust the GC content to an appropriate range.
[0155] After optimization, the DNA sequence shown in SEQ ID NO:8 was obtained, with the CAI increasing from 0.76 to 0.93 and the GC content increasing from 46.20% to 56.83%. The encoded amino acid sequence is completely identical to the original. Those skilled in the art will understand that any DNA sequence encoding the same amino acid sequence that has undergone codon optimization to improve its expression efficiency in mammalian cells falls within the scope of protection of this invention.
[0156] 2. Construction of recombinant lentiviral expression vector.
[0157] 2.1 Carrier selection.
[0158] The optimized fusion gene sequence (SEQ ID NO:8) was cloned into the multiple cloning site of a suitable mammalian expression vector by adding start codon: ATG and stop codon: TAA to the beginning and end, respectively, and placed downstream of a strong constitutive promoter.
[0159] Specifically, a third-generation human lentiviral transfer plasmid is selected as the gene delivery vector, such as pLVX, pLenti, pCDH, or similar vectors; the promoter is CMV or EF1α; the selection marker is puromycin or hygromycin. This example uses pLVX, Puro, and CMV as examples to illustrate the construction of the transfer plasmid as follows: Figure 2 As shown, the specific sequence is shown in SEQ ID NO.9.
[0160] 2.2 Target gene insertion
[0161] The codon-optimized CD63TM4 / CT-MMP1 fusion gene from step 1 was used as the target fragment, and the steps are as follows:
[0162] (1) Restriction endonuclease site design: Restriction sites are introduced at the 5' end and 3' end of the target gene, respectively. In this example, the following are used: 5' end: EcoRI, 3' end: BamHI.
[0163] (2) PCR amplification of the target gene: Taking a 50 μL reaction system as an example: template DNA: 50 ng, upstream primer: 0.5 μM, downstream primer: 0.5 μM, high-fidelity enzyme: 1 U, dNTP: 200 μM, buffer: 1×; PCR program: 98℃ 30 s; 98℃ 10 s; 60℃ 15 s; 72℃ 1 min / kb; 30 cycles; 72℃ 5 min.
[0164] (3) Enzyme digestion and ligation: The PCR product and the linearized vector were double-digested at 37°C for 2 h; after recovery from agarose gel, T4 DNA was ligated at 16°C overnight.
[0165] (4) Transformation and screening: The ligation product was transformed into competent Escherichia coli DH5α: ice bath for 30 min, heat shock at 42℃ for 45 s, ice bath for 2 min, SOC added for recovery for 1 h, plated on LB agar containing ampicillin, and cultured at 37℃ for 16 h.
[0166] (5) Positive clone identification: Select single clones for colony PCR, restriction enzyme digestion identification, Sanger sequencing, and those whose sequencing results are completely consistent with the sequence in Example 1 are selected transfer plasmids pLV-CD63TM4 / CT-MMP1.
[0167] 3. Lentiviral particle packaging
[0168] 3.1 Preparation of Packaging Cells: HEK293T cells were selected as the virus packaging cells. Culture conditions: DMEM + 10% FBS, 37℃, 5% CO2. Transfection was performed when the cell density reached 70–80%.
[0169] 3.2 Co-transfection system
[0170] A three-plasmid packaging system was used, with a mass ratio of 4:3:1. plasmid Function transfer vector pLV-CD63TM4 / CT-MMP1 psPAX2 Gag / Pol pMD2.G VSV-G Encapsulation
[0171] 3.3 Transfection and Virus Collection
[0172] For example, using a 10 cm culture dish: mix DNA with 10 μg transfer vector, 7.5 μg psPAX2, and 2.5 μg pMD2.G, add transfection reagent (Lipofectamine 3000), incubate at room temperature for 15 min, then drop the mixture onto 293T cells, and replace with fresh culture medium after 6–8 h.
[0173] Virus collection: Supernatant was collected at 48 h and 72 h post-transfection. Virus concentration was performed using ultracentrifugation (25,000 rpm, 4℃, 2 h), and the precipitate was resuspended in PBS. The viral titer was calculated by calculating the positivity rate after infecting 293T cells using qPCR. The viral titer in this example was approximately 1 × 10⁻⁶. 8 TU / mL.
