A genetic detection reagent, kit, detection method and application for predicting myopia susceptibility
By designing specific detection primers and fluorescent probes, and combining them with real-time fluorescent PCR technology, the problem of low accuracy in predicting myopia susceptibility in existing technologies has been solved, enabling efficient assessment and risk identification of myopia susceptibility.
Patent Information
- Application Number
- CN202411739770.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-29
- Publication Date
- 2026-05-29
AI Technical Summary
Existing technologies have low accuracy in predicting myopia susceptibility and are difficult to effectively assess the impact of genetic and environmental factors on myopia risk.
Specific detection primers and fluorescent probes were designed to detect polymorphic sites in the rs524952, rs148443109, rs75714645, rs7290586, rs188276693, and rs1420853 genes. Combined with real-time fluorescent PCR technology, genotypes were identified to assess myopia susceptibility.
It improves the accuracy and efficiency of myopia susceptibility prediction, can identify people at risk of myopia, and guide myopia prevention and control measures.
Smart Images

Figure BDA0005162361000000101 
Figure BDA0005162361000000111 
Figure BDA0005162361000000112
Abstract
Description
Technical Field
[0001] This invention relates to the field of gene mutation detection, and in particular to a gene detection reagent, kit, detection method, and application for predicting susceptibility to myopia. Background Technology
[0002] Myopia, or nearsightedness, is a condition where parallel light rays focus in front of the retina after passing through the eye's refractive system, causing blurred vision. It is the most common refractive error worldwide, and its prevalence has risen dramatically in recent decades, particularly in East and Southeast Asia. It is estimated that by 2050, approximately half the global population will have myopia, with 20% of them developing high myopia (HM). HM is defined as an equivalent spherical refractive power ≤ -5.0 or -6.0, or an axial length > 26.0 mm. HM can lead to several vision-threatening complications, including myopic macular degeneration, cataracts, glaucoma, and retinal detachment. It is reportedly a leading cause of irreversible vision loss and blindness among the elderly in developed Chinese cities such as Beijing and Shanghai.
[0003] Myopia, especially myopia-associated myopia (HM), is characterized by its hereditary and familial aggregation. Genome-wide linkage analysis (GWAS), including 2080 myopic children and adolescents and 4072 non-myopic children and adolescents as controls, identified six nucleotide polymorphisms highly associated with myopia. More than 20 chromosomal loci (MYP loci) and hundreds of candidate genes have been reported to be associated with myopia. These genes are mainly involved in extracellular matrix remodeling (LAMA1 / 2, LUM, COL1A1), neural signal transmission (GJD2, RASGRF1, GRIA4, RBFOX1), retinoic acid metabolism (RDH5, RORB, RGR), ion channel activity (KCNQ5, CACNA1D, KCNJ2), and eye development (PAX6, CTNND2, ZIC2).
[0004] The occurrence of myopia is the result of a complex interaction between genetic susceptibility and environmental exposure. Predicting the genetic susceptibility to myopia allows for personalized assessment of the risk of developing myopia and enables individualized interventions, such as increasing outdoor activity time, controlling diet to avoid close-range reading, and increasing auxiliary treatments to prevent myopia in adolescents.
[0005] Currently, some institutions are using genetic testing methods to detect susceptibility to high myopia. For example, they are using one or more loci in the ZNF644 gene to predict the susceptibility of a sample to high myopia. However, studies have confirmed that only some of these gene mutations are associated with the development of hereditary high myopia. In summary, although there are methods to predict myopia risk through the testing of a specific gene, their effectiveness needs further validation. The predictive accuracy is low, and it is difficult to effectively assess the combined risk of myopia from genetic factors and other factors. Summary of the Invention
[0006] In view of the shortcomings of the prior art described above, the purpose of this invention is to provide a gene detection reagent, kit, detection method and application for predicting myopia susceptibility, so as to solve the problems of the prior art.
[0007] To achieve the above and other related objectives, the first aspect of this application is to provide a detection material for the detection of myopia susceptibility genes in adolescents, including specific detection primers and / or fluorescent probes for detecting polymorphic detection sites of the rs524952, rs148443109, rs75714645, rs7290586, rs188276693, and rs1420853 genes.
[0008] Among them, the specific detection primers for detecting rs524952 include primer pairs with sequences as shown in SEQ ID NO: 1 and SEQ ID NO: 2, and fluorescent probes with wild-type probes with sequences as shown in SEQ ID NO: 13 and mutant probes with sequences as shown in SEQ ID NO: 14.
[0009] The specific detection primers for detecting rs148443109 include primer pairs with sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4, and fluorescent probes including a wild-type probe with a sequence shown in SEQ ID NO: 15 and a mutant probe with a sequence shown in SEQ ID NO: 16.
[0010] The specific detection primers for detecting rs75714645 include primer pairs with sequences shown in SEQ ID NO: 5 and SEQ ID NO: 6, and fluorescent probes including a wild-type probe with a sequence shown in SEQ ID NO: 17 and a mutant probe with a sequence shown in SEQ ID NO: 18.
