One-step long-chain dna parallel synthesis method based on nucleic acid framework spatial programming

A one-step parallel synthesis method for long DNA using nucleic acid framework space programming solves the problems of length versus fidelity, low throughput, and high cost in long DNA synthesis, achieving efficient, parallel, and low-cost long DNA synthesis.

CN122104840APending Publication Date: 2026-05-29RENJI HOSPITAL AFFILIATED TO SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610572233.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-28
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing methods for synthesizing long DNA chains suffer from problems such as a contradiction between length and fidelity, low throughput, high cost, and complex processes, making it difficult to achieve low-cost, large-scale parallel synthesis.

Method used

A one-step parallel synthesis method for long-chain DNA based on nucleic acid framework spatial programming is adopted. The nucleic acid framework template is prepared, hybridized with an oligonucleotide pool, and incubated under preset conditions. Nucleic acid ligase is used to achieve rapid ligation of oligonucleotides to form long single-stranded nucleic acid products. Subsequently, PCR amplification can be optionally performed to obtain long double-stranded DNA.

Benefits of technology

It enables efficient and parallel long-chain DNA synthesis, improving synthesis efficiency and fidelity, reducing material and labor costs, and making it suitable for large-scale applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104840A_ABST
    Figure CN122104840A_ABST
Patent Text Reader

Abstract

The application discloses a one-step long-chain DNA parallel synthesis method based on nucleic acid framework space programming, and belongs to the fields of molecular biology and DNA nanotechnology. The method comprises the following steps: preparing a nucleic acid framework structure template with a specific template chain, wherein the nucleic acid framework structure is a two-dimensional or three-dimensional DNA assembly precisely programmed in space position; hybridizing the nucleic acid framework structure template with an oligonucleotide pool to form an assembly; and adding a nucleic acid ligase to sequentially connect the oligonucleotides, thereby obtaining a long-chain nucleic acid product. The application utilizes the nucleic acid framework structure to fix the precise position of the oligonucleotides, improves the local concentration and sequencing accuracy, and realizes one-step efficient connection. The application solves the problems of low fidelity, small flux and high cost in long-chain nucleic acid synthesis in the prior art, has the advantages of high synthesis efficiency, high fidelity, high-throughput parallel synthesis, strong scalability and the like, and is suitable for the fields of synthetic biology, genetic engineering and biological medicine research and development.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and DNA nanotechnology, specifically to a one-step parallel synthesis method for long-chain DNA based on nucleic acid framework spatial programming. Background Technology

[0002] The synthesis of long-chain DNA (typically referring to DNA longer than 1,000 base pairs, kb) is a core technology in synthetic biology, genetic engineering, and biomedical research and development. Currently, the main technical approach for synthesizing long-chain DNA relies on the chemical-enzymatic method, the core idea of ​​which is to first obtain short-chain oligonucleotides through chemical synthesis, and then splice them into long chains through enzymatic reactions.

[0003] The current mainstream method is column-based oligonucleotide assembly, which involves the following steps: First, a series of short oligonucleotides of 30-120 bases are synthesized on an automated synthesizer using the solid-phase phosphoramide method; then, these fragments are assembled into longer double-stranded DNA using Gibson assembly or polymerase cycle assembly reaction (PCA); for ultra-long sequences, secondary assembly is required using multi-step restriction endonuclease cloning or Gibson assembly.

[0004] Existing methods for synthesizing long DNA chains have the following significant shortcomings: a. Length vs. Fidelity: As the synthetic chain length increases, the error sequence index accumulates. To obtain an accurate 1kb long DNA chain, it is usually necessary to perform time-consuming and expensive cloning, sequencing, and error correction on the assembled product, a cumbersome process that can take several weeks.

[0005] b. Constraints of throughput and cost: To obtain an accurate long chain, a large number of overlapping short chains need to be synthesized and undergo multi-level biological assembly and screening. The overall material and labor costs are still high, making it difficult to achieve low-cost, large-scale parallel synthesis. Moreover, a single tube reaction can only generate one long chain DNA.

[0006] Therefore, there is an urgent need in this field for a new method that can directly, in parallel and with high fidelity synthesize specified long-chain nucleic acids to overcome the fundamental limitations of existing technical approaches in terms of efficiency, cost and complexity. Summary of the Invention

[0007] To address the shortcomings of existing technologies, this invention aims to provide a one-step parallel synthesis method for long-chain DNA based on nucleic acid framework space programming, enabling rapid, efficient, high-fidelity, and parallel synthesis of long-chain nucleic acids. This solves the technical problems existing in current long-chain nucleic acid synthesis methods, such as the contradiction between length and fidelity, low throughput, high cost, and complex processes.

