Molecular marker closely linked to main-effect qll.a02 for regulating leaf rosette length in brassica napus and its application

By developing a major QTL locus qLL.A02 tightly linked molecular marker for rapeseed rosette leaf length and using KASP primer combinations for genotyping, the problem of improving rapeseed rosette leaf length was solved, and breeding efficiency and seedling biomass were improved.

CN122104976APending Publication Date: 2026-05-29OIL CROPS RES INST CHINESE ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610201654.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-11
Publication Date
2026-05-29

Smart Images

  • Figure CN122104976A_ABST
    Figure CN122104976A_ABST
Patent Text Reader

Abstract

The application belongs to the field of plant development biology and crop molecular genetic breeding technology, and discloses a molecular marker closely linked to a major QTL site qLL.A02 for regulating the length of a rape rosette leaf and application thereof. A stable major QTL site qLL.A02 for regulating the length of a rape rosette leaf is identified through whole genome correlation analysis. A key SNP variation closely linked to qLL.A02 is identified through co-segregation analysis of a lead SNP genotype and a phenotype between populations, which is located at a SNP site at 9828644 bp of a chromosome A02 of a rape ZS11.v10 reference genome, and the G base variation genotype is a rosette leaf length dominant genotype, and is also highly related to leaf area and seedling stage biomass dominance. A KASP molecular marker developed for the variation can efficiently and accurately identify and explore excellent materials with leaf dominance in a rape germplasm resource population, and provides a key, reliable and efficient idea and method for rape variety improvement and molecular design breeding at the level of seedling stage nutrient growth.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of plant developmental biology and crop molecular genetics breeding technology, and in particular relates to a molecular marker tightly linked to the major QTL site qLL.A02 that regulates the length of rosette leaves in rapeseed and its application. Background Technology

[0002] Rapeseed includes various types such as Brassica napus, Brassica rapa, and Brassica juncea. It is an important source of edible oil, vegetables, animal feed, and industrial oil, and is a large type of crop with diverse functions and uses. Rapeseed oil is the safest bulk edible oil, and vigorously developing rapeseed production is of great significance to improving the supply security of edible oil. (Feng Haitang, Wang Hanzhong. Countermeasures for the Supply Security of Edible Vegetable Oil in my country under the New Situation [J]. Chinese Journal of Oil Crops, 2024, 46(02):221-227.DOI:10.19802 / j.issn.1007-9084.2024021).

[0003] Rapeseed leaves can be divided into three categories according to their growth and development stages and spatial location: rosette leaves (long-petioled leaves) at the base during the vegetative growth stage; short-petioled leaves growing in the middle section of the main stem from the bolting stage to the early silique stage; and sessile leaves growing in the upper stem segments from the flowering stage to the silique maturity stage. The vegetative growth stage of rapeseed refers to the seedling stage before bolting and flowering, during which the leaves are mainly rosette leaves. These are the main organs for photosynthesis in rapeseed and form the basis of plant biomass and grain yield.

[0004] The characteristics of rapeseed rosette leaves can be divided into two aspects: leaf shape and leaf physiology. Leaf shape mainly includes leaf length, leaf width, and leaf area, while leaf physiology mainly includes photosynthetic efficiency and stress resistance.

[0005] Rapeseed rosette leaves are lobed, and leaf length is a key trait of leaf size, significantly correlated with leaf area and seedling biomass (leaf area index) in most cases. Generally, leaf length is a key indicator that can be directly used to assess rapeseed seedling biomass and reflect its vegetative growth status.

[0006] Rapeseed is my country's largest oilseed crop, and increasing yield per unit area is a key approach to boosting rapeseed production. Leaf layer improvement is an important way to promote rapeseed's photosynthetic capacity and increase population biomass. Large-leaf varieties can help rapeseed quickly establish growth dominance and accumulate biomass during the seedling stage, promoting root development and later branching. Currently, most high-yielding varieties are large-leaf types. Molecular design breeding of high-yielding rapeseed urgently needs molecular markers related to superior leaf types and their application methods. Summary of the Invention

[0007] The purpose of this invention is to provide a molecular marker tightly linked to the major QTL locus qLL.A02, which regulates the length of rosette leaves in rapeseed, for detecting the genotype of the SNP locus at chromosome 9828644 bp on chromosome A02 of the rapeseed ZS11.v10 genome. Genotyping of qLL.A02 allows for the identification of the genotype of leaf shape traits in rapeseed materials. The peak value of qLL.A02 is located in the 9.74-10.98 Mb region of chromosome A02 in rapeseed.