[0011] The specific detection primers for detecting rs7290586 include primer pairs with sequences shown in SEQ ID NO: 7 and SEQ ID NO: 8, and fluorescent probes including a wild-type probe with a sequence shown in SEQ ID NO: 19 and a mutant probe with a sequence shown in SEQ ID NO: 20.
[0012] The specific detection primers for detecting rs188276693 include primer pairs with sequences shown in SEQ ID NO: 9 and SEQ ID NO: 10, and fluorescent probes including a wild-type probe with a sequence shown in SEQ ID NO: 21 and a mutant probe with a sequence shown in SEQ ID NO: 22.
[0013] The specific detection primers for detecting rs1420853 comprise primer pairs with sequences shown in SEQ ID NO: 11 and SEQ ID NO: 12, and fluorescent probes including a wild-type probe with a sequence shown in SEQ ID NO: 23 and a mutant probe with a sequence shown in SEQ ID NO: 24.
[0014] A second aspect of the present invention provides the use of a test substance for detecting myopia susceptibility genes in adolescents in the preparation of a product for detecting myopia susceptibility in adolescents.
[0015] A third aspect of the present invention provides a kit for detecting myopia susceptibility in adolescents, including a gene detector for detecting myopia susceptibility in adolescents, and also including an internal reference primer and an internal reference probe.
[0016] The fourth aspect of this invention provides the application of a detection reagent for detecting polymorphic sites of the rs524952, rs148443109, rs75714645, rs7290586, rs188276693, and rs1420853 gene in the preparation of a kit for detecting myopia susceptibility in adolescents.
[0017] The fifth aspect of this invention provides a method for detecting myopia susceptibility in adolescents for non-disease diagnosis or treatment purposes, the method using the aforementioned reagent kit and comprising the following steps:
[0018] S1. Provide genotypic detection data of the DNA amplification products at the aforementioned detection sites of the sample to be tested;
[0019] S2. Determine whether the genotype in the data is a risk genotype;
[0020] S3. Assess the susceptibility to myopia in the test samples based on the number of risk genotypes.
[0021] A sixth aspect of the present invention provides a device for predicting the susceptibility of adolescents to myopia, the device comprising the following modules:
[0022] Test data acquisition module: used to acquire the genotype detection data of the DNA amplification product of the detection site as described in claim 1 for the test sample;
[0023] Judgment module: Determines whether the genotype in the data is a risk genotype;
[0024] Prediction module: Assess myopia susceptibility of the test sample based on the number of risk genotypes.
[0025] A seventh aspect of the present invention provides an electronic terminal, including a processor and a memory, wherein the memory is used to store a computer program, and the processor is used to execute the computer program stored in the memory to cause the device to perform the aforementioned method for detecting myopia susceptibility.
[0026] The eighth aspect of the present invention provides a computer-readable storage medium having a computer program stored thereon, wherein the computer program, when processed, performs the aforementioned method for detecting myopia susceptibility.
[0027] The ninth aspect of the present invention provides a computer program product, including a computer program, characterized in that the program, when processed by a processor, executes the aforementioned method for detecting myopia susceptibility.
[0028] As described above, this invention application has the following beneficial effects:
[0029] This invention is the first to discover that the polymorphisms of the aforementioned gene loci rs524952, rs148443109, rs75714645, rs7290586, rs188276693, and rs1420853 are closely related to the susceptibility of adolescents to myopia. By determining the genotype of the aforementioned gene loci in patients, analysis can identify individuals at risk of myopia and provide guidance for myopia prevention and control.
[0030] This invention also designs corresponding PCR primers and probes for each of the above-mentioned gene loci, and establishes corresponding amplification conditions. Using the corresponding primers and probes, the genotype of the corresponding gene loci can be determined by real-time fluorescence PCR technology. Compared with Sanger sequencing, the method of this invention has high accuracy and is simple to operate, which can greatly improve the efficiency of genotype detection. Attached Figure Description
[0031] Figure 1 The diagram shown is a schematic diagram of the device for predicting myopia susceptibility in adolescents according to the present invention;
[0032] Figure 2 The diagram shown is a schematic representation of the electronic terminal of this invention. Detailed Implementation
[0033] To facilitate understanding of the present invention, a more comprehensive description will be provided below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a more thorough and complete understanding of the disclosure of this invention.
[0034] This application provides reagents for the detection of myopia susceptibility genes in adolescents, including specific detection primers and / or fluorescent probes for detecting polymorphic detection sites of the rs524952, rs148443109, rs75714645, rs7290586, rs188276693, and rs1420853 genes.
[0035] Among them, the specific detection primers for detecting rs524952 include primer pairs with sequences as shown in SEQ ID NO: 1 and SEQ ID NO: 2, and fluorescent probes with wild-type probes with sequences as shown in SEQ ID NO: 13 and mutant probes with sequences as shown in SEQ ID NO: 14.
[0036] The specific detection primers for detecting rs148443109 include primer pairs with sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4, and fluorescent probes including a wild-type probe with a sequence shown in SEQ ID NO: 15 and a mutant probe with a sequence shown in SEQ ID NO: 16.