[0008] To achieve the above objectives, the present invention adopts the following technical solution: A one-step parallel synthesis method for long-chain DNA based on nucleic acid framework spatial programming includes the following steps: S1. Prepare a nucleic acid framework structure template, wherein the nucleic acid framework structure template includes a nucleic acid framework structure and a specific template strand attached to the nucleic acid framework and having a target oligonucleotide sequence; S2. Mix the nucleic acid framework template with the oligonucleotide pool and incubate under preset conditions to allow the oligonucleotides to hybridize with the specific template strands on the nucleic acid framework template to form a nucleic acid framework template-oligonucleotide assembly. S3. Add nucleoligase to the assembly solution and incubate at a specific temperature and time to allow the hybridized oligonucleotides on the template to be sequentially linked, resulting in a long single-stranded nucleic acid product.

[0009] A one-step synthesis method refers to the ligation reaction from an oligonucleotide pool to long single-stranded DNA being completed in one step in a single reaction tube, without the need for intermediate purification.

[0010] Optionally, the synthesis method further includes step S4: the long nucleic acid product is used as a template for PCR amplification, and the long double-stranded DNA product is obtained after gel recovery. Before PCR amplification, forward and reverse primers are designed based on the known sequences at both ends of the target long nucleic acid, and then PCR amplification is performed.

[0011] Furthermore, the nucleic acid framework structure is a DNA assembly with a two-dimensional or three-dimensional nanostructure, formed by folding one or more long single-stranded DNA strands as a backbone, and its spatial morphology, size and functional position are precisely programmed.

[0012] In some embodiments, the nucleic acid framework structure includes a tetrahedral nucleic acid framework structure and a rectangular origami nucleic acid framework structure.

[0013] In some embodiments, the preparation of the nucleic acid framework template in step S1 employs a temperature gradient annealing procedure: starting at 95°C, the temperature is slowly reduced to 4°C at a rate of -3°C / 1 min, and the annealing buffer is 1×Tris-Mg. 2+ A buffer solution comprising 40 mM Tris, 12.5 mM MgCl2, and pH 8.0.

[0014] In some embodiments, in step S2, the molar ratio of the nucleic acid framework template to each oligonucleotide in the oligonucleotide pool is less than 1:1, the incubation temperature is 37°C, and the incubation time is 30 minutes.

[0015] In some embodiments, the incubation temperature in step S3 is 22°C, the incubation time is 10 minutes, and after the ligation reaction is completed, the enzyme is heated at 65°C for 10 minutes to denature and terminate the reaction.

[0016] In some embodiments, step S3 further includes a separation and recovery process for long single-stranded nucleic acid products: the long single-stranded nucleic acid products are separated by denaturing PAGE electrophoresis, and the long single-stranded nucleic acid products are recovered by gel cutting using a PAGE gel DNA recovery kit.

[0017] In some embodiments, the PCR amplification in step S4 is performed using a high-fidelity DNA polymerase, and the long double-stranded DNA product is obtained by gel recovery after amplification.

[0018] In some embodiments, the nucleic acid ligase in step S3 is selected from any one of T4 DNA ligase, Taq DNA ligase, or Tth DNA ligase; preferably, the nucleic acid ligase is T4 DNA ligase.

[0019] The beneficial effects of this invention are as follows: 1) High synthesis efficiency: The nucleic acid framework template pre-fixes all short chains involved in assembly at precise relative positions, greatly increasing local concentration and ensuring correct sequencing, achieving efficient, one-step enzymatic ligation or extension. It eliminates the need for multiple independent annealing-ligation cycles, and can complete the assembly and ligation of all oligonucleotides in one step in the same reaction system, significantly shortening the synthesis cycle.

[0020] 2) High fidelity: The ordered positioning of the frame reduces the possibility of incorrect assembly. For complex sequences (such as repetitive sequences), the precise constraints of the frame can overcome the problem of easy errors in traditional assembly, without the need for cumbersome cloning, sequencing and error correction steps.

[0021] 3) High-throughput parallel synthesis: Each nucleic acid framework template can independently complete the synthesis of one long chain, and the framework can be prepared on a large scale and uniformly through self-assembly, enabling the simultaneous synthesis of massive amounts of long DNA chains, breaking through the limitation of traditional single-tube reactions that can only generate one long DNA chain.

[0022] 4) High scalability: The oligonucleotide assembly synthesis capability of this method is only limited by the number of template chains that can be designed on the nucleic acid framework structure, and the efficiency and accuracy of capturing and assembling multiple short-chain oligonucleotides are not limited by the structure and size of the nucleic acid framework.

[0023] 5) Low cost: It eliminates the need to synthesize a large number of overlapping short chains and undergo multi-level biological assembly and screening, reducing material and labor costs and making it suitable for large-scale applications.

[0024] The above description is merely an overview of the technical solution of the present invention. In order to better understand the technical means of the present invention and to implement it in accordance with the contents of the specification, the preferred embodiments of the present invention are described in detail below with reference to the accompanying drawings. Attached Figure Description

[0025] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, some of the drawings in the following description are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0026] Figure 1 This is a schematic diagram illustrating the principle of the long-chain nucleic acid synthesis method based on a tetrahedral nucleic acid framework template as described in this invention.

[0027] Figure 2 PAGE characterization of the assembly and synthetic product based on the tetrahedral nucleic acid framework template shown in Example 2 of this invention.