[0008] Another objective of this invention is to provide a KASP primer composition for the aforementioned SNP sites. This molecular marker can be directly used for the molecular genetic improvement of leaf layer traits in rapeseed seedlings, thereby improving selection efficiency, significantly reducing costs, shortening the breeding cycle, and accelerating the breeding process of high-yield varieties.

[0009] The final objective of this invention is to provide an application strategy and method for the aforementioned molecular markers.

[0010] To achieve the above objectives, the present invention mainly provides the following technical measures: In a first aspect, the present invention provides a molecular marker tightly linked to the major QTL site qLL.A02 that regulates the length of rosette leaves in rapeseed. This molecular marker was developed based on the molecular marker tightly linked to the major QTL site qLL.A02 that regulates the length of rosette leaves in rapeseed. Its superior haplotype can be applied to the rapid identification of rapeseed leaf type and seedling biomass superior materials.

[0011] Furthermore, co-segregation analysis of lead SNP genotypes and inter-population phenotypes identified a key SNP variant closely linked to qLL.A02, located at chromosome 9828644 bp on chromosome A02 of the rapeseed ZS11.v10 reference genome. This SNP exhibited a G-base variant genotype that was dominant in rosette leaf length and was also highly correlated with leaf area and seedling biomass dominance. Applications targeting this locus also included molecular comparisons and utilization of other variants closely linked to qLL.A02.

[0012] Furthermore, the locus qLL.A02 was identified by GWAS analysis of key traits of rosette leaves in natural population materials, and its lead SNP distribution is between 9.74 and 10.98 Mb on chromosome A02.

[0013] Furthermore, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where [G / A] at 151 bp represents a single nucleotide sequence of G or A. The rosette leaves of rapeseed carrying the G genotype are significantly larger in leaf length and leaf area than those of rapeseed carrying the A genotype.

[0014] Furthermore, the genomic DNA sequence information containing this SNP variation is SEQ ID NO.1: TATCTCGCAGATTAGATAACTTTTTGTTTTAATAAGGACATCATTTTTTACCTGAAACTTTTTGTATTGTAGTTGGGCATGATCACTATCAGGAACTGAACCGAAAACTTCGATCACATTTATCCGGAACTGGATAAAAAAATGAGGTTT[G / A]ATTCAGGCTTGGAGACTATGAATTAACTAAGCGAATTGTATAGCTTTAGAACTGAAAAACTAAGAACCAAATGAGTATCCGAATTTTAAAAATATTAATTATATAGTTTTAAAATAATCAAATAATATTAAAAATACTATTTATAAAT.

[0015] Furthermore, the rapeseed refers to the Brassica napus type, which also includes the Chinese cabbage type and the mustard type rapeseed containing the Brassica AA subgenus; rosette leaves also refer to long-petioled leaves, which are significantly correlated with the seedling biomass of rapeseed plants. The genome version of the Brassica napus type is ZS11.v10 (https: / / yanglab.hzau.edu.cn / BnIR / germplasm_info?id=ZS11.v10).

[0016] Furthermore, based on the regulatory mechanism of the qLL.A02 site on the length of rapeseed rosette leaves, the KASP molecular markers related to the length of rapeseed rosette leaves were investigated. The polymorphism of the SNP marker site is G, which usually indicates that the rapeseed rosette leaves are longer; if the polymorphism is A, the rapeseed rosette leaves are shorter.

[0017] In a second aspect, the present invention provides a set of KASP detection primers for detecting molecular markers significantly associated with rosette leaf length, comprising a FAM-labeled downstream primer MLLA02R1, a HEX-labeled downstream primer MLLA02R2, and a universal upstream primer MLLA02F, the primer sequences of which are as follows: MLLA02F: 5´-TAGTTGGGCATGATCACTATCAGG -3´; MLLA02R1: 5´- GAAGGTGACCAAGTTCATGCTATTCATAGTCTCCAAGCCTGAATC -3´; MLLA02R2: 5´- GAAGGTCGGAGTCAACGGATTATTCATAGTCTCCAAGCCTGAATT-3´.

[0018] As described above, the KASP primer set, using conventional KASP genotyping experiments, enables efficient detection of the qLL.A02 haplotype. This allows for genotyping of large populations of germplasm or breeding materials based on the qLL.A02 locus, efficiently isolating superior haplotype families of qLL.A02. In breeding, this can be applied to improve rapeseed in terms of leaf type and leaf layer, and also to predict seedling biomass dominance. Leaf type improvement can increase the photosynthetic area of ​​individual rapeseed plants and the entire population, thus potentially increasing seedling biomass, further improving rapeseed yield and quality.