[0174] 4. MSC cell infection
[0175] Purchase human umbilical cord-derived MSCs and culture them in DMEM / F12 medium with 1% penicillin and streptomycin. Plate the cells one day before infection to achieve a cell density of 70–80%. Add 8 μg / mL lentivirus at infection, setting the MOI to 20. Replace the medium with virus-containing medium and incubate for 12–16 h, then replace with fresh medium and continue culturing for 48 h.
[0176] 5. Screening of stable mutant strains
[0177] 5.1 Preliminary antibiotic concentration experiment: First, determine the concentration of puromycin that the MSCs are sensitive to. Commonly used lethal concentration: 1–3 μg / mL.
[0178] 5.2 Screening process: 48 hours after infection, replace the medium with fresh medium containing 2 μg / mL puromycin. Replace the medium with antibiotic-containing medium every 2-3 days and continue screening for 7-14 days until all uninfected control wells die.
[0179] 5.3 Identification of Stable Transgenic Cells: In this embodiment, stable transgenic cells were used to identify mRNA levels. Total RNA was extracted from engineered MSC cells → reverse transcription → qPCR. Primers were designed across the Linker-MMP1 linker region, and Oligo(dT) primers were used for reverse transcription. Specifically, the primers used in this embodiment are as follows:
[0180] Primers Sequence (5'-3') Forward Primer (Linker end - MMP1 start area) GGAGGCAGCTTCCCTGCTA Reverse Primer (MMP1 ribbon 121-160 bit) CCCGAAGAACTCCTGCATCT GAPDH Forward Primer ATTCCACCCATGGCAAATTCC GAPDH Reverse Primer GACTCCACGACGTACTCAGC
[0181] Stable transfected cells were selected as the experimental group (EG), and untransfected MSCs were used as the control (CG). The relative gene expression levels were normalized to 2^ΔΔCt using the expression level of the reference gene GAPDH. Figure 3 As shown, the fusion gene mRNA was significantly expressed in the screened MSCs, while it was not detected in the untransfected MSCs.
[0182] Example 3: Exosome Preparation and Characterization
[0183] In this embodiment, exosomes are separated using ultracentrifugation. The specific steps are as follows:
[0184] Using infected MSC cells, discard the original culture medium, wash the cells three times with PBS, replace with serum-free exosome culture medium, and incubate at 37°C for 48 hours. Then collect the supernatant containing exosomes. Centrifuge the supernatant sample at 500g for 5 minutes, then transfer the supernatant to a new centrifuge tube and centrifuge at 2000 × g, 4 °C for 30 min. Transfer the supernatant to a new centrifuge tube and centrifuge again at 10,000 × g, 4 °C for 45 min to remove larger vesicles. Filter the supernatant through a 0.45 μm filter membrane and collect the filtrate. Transfer the filtrate to a new centrifuge tube and centrifuge at 4 °C, 100,000 × g for 90 min. Remove the supernatant, resuspend the exosomes in 10 mL of pre-chilled 1×PBS, and centrifuge again at 4 °C, 100,000 × g for 90 min. Remove the supernatant, resuspend the exosomes in 150 μL of pre-chilled 1×PBS, filter sterilize through a 0.22 μm filter membrane, aliquot, and store at -80 °C for long-term storage.
[0185] Exosomes were extracted from ordinary MSC cells using the same method described above.
[0186] The exosome samples prepared by the above method were subjected to three types of detection: exosome surface protein detection, NTA detection, and electron microscopy.
[0187] (1) Detection of exosome surface proteins: Fluorescent labeling and nanoflow cytometry were used to detect the expression of exosome labeled proteins. (See attached data for exosome labeling protein expression results.) Figure 4 ;
[0188] (2) NTA detection: Exosome samples were enriched with particles with a diameter of 144.9 nm, at a concentration of 7.7E+10 particles / mL. The detection results are referenced. Figure 5 ;
[0189] (3) Electron microscopy results of exosome samples, refer to Figure 6 ;
[0190] Refer to each Figure 4 , Figure 5 and Figure 6 Based on the above three test results, it can be concluded that the exosomes secreted by the genetically engineered MSCs prepared in Example 2 have normal phenotypes, sufficient quantity, and intact membrane structure.