[0028] Figure 3 This is a grayscale peak diagram of the denaturing PAGE of the assembly and synthetic product based on the tetrahedral nucleic acid framework template shown in Example 2 of the present invention.

[0029] Figure 4 AFM characterization of the synthetic product based on the tetrahedral nucleic acid framework template shown in Example 2 of this invention.

[0030] Figure 5 This is a schematic diagram of a one-pot parallel long-chain nucleic acid synthesis method based on a tetrahedral nucleic acid framework template.

[0031] Figure 6 This is the electrophoretic characterization of the one-pot parallel long-chain nucleic acid synthesis based on a tetrahedral nucleic acid framework template, as shown in Example 3 of the present invention.

[0032] Figure 7 This is a schematic diagram and electrophoretic characterization of the nucleic acid synthesis method based on various nucleic acid framework structure templates shown in Embodiment 4 of the present invention.

[0033] Figure 8 This is an electrophoretic characterization of DNA synthesis based on a tetrahedral nucleic acid framework template under a trace template, as shown in Example 5 of the present invention. Detailed Implementation

[0034] To better describe the present invention, specific embodiments are provided below for further explanation. Unless otherwise specified, the methods in the following embodiments are conventional methods.

[0035] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field; unless otherwise specified, the reagents or materials described are all from commercial sources.

[0036] The following examples pertain to the intermediate compounds and final products identified in the specification and synthetic regimens. The preparation of the compounds of the present invention is described in detail using the following examples, but the described chemical reactions are disclosed in accordance with their general applicability to the preparation of the compounds of the present invention. Sometimes, the reactions may not be applicable to every compound within the scope of the present invention as described. Compounds in which this may occur are readily identifiable to those skilled in the art. In these cases, the reactions can be successfully carried out with conventional modifications known to those skilled in the art. In all preparation methods, all starting materials are known or can be readily prepared using known starting materials. All temperatures are given in degrees Celsius, and unless otherwise explicitly stated, all parts and percentages are in moles when referring to yields, and all parts are in volumes when referring to solvents and eluents.

[0037] The nucleotide sequences involved in this application are submitted in electronic sequence listing form, the contents of which are incorporated herein by reference. The SEQ ID No. of each nucleic acid sequence used in the following examples is indicated in the text.

[0038] Example 1: Preparation of a tetrahedral nucleic acid framework template with specific template strand modifications 1.1 Reagents and Instruments: Nucleic acid strands: 20 strands (4 strands of each type) required for the synthesis of 5 types of 20bp tetrahedral nucleic acid framework templates (20bp TDF), 8 strands required for the synthesis of 37bp tetrahedral nucleic acid framework templates (37bp TDF), backbone strands and 226 staple strands required for the synthesis of rectangular origami nucleic acid framework templates (DNA origami) (sequence reference 1), related 5' phosphorylation modified oligonucleotides, and amplification primers were all synthesized at Sangon Biotech (Shanghai) Co., Ltd. The sequences of the above nucleic acid strands are shown in the sequence listing.

[0039] Enzymes: T4 DNA ligase (Thermo Fisher Scientific), Platinum TM SuperFi II DNA polymerase (Thermo Fisher Scientific); Reagent kits: PAGE gel DNA recovery kit (Beyotime Biotechnology Co., Ltd.), DNA gel recovery kit (Beyotime Biotechnology Co., Ltd.); Instruments: UV-Vis spectrophotometer (Carry-100, Agilent Technologies), PCR instrument C100 (Bio-Rad), gel electrophoresis system PowerPac (Bio-Rad), atomic force microscope imaging system (AFM, Oxford, Cypher ES).

[0040] 1.2 Preparation method: 1.2.1 Four DNA strands (A20.p-L10, B20.p-L10, C20.p-L10, D20.p-L10, with sequences shown in SEQ ID No. 1~4, respectively) were added to 1×Tris-Mg in equal molar ratios. 2+ The solution was placed in a buffer solution (40 mM Tris, 12.5 mM MgCl2, pH 8.0). The above solution was then subjected to a temperature gradient annealing program in a PCR instrument: starting at 95 °C, the temperature was slowly reduced to 4 °C at a rate of -3 °C / 1 min to obtain a structurally complete tetrahedral nucleic acid framework template ①.

[0041] The template strand is a portion of the four DNA strands used to synthesize the framework, specifically: In A20.p-L10 (SEQ ID No. 1): a. CCTGCTGGTAAACTTCTTTA, b. CAACAGCACCAGAGTCTTCG; In B20.p-L10 (SEQ ID No. 2): c. CCAGGATTTTTTGCAACAGT, d. TAGCTTTCGGGATACGTTTG; In C20.p-L10 (SEQ ID No.3): e. TGATACCGTTCGGTTTAGCC, f.GGTTGTAAGCTTCACGGTAG; In D20.p-L10 (SEQ ID No. 4): g. ATTTACGAACACGGGTACGG, h. CAACCAGTTTGTTGATACCC.