[0037] The specific detection primers for detecting rs75714645 include primer pairs with sequences shown in SEQ ID NO: 5 and SEQ ID NO: 6, and fluorescent probes including a wild-type probe with a sequence shown in SEQ ID NO: 17 and a mutant probe with a sequence shown in SEQ ID NO: 18.
[0038] The specific detection primers for detecting rs7290586 include primer pairs with sequences shown in SEQ ID NO: 7 and SEQ ID NO: 8, and fluorescent probes including a wild-type probe with a sequence shown in SEQ ID NO: 19 and a mutant probe with a sequence shown in SEQ ID NO: 20.
[0039] The specific detection primers for detecting rs188276693 include primer pairs with sequences shown in SEQ ID NO: 9 and SEQ ID NO: 10, and fluorescent probes including a wild-type probe with a sequence shown in SEQ ID NO: 21 and a mutant probe with a sequence shown in SEQ ID NO: 22.
[0040] The specific detection primers for detecting rs1420853 comprise primer pairs with sequences shown in SEQ ID NO: 11 and SEQ ID NO: 12, and fluorescent probes including a wild-type probe with a sequence shown in SEQ ID NO: 23 and a mutant probe with a sequence shown in SEQ ID NO: 24.
[0041] The sequence structures of SEQ ID NO: 1 to 2 are shown below:
[0042] TTATGAGCCCAAAGGAGA(SEQ ID NO.1);
[0043] ATAATGGCCCATCAACAA(SEQ ID NO.2);
[0044] The sequence structures of SEQ ID NO: 3-4 are shown below:
[0045] CCCACCCATCTTGGATAA(SEQ ID NO.3);
[0046] AGTGCCAGCGGGCTTACT(SEQ ID NO.4);
[0047] The sequence structure of SEQ ID NO: 5-6 is as follows:
[0048] CCCAAGCCTTTGTTTTCA(SEQ ID NO.5);
[0049] GGCAATTTACAGCAGCGT(SEQ ID NO.6);
[0050] The sequence structure of SEQ ID NO: 7-8 is shown below:
[0051] AGGCTGGAGTGCAGTGGG(SEQ ID NO.7);
[0052] GAGGCTGAGGCAGGAGAA(SEQ ID NO.8);
[0053] The sequence structures of SEQ ID NO: 9-10 are shown below:
[0054] TCTTTTAAGCACTCCTTTT(SEQ ID NO.9);
[0055] GTGGCAATGAGATGTAGC(SEQ ID NO.10);
[0056] The sequence structures of SEQ ID NO: 11-12 are shown below:
[0057] TCATTCTCATTTCCAATATC(SEQ ID NO.11);
[0058] GAATGTGACTTGCTTTGTT(SEQ ID NO.12);
[0059] The sequence structures of SEQ ID NO: 13-14 are shown below:
[0060] ATGTAGTTTTTAGAATTACCCTCTT(SEQ ID NO: 13);
[0061] ATGTAGTTTATAGAATTACCCTCTT (SEQ ID NO: 14);
[0062] The sequence structures of SEQ ID NO: 15-16 are shown below:
[0063] ACTCTTTTTTTTTTTTTTTTTCATAT (SEQ ID NO: 15);
[0064] ACTCTTTTTTTTTTTTTTTTCATAT (SEQ ID NO: 16);
[0065] The sequence structure of SEQ ID NO: 17-18 is shown below:
[0066] TTTACATCTGTAAAGATTAAGTTAA (SEQ ID NO: 17);
[0067] TTTACATCTGTAAAGGTTAAGTTAA (SEQ ID NO: 18);
[0068] The sequence structures of SEQ ID NO: 19-20 are shown below:
[0069] GATCTCACCTCACTGCAACCTCCAACT (SEQ ID NO: 19);
[0070] GATCTCACCTCACTGCGACCTCCAACT (SEQ ID NO: 20);
[0071] The sequence structures of SEQ ID NO: 21-22 are shown below:
[0072] CAGTTCCCTTAGTAGGCTGAGACACTT (SEQ ID NO: 21);
[0073] CAGTTCCCTTATTAGGCTGAGACACTT (SEQ ID NO: 22);
[0074] The sequence structures of SEQ ID NO: 23-24 are shown below:
[0075] TGATTTAGTACACCACACTAACATC (SEQ ID NO: 23);
[0076] TGATTTAGTACACTACACTAACATC (SEQ ID NO: 24).
[0077] Furthermore, the gene testing reagent is used to predict the risk of myopia susceptibility in adolescents.
[0078] For the specific base sequences of the primer pairs in this application, as long as their respective specific recognition regions can be specifically recognized under PCR conditions (preferably, primers used in a single reaction vessel do not undergo annealing or self-annealing), one or more bases can be replaced with other bases, or one or more bases can be added to the 3' or 5' end. Here, "multiple" means, for example, 2 to 3. When adding one or more bases to the primers, it is preferable to add them to the 5' end of the primers.