[0191] Example 4: Verification of specific loading and intramembrane localization of MMP prozymogens in engineered MSC exosomes
[0192] This embodiment aims to verify: the expression level of MMP1 carried in engineered MSC exosomes; and to verify that the MMP1 is located in the exosome lumen in zymogen form. The specific steps are as follows:
[0193] The culture supernatants of ordinary MSCs and transfected MSCs were collected separately. Exosomes were extracted by ultracentrifugation according to the method described in Example 3. The exosome count was normalized, and the obtained exosome samples were divided into four experimental groups. The culture medium was used as the control group (CG). Each group was repeated in triplicate. The specific grouping is shown in the table below: Group Exosome source Handling method Control group (CG) none No action taken Experimental group 1 (EG1) Common MSC exosomes No action taken Experimental group 2 (EG2) Engineered MSC exosomes No action taken Experimental group 3 (EG3) Engineered MSC exosomes proteinase K Experimental group 4 (EG4) Engineered MSC exosomes Proteinase K + Triton X-100
[0194] After processing (40 min), proteinase K and Triton X-100 were thoroughly eluted and removed by column purification. The eluted exosomes were lysed using exosome-specific lysis buffer (Yeasen) according to the manufacturer's instructions. The pro-MMP1 content in each sample was quantitatively detected using a human Pro-MMP1 ELISA kit (ZYscience).
[0195] The test results are as follows Figure 7 In experimental group 1, the pro-MMP1 expression level in ordinary MSC exosomes was close to the background; in experimental group 2, the pro-MMP1 content in engineered MSC exosomes was significantly higher than that in ordinary MSC exosomes; in experimental group 3, the pro-MMP1 content was basically the same as that in experimental group 2; and in experimental group 4, the pro-MMP1 signal was significantly reduced.
[0196] The above results indicate that the MMPs carried in the engineered MSC exosomes constructed in this invention are not derived from the natural background of MSC exosomes, but are specifically loaded through the fusion gene described in this invention; under the condition of not damaging the exosome membrane structure, proteinase K cannot degrade pro-MMP1, indicating that it is not exposed on the outer surface of the exosome; after the membrane structure is damaged, pro-MMP1 can be digested by proteinase K, further proving that the MMPs are located in the exosome lumen space in the form of zymogens.
[0197] Example 5: Validation of the anti-collagen deposition effect of engineered MSC exosomes in a high-TIMP fibrotic microenvironment
[0198] This embodiment aims to verify the regulatory effect of engineered MSC exosomes on the fibrotic phenotype of scar fibroblasts and their ability to degrade deposited collagen in a high-TIMP microenvironment.
[0199] 1. Establishment of cell model
[0200] Purchase human scar dermal fibroblasts (MeisenCTCC). Culture the cells in DMEM medium containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin, and incubate at 37°C in a 5% CO2 incubator. When cell confluence reaches 70%–80%, add TGF-β1 (final concentration 10 ng / mL) for 48 h to induce a myofibroblast model. After induction, replace with serum-free medium.
[0201] 2. MMP1 activity detection
[0202] After induction, myofibroblast models were divided into two groups. The experimental group received 5 mL of 1×10^9 / mL engineered MSC exosomes, while the control group received an equal volume of PBS. Each group was divided into three replicates. Cells were collected and lysed after 48 hours. MMP1 expression was detected using the MMP1 Human ProcartaPlex™ Simplex Kit (Thermo Fisher Scientific) according to the manufacturer's instructions. The experimental results are shown below. Figure 8 As shown, compared with the PBS control group, the experimental group showed significantly higher expression of MMP1, proving that after the engineered exosomes of this invention are taken up by myofibroblasts, the pro-MMP1 precursor peptide is cleaved, and MMPs are converted into an active mature enzyme form.
[0203] 3. Verification of anti-collagen deposition effect
[0204] After induction, myofibroblast models were obtained, and tissue inhibitor of metalloproteinases-1 (TIMP-1) was used to simulate the pathological scar microenvironment. The models were divided into 2 control groups (CG) and 5 experimental groups (EG), with 3 replicates per group. The following treatments were performed: Group Handling method Control group 1 (CG1) PBS control Control group 1 (CG2) 150 ng / mL TIMP-1 Experimental group 1 (EG1) Free MMP1 (300 ng / mL) + 150 ng / mL TIMP-1 Experimental group 2 (EG2) 1×10^9 / mL MSC exosomes Experimental group 3 (EG3) 1×10^9 / mL MSC exosomes + 150 ng / mL TIMP-1 Experimental group 4 (EG4) 1×10^9 / mL engineered MSC exosomes Experimental group 5 (EG5) 1×10^9 / mL engineered MSC exosomes + 150 ng / mL TIMP-1
[0205] The relative expression levels of mRNA (COL1A1, COL3A1, ACTA2) of type I collagen, type III collagen, and α-smooth muscle actin were detected 48 hours later; the expression levels of type I collagen and type III collagen were detected 7 days later.