[0042] 1.2.2 Replace the four DNA strands with: ②A711-9, C711-9, D711-9, and B711-9 (their sequences are shown in SEQ ID No. 34~37, respectively); repeat the above operation to obtain the tetrahedral nucleic acid framework template ②. The template strand is a partial region on the four DNA strands used to synthesize the framework, specifically: In A711-9 (SEQ ID No. 34): a. GTTCGCGTCTGTAATGGAGC, b. GACGTGGCCGACTCGAACAC; In C711-9 (SEQ ID No. 35): c. ACCTGGTACGTTGGATGGTC, d. CCTCAATTGGGCTAGATGCT; In D711-9 (SEQ ID No. 36): e. CTCTGTAACACATACAGTAA, f.ACCCTAGGTATCATTAAAGA; In B711-9 (SEQ ID No. 37): g. GCCGTCTTTCTAATCCGTGC, h. CTCCGGTTCCGACGTCGTTT.

[0043] 1.2.3 Replace the four DNA strands with: ③A20.p-1, C20.p-1, D20.p-1, and B20.p-1 (their sequences are shown in SEQ ID No. 49~52, respectively); repeat the above operation to obtain the tetrahedral nucleic acid framework template ③. The template strand is a partial region on the four DNA strands used to synthesize the framework, specifically: In A20.p-1 (SEQ ID No. 49): a. CTCTTCTCTTTCCCTCTTCC, b.TTGCTCCTGTTTTCAGTTAC; In C20.p-1 (SEQ ID No. 50): c. AACCAGCGCGCTACCGAAAT, d. CTTTGATCGTTTTCTCCCCT; In D20.p-1 (SEQ ID No. 51): e. ATCAAAGTCAAACACGCCAG, f. CCAAAACCGGATAATTCATA; In B20.p-1 (SEQ ID No. 52): g. TATTCCTGCACCCTTGCCCT, h. CTACAGGTCGTCGAATCGAG.

[0044] 1.2.4 Replace the four DNA strands with: ④A711-3, C711-3, D711-3, and B711-3 (their sequences are shown in SEQ ID No. 100~103, respectively); repeat the above operation to obtain the tetrahedral nucleic acid framework template ④. The template strand is a partial region on the four DNA strands used to synthesize the framework, specifically: In A711-3 (SEQ ID No. 100): a. AGGCCTTCTTCAGGCCTGAA, b. CCACGTGTGGTTTGCCACCT; In C711-3 (SEQ ID No. 101): c.TATGGTGGTGGTTTGCTTTG, d.ACAACAAACGCTAGCCATTA; In D711-3 (SEQ ID No. 102): e. TTACGGTCAGTCCTCCATCC, f. CTCACCACACCGCTGAACGC; In B711-3 (SEQ ID No. 103): g. TAAGAACTACACCAACTTGG, h. AGACTTAGTGAATTACGCCT.

[0045] Example 2: Synthesis of long-chain nucleic acids based on tetrahedral nucleic acid framework templates See Figure 1 Using the method shown in Example 1, four tetrahedral nucleic acid framework template strands modified with template strands were self-assembled to obtain a tetrahedral nucleic acid framework template, which was used to guide the orderly assembly of oligonucleotides and the synthesis of long-chain DNA. The specific assembly and synthesis principles are as follows: It should be noted that in this invention, the number of template strands can be less than the number of oligonucleotides. This is because the hybridization regions of adjacent oligonucleotides on the template strand partially overlap, and one template strand can simultaneously guide the positioning of the 3' and 5' ends of two adjacent oligonucleotides, thereby achieving sequential ligation. Furthermore, the oligonucleotides at both ends can form a complete chain after ligation through their unhybridized terminal sequences. Therefore, even if the number of template strands is less than the number of oligonucleotides, the method of this invention can still achieve long-chain synthesis efficiently and specifically.

[0046] 2.1 Assembly Formation: The tetrahedral nucleic acid framework template prepared in Example 1 was mixed with a corresponding oligonucleotide pool containing 9 oligonucleotides in water at a molar ratio of less than 1:1 (e.g., 100 nM: 300 nM), and incubated at 37°C for 30 minutes to allow the oligonucleotides to specifically hybridize with the template strands on the tetrahedral nucleic acid framework template to form a "nucleic acid framework template-oligonucleotide assembly". Figure 2 As shown in the PAGE grayscale quantitative peak diagram on the right side, when 3-9 oligonucleotides are added, uniform and complete assemblies are formed without obvious impurities; at the same time, Figure 2 The AFM characterization image on the left side of the image visually presents the three-dimensional structural morphology of the assembly, further confirming that the tetrahedral nucleic acid framework template has the ability to guide the efficient and orderly assembly of multiple oligonucleotides.