[0079] Regarding the length of each primer, there are no particular restrictions as long as it can specifically identify the corresponding specific recognition region and prevent hybridization between primers. Preferably, it is 15 or more bases and 40 or less. More preferably, the lower limit of primer length is 16 or more bases, and even more preferably, it is 17 or more bases. More preferably, the upper limit of primer length is 30 or less bases, and even more preferably, it is 25 or less bases.
[0080] Furthermore, the fluorescent probe is a Taqman probe, with a fluorescent reporter group added to the 5' end and a fluorescent quencher group added to the 3' end. The fluorescent reporter group is selected from one or more of FAM, HEX, TET, JOE, CY3, CY5, ROX, Texas Red, or ROX; the fluorescent quencher group is selected from BHQ or ECLIPSE. In some embodiments, when the fluorescent reporter group is selected from FAM, the fluorescent quencher group is MGB.
[0081] In some specific embodiments, the specific detection primers and fluorescent probes are used in combination. Specifically, a pair of specific detection primers and a pair of fluorescent probes are used in combination. Preferably, the rs524952 specific detection primer and the rs524952 fluorescent probe are used in combination; the rs148443109 specific detection primer and the rs148443109 fluorescent probe are used in combination; the rs75714645 specific detection primer and the rs75714645 fluorescent probe are used in combination; the rs7290586 specific detection primer and the rs7290586 fluorescent probe are used in combination; the rs188276693 specific detection primer and the rs188276693 fluorescent probe are used in combination; and the rs1420853 specific detection primer and the rs1420853 fluorescent probe are used in combination.
[0082] This application also provides the use of a reagent for detecting myopia susceptibility genes in adolescents in the preparation of products for detecting myopia susceptibility genes in adolescents.
[0083] In one embodiment, the product may be one of a reagent kit, chip, membrane strip, protein array, composition, or detection system.
[0084] This application also provides a kit for detecting myopia susceptibility genes in adolescents, including a reagent for detecting myopia susceptibility genes in adolescents.
[0085] Preferably, the gene testing kit is used to predict the risk of myopia susceptibility.
[0086] In some embodiments, the aforementioned kit further includes PCR reagents. These PCR reagents include one or more of the following: PCR reaction buffer, a dNTP mixture, UNG enzyme, surfactant, or preservative. The aforementioned dNTP mixture is typically used as a raw material in DNA synthesis and may specifically include dATP, dGTP, dTTP, dCTP, etc.
[0087] Furthermore, the PCR reaction buffer can be a phosphate buffer. The phosphate buffer provides stable conditions for the enzymatic reaction. The surfactant solubilizes and disperses the solute to promote the enzymatic reaction. The preservative controls the growth of microorganisms in the PCR reaction reagent.
[0088] The phosphate in the phosphate buffer solution is selected from potassium phosphate or sodium phosphate. The potassium phosphate and sodium phosphate are selected from one or more of potassium phosphate, potassium dihydrogen phosphate, dipotassium hydrogen phosphate, sodium phosphate, sodium dihydrogen phosphate, and disodium hydrogen phosphate.
[0089] The surfactant is a substance that contains both hydrophilic and hydrophobic groups, resulting in a significant decrease in the surface tension of the target solution. The surfactant is selected from one or more of stearic acid, sodium dodecylbenzenesulfonate, quaternary ammonium compounds, lecithin, amino acid-type surfactants, betaine-type surfactants, alkyl glucosides, fatty acid glycerides, fatty acid sorbitan, or polysorbates.
[0090] The preservative can be self-produced or a commercially available reagent. Preferably, the preservative is any one or more of the commercially available ProClin series preservatives ProClin 150, 200, 300, or 5000. More preferably, the preservative is ProClin 300.
[0091] This application also provides the application of detection reagents for detecting polymorphic sites of genes rs524952, rs148443109, rs75714645, rs7290586, rs188276693, and rs1420853 in the preparation of a gene detection kit for myopia susceptibility in adolescents.
[0092] Preferably, the application is in the preparation of a kit for detecting genes that predispose adolescents to myopia.
[0093] This application also provides a method for detecting myopia susceptibility genes in adolescents for non-disease diagnosis or treatment purposes. The method uses the aforementioned kit for detection and includes: performing PCR amplification on the extracted DNA using the primers, probes, and PCR reagents, and obtaining the corresponding genotype result based on the amplification product.
[0094] Preferably, it includes the following steps:
[0095] S1. Provide genotypic detection data of the DNA amplification products at the aforementioned detection sites of the sample to be tested;
[0096] S2. Determine whether the genotype in the data is a risk genotype;
[0097] S3. Assess the susceptibility to myopia in the test samples based on the number of risk genotypes.
[0098] In one embodiment, the genotype of the detection site is determined by the following method: if the fluorescence of the wild-type probe shows a logarithmic increase and the Ct value is ≤30.0, then the genotype of the site is wild-type; if the fluorescence of the mutant probe shows a logarithmic increase and the Ct value is ≤30.0, then the genotype of the site is mutant.