[0206] 3.1 Detection of COL1A1, COL3A1, and ACTA2 mRNA expression Cells were collected by centrifugation after 48 h of treatment, washed twice with PBS, and lysed with Trizol. Total RNA was extracted, and the RNA concentration was measured before use. cDNA amplification and qPCR detection were performed using a commercial reverse transcription kit. Real-time quantitative PCR was performed using the SYBR Green system. The reaction system included SYBR Green Mix, forward and reverse primers, cDNA template, and internal control gene: GAPDH. The primer template is as follows:
[0207] Primers Sequence (5'-3') COL1A1 Forward Primer TTGCTTCCCAGATGTCCT COL1A1 Reverse Primer TGTCCCTTCATTCC COL3A1 Forward Primer CTACTGGGCCTGGTGGTGA COL3A1 Reverse Primer GACCTGGTTCCCCAGGTTTT ACTA2 Forward Primer GGTGATGGTGGGAATGG ACTA2 Reverse Primer TGGCTGGAACAGGGTCT GAPDH Forward Primer ATTCCACCCATGGCAAATTCC GAPDH Reverse Primer GACTCCACGACGTACTCAGC
[0208] The relative gene expression levels of the target gene were normalized to the expression level of the reference gene GAPDH, and the data were expressed as fold change (2^ΔΔCq) between the treated sample and the culture medium control. Statistical analysis of the 2^ΔΔCq data yielded the following results: Figure 9 As shown:
[0209] Figure 9 A represents the change in COL1A1 mRNA expression level:
[0210] In control group 2, COL1A1 expression was significantly increased (24.6 vs 16.4) under high TIMP environment, suggesting that TIMP inhibits matrix degradation and further promotes type I collagen synthesis. In experimental group 1, the expression level of free MMP1 remained at a high level (23.7), indicating that the function of free enzymes was limited in a high TIMP environment. The COL1A1 level in ordinary MSC exosomes in experimental group 2 was lower than that in experimental group 1 (12.3), indicating that MSC exosomes themselves have a certain anti-fibrotic effect. The COL1A1 level in experimental group 3 (18.1) was higher than that in MSC exosomes alone, suggesting that its effect is partly affected by the TIMP microenvironment. The COL1A1 level in the engineered MSC exosome group was significantly reduced (10.8), with a greater reduction than that in ordinary MSC exosomes. Under TIMP environment, the COL1A1 level in the engineered exosome group (13.1) was still lower than that in the PBS control and TIMP groups.
[0211] Figure 9 B represents the change in COL3A1 mRNA expression level:
[0212] The overall trend of COL3A1 is basically the same as that of COL1A1. Both COL3A1 and COL1A1 showed a certain degree of decrease after treatment with ordinary exosomes and genetically engineered exosomes, but no significant difference was shown under high TIMP conditions.
[0213] Figure 9 C: Changes in ACTA2 mRNA expression levels:
[0214] ACTA2 is the gene encoding α-SMA and a marker gene for fibrosis phenotype. There was basically no difference in ACTA2 expression level between experimental group 1 and control group 2. The ACTA2 expression level in experimental group 3 decreased compared with control group 2, but there was no significant difference. The ACTA2 expression level in experimental group 5 decreased significantly compared with control group 2.
[0215] The above results indicate that the engineered exosomes of this invention can significantly inhibit the transcription level of COL1A1 in fibroblasts (P < 0.0001) and regulate the degree of myofibroblast fibrosis (P < 0.01), and still maintain a strong effect in a high TIMP inhibition environment, which is significantly better than ordinary exosomes and free MMP1.
[0216] 3.2 Detection of type I and type III collagen expression
[0217] After 7 days of treatment, cells from each group were collected and lysed to detect the collagen deposition level in fibroblasts under different treatment conditions. The expression levels of type I and type III collagen were measured using a commercially available ELISA kit. A standard curve equation was created by fitting a logistic curve with the standard concentration as the x-axis and the corresponding OD value as the y-axis. The concentration of the sample was calculated using the equation based on the OD value of the sample, expressed as ng / mL, and the ratio of collagen I to type III was also calculated.