[0047] 2.2 Oligonucleotide Ligation and Single-Stranded Product Recovery: T4 ligase was added to the pre-assembled assembly solution, and the mixture was incubated at 22°C for 10 minutes to allow the hybridized oligonucleotides on the template to ligate sequentially, forming a long-chain nucleic acid product. The reaction was terminated by heating at 65°C for 10 minutes to denature the enzyme. Denaturing PAGE electrophoresis was used to separate the product bands, and the gel was excised using a PAGE gel DNA recovery kit to obtain the long single-stranded DNA product. Figure 3As shown in the denaturing PAGE grayscale peak diagram, 3-9 oligonucleotides can be sequentially linked to form single-stranded DNA products of corresponding lengths. The product bands are concentrated, with no obvious degradation or erroneous ligation products, demonstrating the high efficiency and specificity of the ligation reaction.

[0048] Repeat the above steps, using the following tetrahedral nucleic acid framework template and corresponding oligonucleotide pool combinations, to synthesize five long single-stranded DNA strands of different lengths: 450bp, 711bp, 735bp, 810bp, and 1056bp. 1) A 450bp DNA was synthesized using a tetrahedral nucleic acid framework template ① and F450-1~9 (the sequences of which are shown in SEQ ID No. 5~13, respectively); 2) Tetrahedral nucleic acid framework template ② and F711-1~9 (the sequences of which are shown in SEQ ID No. 38~46 respectively) were used to synthesize 711bp DNA; 3) Tetrahedral nucleic acid framework template ③ and F735-1~9 (the sequences of which are shown in SEQ ID No. 53~61 respectively) were used to synthesize 735bp DNA; 4) Tetrahedral nucleic acid framework template ① and F810-1~9 (the sequences of which are shown in SEQ ID No. 14~22 respectively) were used to synthesize 810bp DNA; 5) A 1056bp DNA was synthesized using the tetrahedral nucleic acid framework template ① and F1056-1~9 (the sequences of which are shown in SEQ ID No. 23~31, respectively).

[0049] 2.3 PCR Amplification and Recovery of Double-Stranded Products: The above-mentioned long single-stranded DNA products were used as templates for PCR amplification. Primers primers primer-1056-FP and primer-1056-RP (sequences shown in SEQ ID No. 32-33) were used for PCR amplification of the 450bp, 810bp, and 1056bp products, respectively; primers primer-711-FP and primer-711-RP (sequences shown in SEQ ID No. 47-48) were used for PCR amplification of the 711bp product, respectively; and primers primer-735-FP and primer-735-RP (sequences shown in SEQ ID No. 62-63) were used for PCR amplification of the 735bp product, respectively. After amplification, the long double-stranded DNA products were recovered by gel extraction using a DNA gel extraction kit. Figure 4The AFM images clearly show five long double-stranded DNA strands of different lengths: 450bp, 711bp, 735bp, 810bp, and 1056bp. The products exhibited uniform structure without significant aggregation or breakage. Sequencing confirmed that the sequences of the 450bp, 711bp, 735bp, 810bp, and 1056bp DNA products were completely consistent with expectations, demonstrating that no cross-contamination or incorrect ligation occurred during parallel synthesis. These results confirm that a complete process using a tetrahedral nucleic acid framework template to guide oligonucleotide assembly, T4 ligase ligation, and PCR amplification can successfully achieve efficient and high-fidelity synthesis of long double-stranded DNA.

[0050] Example 3: One-pot parallel long nucleic acid synthesis based on tetrahedral nucleic acid framework template See Figure 5 The process shown allows for the parallel synthesis of multiple (2 types) long-chain nucleic acids in a single reaction. The specific steps are as follows: 3.1 Assembly Formation: Two tetrahedral nucleic acid framework templates with different designs (designed for 711 bp and 1056 bp long nucleic acids, respectively) were mixed with a pool of 18 oligonucleotides in water at a molar ratio of less than 1:1 (e.g., 100 nM: 300 nM) and incubated at 37°C for 30 minutes. This allowed the tetrahedral nucleic acid framework templates to specifically capture and hybridize the corresponding oligonucleotides, forming two different “nucleic acid framework template-oligonucleotide assemblies”, achieving synchronous and specific binding of different target oligonucleotides. The oligonucleotide pools for 711 bp are F711-1~9 (their sequences are shown in SEQ ID No. 38~46, respectively), and the oligonucleotide pools for 1056 bp are F1056-1~9 (their sequences are shown in SEQ ID No. 23~31, respectively). The template strand sequences on the tetrahedral nucleic acid framework template ② (for 711 bp) and template ① (for 1056 bp) used in this embodiment are as described in Example 1.

[0051] 3.2 Oligonucleotide ligation: T4 ligase was added to the above assembly solution and incubated at 22°C for 10 minutes to allow oligonucleotides hybridized on different templates to be sequentially ligated to form two different long-chain nucleic acid products of 711nt and 1056nt. The reaction was terminated by heating at 65°C for 10 minutes to denature the enzyme, thus successfully achieving the parallel synthesis of multiple long-chain nucleic acids in one reaction.