[0019] A third aspect of the present invention provides a method for detecting molecular markers significantly correlated with rosette leaf length, comprising the following steps: (a) Extracting genomic DNA from the rapeseed plants to be tested; (b) Competitive allele-specific PCR (KASP) reaction was performed using the aforementioned molecular marker primer pair; (c) The genotype of the SNP_chrA2_9828644 locus was determined by fluorescence signal analysis; (d) Determining the rosette leaf length phenotype of rapeseed based on the correlation between genotype and phenotype: homozygous GG genotype indicates a longer rosette leaf phenotype, while homozygous AA genotype indicates a shorter rosette leaf phenotype.

[0020] The amplification reaction system included: 5 μL KASP 2×PCRmix, 0.14 μL 100 μmol primer premix, 1 μL template DNA, and 3.86 μL deionized water. The PCR amplification program was as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, 61℃ annealing and extension for 40 s, 10 cycles, with the annealing and extension temperature decreasing by 0.6℃ each time; 95℃ denaturation for 20 s, 55℃ annealing and extension for 30 s, 42 cycles; and real-time PCR at 37℃ for 60 s, during which fluorescence signals were collected.

[0021] Furthermore, when the nucleotide sequence of the amplified product is as shown in SEQ ID NO.2, the genotype G at 82 bp is usually significantly longer than that of rapeseed carrying the A genotype.

[0022] Furthermore, the genotyping and rosette leaf length of rapeseed can be determined based on the amplified fluorescence detection results, including: if the universal tag FAM fluorescent adapter sequence is detected and the genotype is GG, the corresponding rapeseed rosette leaves are longer; if the universal tag HEX fluorescent adapter sequence is detected and the genotype is AA, the corresponding rapeseed rosette leaves are shorter.

[0023] A fourth aspect of the present invention provides an application of the molecular marker or primer set or detection method as described above, comprising: (1) Application in rapeseed breeding.

[0024] (2) Application in the rapid identification of rapeseed leaf type and seedling biomass dominant materials.

[0025] (3) Application in detecting and predicting the length of rosette leaves in rapeseed.

[0026] Specifically, the breeding objective is to screen out superior rapeseed germplasm with longer rosette leaves, larger leaves, and greater biomass.

[0027] The beneficial effects of this invention are as follows: The molecular marker and its detection method closely linked to the major QTL site qLL.A02 for rosette leaf length in rapeseed provided by this invention have been verified by numerous experiments to have high specificity and accuracy, with a 98% consistency between the genotyping results and sequencing results. Therefore, it can be directly used for molecular improvement of rapeseed leaf type, offering advantages over traditional field surveys in terms of lower cost, higher effectiveness, and shorter cycle.

[0028] Furthermore, it can be used for early molecular marker-assisted selection of related traits such as rosette leaf (long petiole leaf) length and leaf area in rapeseed, and for efficient genotyping of large population germplasm resources or breeding material populations. It can also provide relevant molecular technical means for high-yield and high-quality rapeseed breeding from the perspective of basic biomass during the seedling stage (vegetative growth period). Attached Figure Description

[0029] Figure 1 Images of rosette leaves from a portion of natural plant populations; Figure 2 Normal distribution of rosette leaf length phenotype in natural population resources during the 2024-2025 growing season; Figure 3 Manhattan plot showing the relationship between rosette leaf length and SNP in GWAS; Figure 4 The results of KASP marker typing of rapeseed samples with different genotypes in Example 3; Figure 5 The results of KASP marker typing of rapeseed samples with different genotypes in Example 4; Figure 6 Box plots showing phenotypic differences in rosette leaf length among rapeseed varieties carrying different alleles. Detailed Implementation

[0030] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0031] Example 1: Identification of the major QTL locus qLL.A02 for rosette leaf length in rapeseed Three hundred and fifty inbred lines of Brassica napus from various countries around the world were collected as a rapeseed association population. Single leaves of each line in the association population were collected, and total DNA was extracted using the CTAB method. Genotyping of each sample was performed using the 20K Illumina SNP chip developed by Wuhan Shuanglvyuan Chuangxin Technology Research Institute Co., Ltd.

[0032] Illumina BeadStudio genotyping software (http: / / www.illumina.com / ) was used to calculate the heterozygous rate, missing rate, and minor allele frequency at each locus in the population materials. SNP markers were filtered using criteria including a missing rate ≤0.2, a heterozygous rate ≤0.2, a minor allele frequency >0.05, and a unique match of the SNP marker in the Brassica napus ZS11.v10 genome. A total of 18,010 high-quality SNP markers were obtained for genome-wide association analysis.