[0218] The results are as follows Figure 10 As shown, after adding TIMP-1 to simulate a high TIMP-inhibiting microenvironment in vivo based on control group 1 (CG1), the detection results of control group 2 (CG2) showed that Collagen I increased from 256.42 ng / mL to 389.33 ng / mL, Collagen III increased from 22.53 ng / mL to 24.56 ng / mL, and the I / III ratio increased from 11.381 to 15.852. This indicates that under the condition of TIMP-inhibiting matrix degradation, abnormal collagen deposition was further aggravated, and the I / III ratio increased, presenting typical pathological scar collagen structure characteristics.
[0219] The results of experimental group 1 (EG1) showed that the average Collagen I was 366.45 ng / mL, which was slightly lower than that of CG2, but the difference was not significant (ns). Collagen III was 24.93 ng / mL, which was not significantly different from that of CG2 (ns). The I / III ratio was 14.699, which remained at a high level.
[0220] The results of experimental group 2 (EG2) showed that Collagen I decreased to 206.33 ng / mL, which was significantly lower than that of CG2, Collagen III decreased to 21.46 ng / mL, and the I / III ratio decreased to 9.615.
[0221] The results of experimental group 3 (EG3) showed that Collagen I rose to 305.28 ng / mL, which was significantly higher than that of EG2, Collagen III was 22.78 ng / mL, and the I / III ratio rose to 13.401.
[0222] The results of experimental group 4 (EG4) showed that Collagen I decreased to 97.38 ng / mL, which was significantly lower than that of CG2, EG1 and EG3, Collagen III decreased to 20.42 ng / mL, and the I / III ratio decreased to 4.769.
[0223] The results of experimental group 5 (EG5, engineered Exo + TIMP) showed that Collagen I was 168.30 ng / mL, significantly lower than CG2 (****), and Collagen III was 21.54 ng / mL, with an I / III ratio of 7.813. Although slightly higher than EG4, it was still significantly lower than CG2, EG1, and EG3.
[0224] In summary, the results indicate that a high-TIMP microenvironment significantly promotes abnormal collagen deposition and increases the I / III ratio; free MMP1 enzyme activity is limited under high-TIMP inhibition, making it difficult to effectively degrade collagen deposits; ordinary MSC exosomes have a certain ability to inhibit collagen deposition and regulate the matrix, but this is easily weakened by the TIMP environment; the engineered MSC exosomes constructed in this invention can significantly reduce type I collagen expression; especially under high-TIMP inhibition, they maintain a significant degradation effect and effectively reduce the I / III ratio. This confirms their functional effectiveness in pathological scar matrix remodeling.
[0225] Example 6: Preparation and in vitro evaluation of engineered MSC-modified exosome-hyaluronic acid hydrogel
[0226] This embodiment aims to verify the feasibility of combining the engineered exosomes of the present invention with hyaluronic acid hydrogel, and to examine the release behavior, structural stability and bioactivity of the combined exosomes.
[0227] 1. Preparation of engineered exosome-hyaluronic acid hydrogel
[0228] Take the engineered MSC exosomes prepared in Example 3 (concentration 1×10^10 particles / mL, measured by NTA), dissolve the commercially available sterile PLGA-PEG-PLGA thermosensitive hydrogel in the exosome concentrate solution, prepare exosome hydrogel solutions with different weight percentages (10%~25%), and stir at 4°C for 1 hour to ensure uniform mixing and stability.
[0229] The prepared engineered exosome hydrogel (P-Exo) solution was liquid at room temperature. The sol-gel phase transition temperature was determined using a test tube inversion test: before measurement, the P-Exo hydrogel solution was placed in a centrifuge tube, and the temperature was continuously increased from 25°C until a phase transition occurred, with the heating rate controlled at 0.5°C / cycle. If the solution remained stagnant after the centrifuge tube was inverted at the current temperature for 20 seconds, gel formation was considered complete. Each sample was measured three times, and the average value was taken as the sample's phase transition temperature.
[0230] The results are as follows Figure 11 As shown, 15 wt% P-Exo undergoes a sol-gel transition at 37 °C.
[0231] 2. Determination of exosome release curves.