[0052] 3.3 PCR Amplification and Product Recovery: Three PCR reaction systems were prepared using the ligation mixture as a template: System 1 was equipped with primer-711-FP and primer-711-RP (their sequences are shown in SEQ ID No. 47~48, designed only for the 711bp product); System 2 was equipped with primer-1056-FP and primer-1056-RP (their sequences are shown in SEQ ID No. 32~33, designed only for the 1056bp product); and System 3 was equipped with both of the above primer pairs. Platinum SuperFi II premix was added to each system. Nucleic acid amplification was performed in a PCR instrument, and the final product was obtained by gel extraction using a DNA gel extraction kit.

[0053] like Figure 6 As shown ( Figure 4 This is an electrophoretic characterization image of one-pot parallel long nucleic acid synthesis based on a tetrahedral nucleic acid framework template, where M is the molecular weight standard, and the band sizes from top to bottom are 1.5 kbp, 1000 bp, and 600 bp. Lane 1 (711 only): 711bp positive control; Lane 2 (1056 only): 1056bp positive control; Lane 3 (parallel of 711 & 1056): Only primer-711 was added, resulting in a specific band of 711 bp with no extraneous bands; Lane 4 (parallel of 711 & 1056): Only primer-1056 was added, resulting in a specific band of 1056 bp with no extraneous bands; Lane 5 (parallel of 711 & 1056): Two specific bands, 711 bp and 1056 bp, appear simultaneously, and the band brightness is uniform, indicating that the synthesis efficiency of the two products is comparable.

[0054] The electrophoresis results confirmed that the tetrahedral nucleic acid framework template can be specifically captured from the pool of mixed oligonucleotides. Through T4 ligase ligation and targeted PCR amplification, a one-pot parallel synthesis of long nucleic acids based on the tetrahedral nucleic acid framework template was successfully achieved, and the product had high specificity.

[0055] Example 4: Nucleic acid synthesis based on multiple nucleic acid framework templates 4.1 Nucleic Acid Framework Template Design and Assembly Formation: Three different types of nucleic acid framework templates were designed: 1) A 20bp tetrahedral nucleic acid framework template (composed of four strands A20.p-10, B20.p, C20.p, and D20.p, with sequences shown in SEQ ID No. 64~67): a specific template strand is extended from one of its four vertices. The template strand is a portion of the four DNA strands used to synthesize the framework; two template strands are provided, specifically: In A20.p-10 (SEQ ID No. 64): a. AGAAAACGCAAACAACAACC, b. CTTCTTCAACCTGAGCGTAG; B20.p (SEQ ID No. 65), C20.p (SEQ ID No. 66), and D20.p (SEQ ID No. 67) do not have template chain extensions designed.

[0056] 2) A 37bp tetrahedral nucleic acid framework template (composed of 8 strands A1-37-s110, A2-37-s210, B1-37, B2-37, C1-37, C2-37, D1-37, and D2-37, with sequences shown in SEQ ID No. 68~75): a specific template strand is extended from one of its four vertices. The template strand is a portion of the 8 DNA strands used to synthesize this framework, and two template strands are provided, specifically: In A1-37-s110 (SEQ ID No. 68): a. AGAAAACGCAAACAACAACC; In A2-37-s210 (SEQ ID No. 69): b. CTTCTTCAACCTGAGCGTAG; The remaining chains (B1-37, B2-37, C1-37, C2-37, D1-37, D2-37) have no template chain extension.

[0057] 3) A rectangular origami-like nucleic acid framework template (composed of one backbone strand and 226 staple strands, some of which are stp10, S1-155 stp10, S1-154-S2 stp10, 153-S2, S1-148 stp10, S1-147-S2 stp10, 146-S2 stp10, 64-S2 stp10, S1-63-S2 stp10, S1-62 stp10, 71-S2 stp10, S1-70-S2 stp10, and S1-69 stp10, with sequences shown in SEQ ID No. 76~87 respectively; the remaining backbone and staple strands are the same as the corresponding staples in Reference 1): Eight sets of specific template strands extend from its staple strand. The template strands are specific regions on some of the staple strands, specifically: In S1-155 stp10 (SEQ ID No.76): a. AGAAAACGCAAACAACAACC; In S1-154-S2 stp10 (SEQ ID No.77): b. AGAAAACGCAAACAACAACC, c.CTTCTTCAACCTGAGCGTAG; 153-S2 (SEQ ID No. 78): d. CTTCTTCAACCTGAGCGTAG; In S1-148 stp10 (SEQ ID No. 79): e. AGAAAACGCAAACAACAACC; In S1-147-S2 stp10 (SEQ ID No.80): f. AGAAAACGCAAACAACAACC, g.CTTCTTCAACCTGAGCGTAG; 146-S2 stp10 (SEQ ID No.81): h. CTTCTTCAACCTGAGCGTAG; 64-S2 stp10 (SEQ ID No.82): i. CTTCTTCAACCTGAGCGTAG; In S1-63-S2 stp10 (SEQ ID No. 83): j. AGAAAACGCAAACAACAACC, k. CTTCTTCAACCTGAGCGTAG; In S1-62 stp10 (SEQ ID No.84): l. AGAAAACGCAAACAACAACC; 71-S2 stp10 (SEQ ID No.85): m. CTTCTTCAACCTGAGCGTAG; In S1-70-S2 stp10 (SEQ ID No.86): n. AGAAAACGCAAACAACAACC, o.CTTCTTCAACCTGAGCGTAG; In S1-69 stp10 (SEQ ID No. 87): p. AGAAAACGCAAACAACAACC.