[0099] Myopia susceptibility is predicted based on the SNP locus detection results of the individuals to be tested. For SNP locus rs524952, the risk genotype is mutant; for SNP locus rs148443109, the risk genotype is wild-type; for SNP locus rs75714645, the risk genotype is mutant; for SNP locus rs7290586, the risk genotype is wild-type; for SNP locus rs188276693, the risk genotype is mutant; and for SNP locus rs1420853, the risk genotype is wild-type.
[0100] Based on the SNP locus detection results of the individual being tested, the more risk genotypes there are, the stronger the susceptibility to myopia in the adolescent. For example, if the test results show two risk genotypes, the susceptibility to myopia is stronger than if there is only one risk genotype.
[0101] In some implementations, the purpose of non-disease diagnosis or treatment may be scientific research or statistical analysis to explore the molecular characteristics of myopia.
[0102] Preferably, the PCR amplification conditions are as follows: first, pre-denaturation at 95°C for 10 min; then denaturation at 95°C for 10 s; followed by annealing at 60°C for 60 s; for a total of 45 cycles.
[0103] In another aspect, the present invention also provides a device for predicting the susceptibility of adolescents to myopia, such as... Figure 1 As shown, the device includes the following modules:
[0104] Test data acquisition module 11: used to acquire the genotype detection data of the DNA amplification products of the aforementioned detection sites of the test sample;
[0105] Judgment module 12: Determines whether the genotype in the data is a risk genotype;
[0106] Prediction Module 13: Assess myopia susceptibility of the test sample based on the number of risk genotypes.
[0107] It should be noted that the division of the various modules in the above device is merely a logical functional division. In actual implementation, they can be fully or partially integrated into a single physical entity, or they can be physically separated. Furthermore, these modules can be implemented entirely in software via processing element calls; they can be fully implemented in hardware; or some modules can be implemented by processing element calls to software, while others are implemented in hardware. For example, a subdivision module can be a separate processing element, or it can be integrated into a chip in the above device. Alternatively, it can be stored as program code in the memory of the above device, and its functions can be called and executed by a processing element of the device. The implementation of other modules is similar. Moreover, these modules can be fully or partially integrated together, or they can be implemented independently. The processing element mentioned here can be an integrated circuit with signal processing capabilities. In the implementation process, each step of the above method or each of the above modules can be completed through integrated logic circuits in the hardware of the processor element or through software instructions.
[0108] For example, these modules can be one or more integrated circuits configured to implement the above methods, such as one or more Application Specific Integrated Circuits (ASICs), one or more digital signal processors (DSPs), or one or more Field Programmable Gate Arrays (FPGAs). As another example, when a module is implemented using processing element scheduler code, the processing element can be a general-purpose processor, such as a Central Processing Unit (CPU) or other processor capable of calling program code. Furthermore, these modules can be integrated together as a system-on-a-chip (SOC).
[0109] The present invention also provides an electronic terminal, including a processor and a memory, wherein the memory stores a computer program, and the processor executes the computer program stored in the memory to cause the device to perform the aforementioned detection method. Further, as... Figure 2As shown, the computer processing device includes: a processor 21, a memory 22, a communicator 23, a communication interface 24, and a system bus 25; the memory 22 and the communication interface 24 are connected to the processor 21 and the communicator 23 through the system bus 25 and complete mutual communication. The memory 22 is used to store computer programs, the communication interface 24 is used to communicate with other devices, and the processor 21 and the communicator 23 are used to run computer programs to enable the terminal to execute the method.
[0110] The system bus mentioned above can be a Peripheral Component Interconnect (PCI) bus or an Extended Industry Standard Architecture (EISA) bus, etc. This system bus can be divided into address bus, data bus, control bus, etc. For ease of representation, only one thick line is used in the diagram, but this does not indicate that there is only one bus or one type of bus. The communication interface is used to enable communication between the database access device and other devices (e.g., clients, read-write libraries, and read-only libraries). Memory may include Random Access Memory (RAM) and may also include non-volatile memory, such as at least one disk drive.
[0111] The processors mentioned above can be general-purpose processors, including central processing units (CPUs), network processors (NPs), etc.; they can also be digital signal processors (DSPs), application-specific integrated circuits (ASICs), field-programmable gate arrays (FPGAs), or other programmable logic devices, discrete gate or transistor logic devices, or discrete hardware components.
[0112] The present invention also provides a computer-readable storage medium having a computer program stored thereon, wherein the computer program, when processed, performs the aforementioned method for detecting myopia susceptibility.
[0113] Those skilled in the art will understand that all or part of the steps of the above-described method embodiments can be implemented using computer program-related hardware. The aforementioned computer program can be stored in a computer-readable storage medium. When executed, the program performs the steps of the above-described method embodiments; and the aforementioned storage medium includes various media capable of storing program code, such as ROM, RAM, magnetic disks, or optical disks.
[0114] The present invention also provides a computer program product, including a computer program that, when processed by a processor, executes the aforementioned method for detecting myopia susceptibility.