[0232] A 15 wt% P-Exo hydrogel solution (total volume 1 mL) was incubated at 37°C for 30 minutes to form a gel. The resulting gel was then incubated with 1 mL of PBS in a shaker at 37°C. At predetermined time intervals (6, 12, 24, 48, 72, and 96 hours), 0.5 mL of the supernatant was collected for analysis, and an equal volume of fresh PBS (0.5 mL) was added. The rate of exosome release from the P-Exo hydrogel was assessed using an exosome ELISA kit. The specific steps are as follows:
[0233] Take the concentrated washing solution and dilute it 20 times with deionized water to prepare the washing working solution. Prepare the chromogenic substrate solution at a ratio of A:B = 1:1 to prepare the chromogenic substrate working solution. Mix well and set aside. Take 100 μL of standards S0-S5, exosome concentrate, and test sample respectively and add them to the microplate. Seal the wells with sealing film and incubate at 37 ℃ for 60 min. Then wash three times with the washing working solution, pat dry the residual liquid in the wells on absorbent paper, and add 100 μL of enzyme conjugate to each well. Seal the wells with sealing film, incubate at 37 ℃ for 60 min, and then wash three more times with the working solution and pat dry. Add 100 μL of the chromogenic substrate working solution to the reaction wells and react at 37 ℃ in the dark for 30 min. Add 50 μL of stop solution and react for 5 min. Read the OD value of each well at 450 nm using a microplate reader. Plot an XY standard curve with the standards as the x-axis and the OD value as the y-axis. The cumulative exosome release rate was calculated.
[0234] The results show that... Figure 12 As shown, the composite material released approximately 85% of the exosomes within 96 hours, with no burst release. This indicates that the exosomes can be continuously released from the hydrogel, exhibiting excellent sustained-release properties.
[0235] 3. Detection of the morphology and particle size of exosomes released from P-Exo hydrogel
[0236] The release solution was collected at 48 h, and the exosomes were recovered by ultracentrifugation, resuspended in PBS, and their morphology was examined by electron microscopy. The particle size distribution was detected by nanoparticle tracking and analysis (NTA).
[0237] NTA results as follows Figure 13 As shown, the average particle size of the released exosomes was 142.3 ± 5.6 nm, which was not significantly different from the engineered exosomes prepared in Example 3 (144.9 ± 4.8 nm) (P > 0.05), and the particle size distribution curves basically overlapped.
[0238] Electron microscopy results as follows Figure 14 As shown, the hydrogel composite and release process did not disrupt the membrane structure integrity of the exosomes.
[0239] 4. Detection of the bioactivity of exosomes after release.
[0240] Exosomes recovered from the release solution at 48 h were used to treat TGF-β1-induced myofibroblasts at a concentration of 1 × 10^9 particles / mL (specific experimental procedures are the same as in Example 5). The control group was treated with PBS. After 7 days, cells from each group were collected and lysed, and the expression level of type I collagen was detected using an ELISA kit.
[0241] The results are shown in the table below. Compared with the PBS-treated control group (CG), the Collagen I expression level in the hydrogel-released exosome treatment group (EG) decreased to 101.17 ng / mL, which is 38.20% of the control group's 264.84 ng / mL. This was not significantly different from the ratio of the engineered exosome treatment group to control group 1 (EG4 / CG1) in Example 5 (37.98%) (P > 0.05), indicating that the exosomes released from the hydrogel still maintain their bioactivity in inhibiting collagen synthesis. This example demonstrates that the engineered exosomes of this invention can be successfully combined with hyaluronic acid hydrogel to form a sustained-release delivery system, and the combined release process does not affect the structural integrity and anti-fibrotic function of the exosomes, providing experimental evidence for the development of this engineered exosome formulation.