[0058] The three nucleic acid framework templates mentioned above were mixed in solution with oligonucleotide pools containing three oligonucleotides (T1, T2, and T3, the sequences of which are shown in SEQ ID No. 88~90, respectively), so that the molar ratio of nucleic acid framework templates to oligonucleotide pools was less than 1:1 (e.g., 100nM: 300nM). The mixtures were incubated at 37°C for 30 minutes to allow the oligonucleotides to specifically hybridize with the template strands on each nucleic acid framework template to form the corresponding "nucleic acid framework template-oligonucleotide assembly".

[0059] 4.2 Oligonucleotide Ligation and Product Recovery: T4 ligase was added to each of the three assembly solutions described above, and the mixture was incubated at 22°C for 10 minutes to allow the three hybridized oligonucleotides on the template to be sequentially ligated to form the target single-stranded DNA product. The reaction was terminated by heating at 65°C for 10 minutes to denature the enzyme. The product bands were separated by denaturing PAGE electrophoresis, and the single-stranded DNA product was recovered by gel extraction using a PAGE gel DNA recovery kit.

[0060] like Figure 7 As shown in the denaturing PAGE images, specific peaks consistent with the target single-stranded DNA length appeared in the electrophoresis lanes corresponding to the three different nucleic acid framework templates. These peaks were sharp and free of obvious impurities, indicating that the orderly assembly and ligation of three oligonucleotides could be efficiently guided on the three different nucleic acid framework templates (20bp tetrahedral, 37bp tetrahedral, and rectangular origami-style templates), successfully achieving single-stranded DNA synthesis. This result confirms that the synthesis method of this invention has good design versatility on different nucleic acid framework templates, and its efficiency and accuracy in capturing and assembling oligonucleotides are not limited by the structure and size of the nucleic acid framework.

[0061] Example 5: DNA Synthesis Based on Tetrahedral Nucleic Acid Framework Templates Using Micro-Temperature Templates To evaluate the lower limit of sensitivity for synthesizing long nucleic acids using the method of this invention, and to verify the synthesis efficiency with trace templates and the impact of parallel synthesis on trace template synthesis, this embodiment uses a tetrahedral nucleic acid framework structure as a template to conduct concentration gradient synthesis experiments on 711bp long nucleic acids. Two sets of experiments were set up: individual synthesis and parallel synthesis of 450bp / 711bp nucleic acids. The specific operations and results are as follows: 5.1 Experimental Procedure: Tetrahedral nucleic acid framework templates with concentration gradients ranging from 0.02 to 10 nM were mixed with oligonucleotide pools (DS711-3-1~9, their sequences shown in SEQ ID No. 91~99) at a molar ratio of 1:3 and incubated at 37°C for 30 minutes. This allowed the tetrahedral nucleic acid framework templates to capture corresponding oligonucleotides through specific hybridization, forming a "tetrahedral nucleic acid framework template-oligonucleotide assembly". Subsequently, T4 DNA ligase was added to the system, and the reaction was carried out at 22°C for 10 minutes, allowing the hybridized oligonucleotides on the template to be sequentially ligated to form a 711 bp long chain product. After the reaction, the mixture was heated at 65°C for 10 minutes to inactivate the enzyme and terminate the ligation reaction. The tetrahedral nucleic acid framework template used in this example is template ④ from Example 1, and its template strand sequence is as described in Example 1.

[0062] Using the above-mentioned ligation product as a template, Platinum was used. TM PCR amplification was performed using SuperFi II DNA polymerase. Separate amplification groups were set up: a single amplification group (detecting only the 711bp product) and a parallel synthesis amplification group (simultaneously synthesizing 450bp and 711bp long nucleic acids in the same system; the 450bp synthesis used a tetrahedral nucleic acid framework template ① and oligonucleotide pools F450-1~9 (their sequences are shown in SEQ ID Nos. 5~13, respectively), while the 711bp product was amplified and detected separately). Electrophoresis was used to characterize the synthesis of the target long chain. The PCR amplification of the 711bp product used primers primer-711-FP and primer-711-RP (their sequences are shown in SEQ ID Nos. 47~48, respectively).

[0063] 5.2 Experimental Results: As shown in Figure 8a (PCR amplification results alone), when the concentration of the tetrahedral nucleic acid framework template was reduced to 50 pM, a weak 711 bp PCR product band could still be observed, indicating that the method of the present invention can achieve efficient synthesis of long nucleic acids at the picomolar (pM) level, demonstrating extremely high synthesis sensitivity.