[0115] The present invention will be further described below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of protection of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.
[0116] It should be understood that the terminology used in the embodiments of this invention is for describing specific particular implementations and not for limiting the scope of protection of this invention; in the specification and claims of this invention, unless otherwise expressly stated herein, the singular forms "a," "an," and "this" include the plural forms. When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in this invention, the two endpoints of each numerical range and any value between the two endpoints may be selected.
[0117] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, this invention can be implemented using any prior art methods, apparatus, and materials similar to or equivalent to those described in the embodiments of this invention, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention.
[0118] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in this invention all employ conventional techniques in this and related fields.
[0119] Example 1 - Correlation between rs524952, rs148443109, rs75714645, rs7290586, rs188276693, rs1420853 and myopia
[0120] Selection of polymorphic sites of genes related to myopia susceptibility in adolescents
[0121] This invention first used a whole-genome genotyping method to perform whole-genome genotyping on myopic adolescents (experimental group: 2080 myopic adolescents; control group: 4072 healthy adolescents). Principal component analysis was used to stratify the population and group the samples, ensuring that the genetic backgrounds of the experimental and control groups matched, thus eliminating the influence of inherent population stratification on the results. To improve statistical power, different statistical models were used for common and rare variants. For common variants (minor allele frequency [MAF] ≥ 1%), a fixed-effects model was used. For rare variants, the Cochran-Mantel-Haenszel analysis was used. Six polymorphic loci with a globally positive correlation (P < 5E-08) with susceptibility to myopia in adolescents were identified. These six loci were rs524952, rs148443109, rs75714645, rs7290586, rs188276693, and rs1420853, and their basic information is shown in Table 1 below. Table 2 shows the analysis results of six SNPs for myopia susceptibility. The influence of carrying related alleles on the incidence of myopia was determined by calculating the allele odds ratio (OR).
[0122] Table 1. Basic information of the 6 polymorphic sites
[0123] SNP Chromosome and location information Alleles rs524952 15:35005886 T>A rs148443109 4:96662732 I>D rs75714645 16:86628361 A>G rs7290586 22:27048408 A>G rs188276693 4:133042109 G>T rs1420853 8:113265330 C>T
[0124] Table 2. Analysis results of six SNPs for myopia susceptibility.
[0125]
[0126]
[0127] Primer and probe design
[0128] Primers were designed using Primer software for the above gene loci. Through repeated comparative analysis, the following principles were followed, but not limited to: Primers: 1) Length 17-25 bp; 2) GC content 40-60%; 3) Tm values of the two primers should be as close as possible; 4) Avoid GC-rich or AT-rich regions (especially the 3' end), and avoid T / C or A / G continuity; 5) Avoid T at the 3' end; 6) Use UCSC In-Silico PCR to determine primer specificity; Probes: 1) Length 20-25 bp; 2) Tm value 8-10 °C higher than primers; 3) Select regions with relatively high GC content in the target sequence, avoid GC-rich or AT-rich regions (especially the 3' end), and avoid T / C or A / C continuity; 4) The first base at the 5' end of the probe cannot be G. The final PCR-specific primers and probes were designed, as shown in Table 3 below.
[0129] Table 3 Primers and probes for each gene locus
[0130]
[0131]
[0132] Example 2 - Validation of Correlation
[0133] 1. Research Subjects
[0134] Experimental group: 2080 cases. These 2080 children and adolescents with myopia who did not have myopia-related syndromes such as Stickler's syndrome or Marfan syndrome. In this study, myopia was defined as spherical equivalence ≤ -0.5 diopters (D), while myopia required spherical equivalence ≤ -5 diopters (D) or axial length ≥ 26 mm.
[0135] Control group: 4072 cases. These 4072 cases were non-myopic children and adolescents, and none of them had myopia-related syndromes such as Stickler syndrome or Marfan syndrome. Table 4 records the basic information of the study subjects.
[0136] Table 4. Information on research subjects
[0137] experimental group control group Sample size 2080 4072 Average age (years) 10.35±2.41 9.2±0.69 Female percentage (%) 49.6 46.4
[0138] 2. Association Analysis
[0139] Five ml of peripheral venous blood was drawn from both the experimental and control groups and placed in EDTA Na2 anticoagulant tubes to obtain blood samples. Genomic DNA was extracted from the blood samples using the Flexi Gene DNA Extraction Kit, and the quality of the obtained genomic DNA was detected by standard agarose gel electrophoresis. The concentration of genomic DNA was detected using NanoDrop.
[0140] (1) Genotyping
[0141] Genotyping was performed using real-time fluorescence PCR with the primers and probes described above. Table 5 shows the real-time fluorescence PCR reaction system.
[0142] The specific steps are as follows:
[0143] Step 1: Extract DNA from the sample to be tested and use it as a PCR template;
[0144] Step 2: Provide the kit described above, take out an appropriate amount of PCR reaction solution, the composition of which is shown in Table 5, and mix the PCR reaction solution with an appropriate amount of the PCR template.