[0242]
[0243] A brief explanation of common knowledge regarding the combination of exosomes with biomaterials such as hydrogels:
[0244] Those skilled in the art will recognize that exosomes, as nanoscale bioactive vesicles, possess excellent tissue penetration and cellular uptake efficiency, but they are also rapidly cleared from the body and have a short local retention time. To address this issue, combining exosomes with biocompatible hydrogels to achieve localized sustained-release delivery has become a standard strategy in the field of tissue repair and regenerative medicine. For example, numerous studies have reported the use of exosomes derived from mesenchymal stem cells in combination with hyaluronic acid hydrogels, chitosan hydrogels, gelatin hydrogels, or polylactic-coated glycolic acid (PLGA) hydrogels to promote wound healing, inhibit fibrosis, and improve myocardial repair (see: 1. Han X, Saengow C, Ju L, Ren W, Ewoldt RH, Irudayaraj J. Exosome-coated oxygen nanobubble-laden hydrogel augments intracellular delivery of exosomes for enhanced wound healing. Nat Commun. 2024 Apr 23;15(1):3435. doi: 10.1038 / s41467-024-47696-5; 2. Li Q, Hu W, Huang Q, Yang J, LiB, Ma K, Wei Q, Wang Y, Su J, Sun M, Cui S, Yang R, Li H, Fu X, Zhang C. MiR146a-loaded engineered Exosomes released from silk fibroin patch promote diabetic wound healing by targeting IRAK1. Signal Transduct Target Ther. 2023 Feb 13;8(1):62. doi: 10.1038 / s41392-022-01263-w.). The above-mentioned composites can usually be achieved through simple physical mixing, embedding, adsorption, or in-situ cross-linking, and the exosomes can still maintain their structural integrity and biological activity after composite formation.
[0245] General knowledge regarding exosome preparations:
[0246] Preparing exosomes into pharmaceutically acceptable formulations is a routine technique in this field. For example, exosomes can be lyophilized and reconstituted to prepare injectable formulations; exosomes can be mixed with gel matrices such as carbomer and sodium alginate to prepare topical gels; and exosomes can be mixed with cream matrices to prepare creams. These formulation processes have been widely used in research on the delivery of protein drugs, nucleic acid drugs, and extracellular vesicles (see: Kang S, Shi X, Chen Y, Zhang L, Liu Q, Lin Z, LuH, Pan H. Injectable decellularized Wharton's jelly hydrogel containing CD56+umbilical cord mesenchymal stem cell-derived exosomes for meniscus tearhealing and cartilage protection. Mater Today Bio. 2024 Sep 19;29:101258.doi: 10.1016 / j.mtbio.2024.101258.). Based on these common knowledge, those skilled in the art can prepare the engineered exosomes described in this invention into corresponding biomaterials or preparations without creative effort, and reasonably expect them to have sustained-release, local retention and synergistic effects in scar treatment.
[0247] In summary, this invention focuses on the core pathological link of abnormal collagen deposition in pathological scars, and constructs an engineered exosome based on a CD63 transmembrane domain anchoring strategy. By fusing human matrix metalloproteinases with the CD63 TM4 / CT domain, the endogenous, efficient, and targeted loading of the target protein is achieved through the exosome biogenesis pathway, and the protein is stably encapsulated in the exosome lumen in zymogen form. Through the natural targeting ability of exosomes and the protective effect of the exosome membrane, key technical bottlenecks such as the easy inactivation, poor penetration, and TIMP inhibition of free MMPs are successfully overcome, enabling them to be activated within target cells and exert local collagen degradation. In vitro functional experiments show that the engineered exosomes can be taken up by scar myofibroblasts, significantly reducing the expression of COL1A1, COL3A1, and α-SMA, effectively inhibiting type I collagen deposition, and regulating the type I / III collagen ratio. Simultaneously, the anti-inflammatory and anti-fibrotic effects of MSC exosomes synergistically enhance the scar tissue remodeling capacity.
[0248] Although embodiments of the present invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents. In conclusion, if those skilled in the art, inspired by this description, design similar structural methods and embodiments without departing from the inventive spirit of the invention, such designs should fall within the protection scope of the present invention.
Claims
1. An engineered exosome loaded with a CD63 transmembrane domain-matrix metalloproteinase (MMP) fusion protein, characterized in that, The exosomes are derived from genetically engineered mesenchymal stem cells, and the exosome membrane structure is anchored to a CD63 transmembrane domain-matrix metalloproteinase fusion protein, which contains the following functional domains from the N-terminus to the C-terminus: (1) Targeting anchoring domain; (2) Flexible linker peptides; (3) Functional domain of MMPs effect.
2. The engineered exosomes according to claim 1, characterized in that, The targeting anchoring domain is the fourth transmembrane domain of CD63 and its C-terminal cytoplasmic tail.