[0064] As shown in Figure 8b (PCR amplification results of the 711bp product after parallel synthesis), in the parallel synthesis systems of 450bp and 711bp, a clear target band can still be observed when the concentration of the tetrahedral nucleic acid framework template corresponding to 711bp is reduced to 50 pM. This confirms that the parallel synthesis strategy does not interfere with the synthesis efficiency of trace templates, and that the tetrahedral nucleic acid framework template has excellent structural stability, which is sufficient to support the efficient execution of multiplex reaction systems.

[0065] 5.3 Experimental Conclusions: Tetrahedral nucleic acid framework templates exhibit extremely high structural stability and local oligonucleotide enrichment effects, effectively mediating the assembly and ligation of long nucleic acids even at the picomolar (pM) level. Based on a synthesis limit estimate of 50 pM, a single-tube synthesis system containing 500 nM template can theoretically support the parallel synthesis of up to 10,000 different nucleic acid sequences, fully demonstrating the enormous application potential of the method of this invention in highly parallelized, high-throughput nucleic acid synthesis.

[0066] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0067] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

[0068] References [1]Yan, Hao et al. Inter-enzyme substrate diffusion for an enzymecascade organized on spatially addressable DNA nanostructures. Journal of the American Chemical Society 134, 12, 5516–5519 (2012).

Claims

1. A one-step parallel synthesis method for long-chain DNA based on nucleic acid framework spatial programming, characterized in that, Includes the following steps: S1. Prepare a nucleic acid framework structure template, wherein the nucleic acid framework structure template includes a nucleic acid framework structure and a specific template strand attached to the nucleic acid framework structure and having a specific oligonucleotide sequence targeting the target; S2. Mix the nucleic acid framework template with the oligonucleotide pool and incubate under preset conditions to allow the oligonucleotides to hybridize with the specific template strands on the nucleic acid framework template to form a nucleic acid framework template-oligonucleotide assembly. S3. Add nucleoligase to the assembly solution and incubate at a specific temperature and time to allow the hybridized oligonucleotides on the template to be sequentially linked, resulting in a long single-stranded nucleic acid product.

2. The one-step parallel synthesis method for long-chain DNA based on nucleic acid framework spatial programming as described in claim 1, characterized in that, The synthesis method further includes step S4: the long-chain nucleic acid product is used as a template for PCR amplification, and the long double-stranded DNA product is obtained after gel recovery.

3. The one-step parallel synthesis method for long-chain DNA based on nucleic acid framework spatial programming as described in claim 1, characterized in that, The nucleic acid framework structure is a DNA assembly with a two-dimensional or three-dimensional nanostructure, formed by folding one or more long single-stranded DNA strands as a backbone, and its spatial morphology, size and functional position are precisely programmed.

4. The one-step parallel synthesis method for long-chain DNA based on nucleic acid framework space programming as described in claim 1, characterized in that, In step S1, the preparation of the nucleic acid framework template uses a temperature gradient annealing procedure: starting at 95°C, the temperature is slowly reduced to 4°C at a rate of -3°C / 1 min, and the annealing buffer is 1×Tris-Mg. 2+ A buffer solution comprising 40 mM Tris, 12.5 mM MgCl2, and pH 8.

0.

5. The one-step parallel synthesis method for long-chain DNA based on nucleic acid framework spatial programming as described in claim 1, characterized in that, At least one tetrahedral nucleic acid framework structure chain has oligonucleotide template chains designed at both ends, the template chains having sequences complementary to the target oligonucleotide partial sequence, for guiding the assembly and ligation of subsequent oligonucleotides.

6. The one-step parallel synthesis method for long-chain DNA based on nucleic acid framework space programming as described in claim 1, characterized in that, In step S2, the molar ratio of the nucleic acid framework template to each oligonucleotide in the oligonucleotide pool is less than 1:1, the incubation temperature is 37°C, and the incubation time is 30 minutes.

7. The one-step parallel synthesis method for long-chain DNA based on nucleic acid framework spatial programming as described in claim 1, characterized in that, In step S3, the incubation temperature is 22℃ and the incubation time is 10 minutes. After the ligation reaction is completed, the enzyme is heated at 65℃ for 10 minutes to denature and terminate the reaction.

8. The one-step parallel synthesis method for long-chain DNA based on nucleic acid framework spatial programming as described in claim 1, characterized in that, Step S3 also includes the separation and recovery of long single-stranded nucleic acid products: the long single-stranded nucleic acid products are separated by denaturing PAGE electrophoresis, and the long single-stranded nucleic acid products are recovered by gel cutting using a PAGE gel DNA recovery kit.

9. The one-step parallel synthesis method for long-chain DNA based on nucleic acid framework spatial programming as described in claim 1, characterized in that, In step S4, PCR amplification is performed using a high-fidelity DNA polymerase, and the long double-stranded DNA product is obtained by gel recovery after amplification.

10. The one-step parallel synthesis method for long-chain DNA based on nucleic acid framework spatial programming as described in claim 1, characterized in that, The nucleic acid ligase mentioned in step S3 is selected from any one of T4 DNA ligase, Taq DNA ligase or Tth DNA ligase.