[0145] Step 3: Perform PCR amplification reaction. The amplification reaction conditions are as follows: first, pre-denaturation at 95℃ for 10 min; then denaturation at 95℃ for 10 s; followed by annealing at 60℃ for 60 s; for a total of 45 cycles.
[0146] Analysis and judgment of amplification results: In the real-time fluorescence PCR reaction system of the sample, if the fluorescence of the wild-type probe shows a logarithmic increase and the Ct value is ≤30.0, then there is no mutation at that site; if the fluorescence of the mutant probe shows a logarithmic increase and the Ct value is ≤30.0 in the real-time fluorescence PCR reaction system of the sample, then there is a mutation at that site.
[0147] Table 5 Real-time fluorescence PCR reaction system
[0148] reagents Volume (uL) 10×PCR buffer 2.5 DNA (30 ng / uL) 1 dNTP 2 Wild-type probe (10 nmol / mL) 0.5 Mutant probe (10 nmol / mL) 0.5 Forward primer (10 nmol / mL) 0.5 Reverse primer (10 nmol / mL) 0.5 UNG enzyme (5U / uL) 0.25 Ultrapure water 17.25
[0149] (2) Association Analysis
[0150] Prior to the association analysis, quality control was performed on blood samples and SNP levels. Principal component analysis (PCA) was then conducted on the population to examine the fit between the experimental and control groups. After quality control, this study ultimately included 2080 cases in the experimental group and 4072 cases in the control group, with a total of 6 SNPs included in the statistical analysis.
[0151] The genotype frequencies at six loci were statistically analyzed using the Hardy-Weinberg equilibrium test. Genotype frequencies were calculated in both the experimental and control groups using the ratio of mutant / heterozygous / wild-type to the complete genotype. Table 6 shows the genotype frequencies of the six SNPs in the experimental and control groups. The results in Table 6 show that, for the rs524952 genotype, the proportion of mutant individuals was higher in the experimental group than in the control group, while the proportion of wild-type individuals was lower in the experimental group than in the control group; for the two rs148443109 genotypes, the proportion of mutant individuals was lower in the experimental group than in the control group, while the proportion of wild-type individuals was higher in the experimental group than in the control group; for the two rs75714645 genotypes, the proportion of mutant individuals was higher in the experimental group than in the control group, while the proportion of wild-type individuals was higher in the experimental group than in the control group. The proportion of heterozygous individuals in the experimental group was lower than that in the control group; among the two genotypes of rs7290586, the proportion of heterozygous individuals in the experimental group was lower than that in the control group, while the proportion of wild-type individuals in the experimental group was higher than that in the control group; among the two genotypes of rs188276693, the proportion of heterozygous individuals in the experimental group was higher than that in the control group, while the proportion of wild-type individuals in the experimental group was lower than that in the control group; among the two genotypes of rs1420853, the proportion of heterozygous individuals in the experimental group was lower than that in the control group, while the proportion of wild-type individuals in the experimental group was higher than that in the control group. This indicates that all six SNP loci are myopia-related SNP loci.
[0152] Table 6. Allele frequencies (%) of the six SNPs in the experimental and control groups.
[0153]
[0154] Table 6 shows the changes in allele frequencies of six SNPs in the case and control groups. The calculation method was as follows: wild-type gene frequency was obtained from genotyping, and mutant gene frequency was obtained from (1 - wild-type gene frequency). The changes were represented by the difference between wild-type and mutant gene frequencies in the two groups. The results in Table 6 show that the mutant gene frequency of rs524952 was 5.82% higher in the experimental group than in the control group, indicating that the risk genotype of rs524952 is mutant; the mutant gene frequency of rs148443109 was 4.01% lower in the experimental group than in the control group, indicating that the risk genotype of rs148443109 is wild-type; and the mutant gene frequency of rs75714645 was 3.85% higher in the experimental group than in the control group, indicating that the risk genotype of rs75714645 is wild-type. The rs7290586 mutant gene frequency was 5.17% lower in the experimental group than in the control group, indicating that the risk genotype of rs7290586 is wild-type; the rs188276693 mutant gene frequency was 3.38% higher in the experimental group than in the control group, indicating that the risk genotype of rs188276693 is mutant; the rs1420853 mutant gene frequency was 3.91% lower in the experimental group than in the control group, indicating that the risk genotype of rs1420853 is wild-type.
[0155] The above experiments demonstrate that the susceptibility of adolescents to myopia can be predicted using the rs524952, rs148443109, rs75714645, rs7290586, rs188276693, and rs1420853 gene polymorphism detection sites.
[0156] The above embodiments are for illustrating the implementation schemes disclosed in this invention and should not be construed as limiting the invention. Furthermore, various modifications and variations in the methods described herein will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been specifically described in conjunction with various specific preferred embodiments, it should be understood that the invention should not be limited to these specific embodiments. In fact, various modifications that are obvious to those skilled in the art as described above to obtain the invention should be included within the scope of this invention.