3. The engineered exosome according to claim 1, wherein the MMPs effector domain is selected from human matrix metalloproteinases with the natural N-terminal secretory signal peptide and stop codon removed, retaining the propeptide region, catalytic domain, hinge region and heme-binding protein-like domain, having type I and / or type III collagen degradation activity, and located in the inner side of the exosome lumen in the form of zymogen.
4. The engineered exosomes according to claim 1, characterized in that, The functional domains of the MMPs effect are selected from one or more of MMP1, MMP3, MMP8, MMP9 or MMP13.
5. A CD63 transmembrane domain-matrix metalloproteinase fusion protein, characterized in that, The fusion protein comprises, from N-terminus to C-terminus, the following: (1) The amino acid sequence of the targeting anchoring domain shown in SEQ ID NO:1; (2) Flexible linker peptides represented by (GGGGS)n, where n = 2–5; (3) Human MMP effector domains with the natural N-terminal secretory signal peptide and stop codon removed from any of the following amino acid sequences: SEQ ID NO:3, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14 or SEQ ID NO:
16.
6. The fusion protein according to claim 5, characterized in that, The amino acid sequence of the fusion protein is shown in SEQ ID NO:
6.
7. A nucleic acid molecule encoding the fusion protein of claim 5 or 6.
8. The nucleic acid molecule according to claim 7, characterized in that, The nucleic acid molecule comprises, in sequence: (1) the DNA sequence encoding the targeting anchoring domain shown in SEQ ID NO:2; (2) the DNA sequence encoding the (GGGG)n flexible linker peptide, wherein n = 2–5; and (3) the MMP encoding sequence selected from any of the following DNA sequences: SEQ ID NO:4, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15 or SEQ ID NO:
17.
9. The nucleic acid molecule according to claim 8, characterized in that, The DNA sequence encoding the (GGGGS)n flexible linker peptide is shown in SEQ ID NO:5, where n=4.
10. The nucleic acid molecule according to claim 7, characterized in that, The encoding DNA sequence of the nucleic acid molecule is shown in SEQ ID NO:
7.
11. The nucleic acid molecule according to claim 7, characterized in that, The nucleic acid molecule is a coding sequence optimized with human codons, as shown in SEQ ID NO:
8.
12. A method for preparing engineered exosomes according to any one of claims 1–4, comprising the following steps: (1) Construct a nucleic acid molecule encoding the CD63-TM4 / CT-MMPs fusion protein; (2) The nucleic acid molecule is cloned into a lentiviral transfer plasmid vector to obtain a recombinant lentiviral transfer plasmid; (3) Co-transfect packaging cells with recombinant lentiviral transfer plasmid and packaging helper plasmid to obtain recombinant lentiviral particles; (4) Infect mesenchymal stem cells with the recombinant lentiviral particles and screen to obtain genetically engineered mesenchymal stem cells that stably express the fusion protein; (5) Culture the genetically engineered mesenchymal stem cells, collect the culture supernatant, and separate and purify to obtain engineered exosomes.
13. A biomaterial, characterized in that, It comprises engineered exosomes as described in any one of claims 1-4 and biocompatible materials.
14. The biomaterial according to claim 13, characterized in that, The biocompatible material is selected from one or more of the following: (1) Natural polymer materials, including collagen, gelatin, hyaluronic acid, chitosan, alginate or fibroin; (2) Synthesize biodegradable polymer materials, including polylactic acid (PLA), polylactic acid-glycolic acid copolymer (PLGA), and polycaprolactone (PCL). (3) Hydrogel materials, including thermosensitive hydrogels, pH-sensitive hydrogels or in-situ gelling hydrogels.
15. The biomaterial according to claim 18 or 19, characterized in that, The biocompatible material is a carrier system that enables sustained release or localized targeted delivery of exosomes.
16. A biological agent, characterized in that, It includes engineered exosomes as described in any one of claims 1–4 and pharmaceutically acceptable carriers.
17. The biological agent according to claim 16, characterized in that, The formulation is one or more of the following dosage forms: (1) Injectable preparations; (2) Spray; (3) Creams or patches; (4) Gel preparations or hydrogel sustained-release preparations.
18. Use of engineered exosomes according to any one of claims 1-4 or engineered exosomes prepared by the method of claim 12 in the preparation of medicaments for the prevention or treatment of pathological scars.
19. The use according to claim 18, characterized in that, The pathological scars include hypertrophic scars, keloids, post-burn scars, post-surgical scars, or post-traumatic fibrosis.