Claims
1. A reagent for detecting myopia susceptibility genes in adolescents, comprising specific detection primers and / or fluorescent probes for detecting polymorphic detection sites of the rs524952, rs148443109, rs75714645, rs7290586, rs188276693, and rs1420853 genes.
2. The reagent according to claim 1, characterized in that, The specific detection primers for rs524952 comprise primer pairs with sequences as shown in SEQ ID NO: 1 and SEQ ID NO: 2, and the fluorescent probes for rs524952 comprise a wild-type probe with a sequence as shown in SEQ ID NO: 13 and a mutant probe with a sequence as shown in SEQ ID NO:
14. The specific detection primers for rs148443109 comprise primer pairs with sequences as shown in SEQ ID NO: 3 and SEQ ID NO: 4, and the fluorescent probes for rs148443109 comprise a wild-type probe with a sequence as shown in SEQ ID NO: 15 and a mutant probe with a sequence as shown in SEQ ID NO:
16. The specific detection primers for rs75714645 comprise primer pairs with sequences as shown in SEQ ID NO: 5 and SEQ ID NO: 6, and the fluorescent probes for rs75714645 comprise a wild-type probe with a sequence as shown in SEQ ID NO: 17 and a mutant probe with a sequence as shown in SEQ ID NO:
18. The specific detection primers for rs7290586 comprise primer pairs with sequences as shown in SEQ ID NO: 7 and SEQ ID NO: 8, and the fluorescent probes for rs7290586 comprise a wild-type probe with a sequence as shown in SEQ ID NO: 19 and a mutant probe with a sequence as shown in SEQ ID NO:
20. The specific detection primers for rs188276693 comprise primer pairs with sequences as shown in SEQ ID NO: 9 and SEQ ID NO: 10, and the fluorescent probes for rs188276693 comprise a wild-type probe with a sequence as shown in SEQ ID NO: 21 and a mutant probe with a sequence as shown in SEQ ID NO:
22. The specific detection primers for rs1420853 comprise primer pairs with sequences as shown in SEQ ID NO: 11 and SEQ ID NO: 12, and the fluorescent probes for rs1420853 comprise a wild-type probe with a sequence as shown in SEQ ID NO: 23 and a mutant probe with a sequence as shown in SEQ ID NO:
24.
3. The reagent according to claim 1, characterized in that, The fluorescent probe has a fluorescent reporter group coupled to its 5' end and a fluorescent quencher group coupled to its 3' end.
4. The reagent according to claim 3, characterized in that, The fluorescent reporter group is selected from one or more of FAM, HEX, TET, JOE, CY3, CY5, ROX, Texas Red, or ROX, and the fluorescent quencher group is selected from BHQ or ECLIPSE.
5. The use of a reagent for detecting myopia susceptibility genes in adolescents in the preparation of products for detecting myopia susceptibility genes in adolescents.
6. A kit for detecting myopia susceptibility genes in adolescents, comprising a reagent for detecting myopia susceptibility genes in adolescents.
7. The reagent kit according to claim 6, characterized in that, The kit also includes PCR reagents, which include one or more of the following: PCR reaction buffer, dNTP mixture, UNG enzyme, surfactant or preservative.
8. The application of a detection reagent for detecting polymorphic sites of genes rs524952, rs148443109, rs75714645, rs7290586, rs188276693, and rs1420853 in the preparation of a gene detection kit for myopia susceptibility in adolescents.
9. A method for detecting myopia susceptibility genes in adolescents for non-disease diagnosis or treatment purposes, wherein the method uses the kit described in claims 6-7 for detection, and specifically includes the following steps: S1. Provide genotypic detection data of the DNA amplification products of the detection sites as described in claim 1 for the sample to be tested; S2. Determine whether the genotype in the data is a risk genotype; S3. Assess the susceptibility to myopia in the test samples based on the number of risk genotypes.
10. The method according to claim 9, characterized in that, The risk genotype of the detection site rs524952 is mutant; the risk genotype of the detection site rs148443109 is wild-type; the risk genotype of the detection site rs75714645 is mutant; the risk genotype of the detection site rs7290586 is wild-type; the risk genotype of the detection site rs188276693 is mutant; and the risk genotype of the detection site rs1420853 is wild-type.
11. A device for predicting the susceptibility of adolescents to myopia, characterized in that, The device includes the following modules: Test data acquisition module: used to acquire DNA amplification product genotype detection data of the test sample at the detection site as described in claim 1; Judgment module: Determines whether the genotype in the data is a risk genotype; Prediction module: Assess myopia susceptibility of the test sample based on the number of risk genotypes.
12. An electronic terminal, comprising a processor and a memory, characterized in that, The memory is used to store a computer program, and the processor is used to execute the computer program stored in the memory to cause the device to perform the detection method as described in any one of claims 9-10.
13. A computer-readable storage medium having a computer program stored thereon, characterized in that, When the computer program is processed, it performs the detection method as described in any one of claims 9-10.
14. A computer program product, comprising a computer program, characterized in that, When the program is processed by the processor, it executes the detection method as described in any one of claims 9-10.