[0033] Three hundred and fifty materials were planted at the Yangluo Experimental Base of the Oil Crops Research Institute, Chinese Academy of Agricultural Sciences, in 2023, 2024, and 2025, respectively, following conventional winter rapeseed planting practices in the Yangtze River Basin, with three replicates. At the seedling stage, six plants (one large rosette leaf per plant) were sampled from each of the 350 families to determine the length of the rosette leaves. Figure 1 and Figure 2 The image shows a schematic diagram of rapeseed rosette leaves and a bar chart of data for one year.

[0034] Based on three years of data on rosette leaf length, genotype, and population structure during the rapeseed seedling stage, association analysis was performed using TASSEL 5.0 software. A QTL locus significantly associated with rosette leaf length during the rapeseed seedling stage was identified on chromosome A02 and named qLL.A02. The association results are as follows: Figure 3 show.

[0035] like Figure 3 The results are visualized as a Manhattan plot. Figure 3 In the Manhattan plot, the X-axis represents the chromosome region, the Y-axis represents the -log10(p) value, and the red dashed line represents the significance threshold. There are multiple SNPs exceeding the threshold in the A02 region.

[0036] Example 2: Design and development of SNP molecular markers significantly associated with rosette leaf length trait Data on the lead SNP at the peak of the QTL sites identified in Example 1 within the A02 region were extracted. Based on screening criteria such as sequence conservation, the lead SNP at 9828644 bp on chromosome A02 (named SNP_chrA2_9828644) was selected as the target SNP site for molecular marker development. This SNP can be repeatedly detected under multiple environments, with a significance level of 8.31E-4. Its variant site (G / A) is located at the 9828644th base on chromosome A02 of the Brassica napus ZS11.v10 genome.

[0037] Primer design: Based on the KASP primer design principle, using SnapGene software, allele-specific primers and universal reverse primers were designed around the SEQ ID NO.1 sequence, which is located approximately 100 bp upstream and downstream of the SNP site at position SNP_chrA2_9828644, as the target sequence.

[0038] The specific PCR amplification sequence of this primer set, SEQ ID NO.2, is as follows: TAGTTGGGCATGATCACTATCAGGAACTGAACCGAAAACTTCGATCACATTTATCCGGAACTGGATAAAAAAATGAGGTTT[G / A]ATTCAGGCTTGGAGACTATGAAT.

[0039] The designed general forward primers and specific primers are as follows: Universal forward primer MLLA02F: 5´-TAGTTGGGCATGATCACTATCAGG-3´; Allele 1-specific reverse primer (FAM marker) MLLA02R1: 5´- GAAGGTGACCAAGTTCATGCTATTCATAGTCTCCAAGCCTGAATC -3´, where GAAGGTGACCAAGTTCATGCT is the FAM signal fluorescent probe sequence; Allele 2-specific reverse primer (HEX marker) MLLA02R2: 5´- GAAGGTCGGAGTCAACGGATTATTCATAGTCTCCAAGCCTGAATT-3´, where GAAGGTCGGAGTCAACGGATT is the HEX signal fluorescent probe sequence.

[0040] Example 3: Verification of KASP tagging effect KASP validation population selection: Ten Brassica napus germplasm resources with known genotypes (20K SNP microarray sequencing) were randomly selected as validation materials (5 homozygous for Hap1 AA and 5 homozygous for Hap2 GG). The experimental steps are as follows: (a) Extracting genomic DNA from the rapeseed plants to be tested; (b) Competitive allele-specific PCR (KASP) reaction was performed using the primer set described in Example 2; (c) The genotype of the SNP_chrA2_9828644 locus was determined by fluorescence signal analysis; (d) Determining rosette leaf length phenotype based on genotype: AA genotype indicates short rosette leaf phenotype, and GG genotype indicates long rosette leaf phenotype.

[0041] The amplification reaction system included: 5 μL KASP 2×PCRmix, 0.14 μL 100 μmol primer premix, 1 μL template DNA, and 3.86 μL deionized water. The PCR amplification program was as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, 61℃ annealing and extension for 40 s, 10 cycles, with the annealing and extension temperature decreasing by 0.6℃ each time; 95℃ denaturation for 20 s, 55℃ annealing and extension for 30 s, 42 cycles; and real-time PCR at 37℃ for 60 s, during which fluorescence signals were collected.

[0042] Results Detection and Analysis: After the reaction, fluorescence signals were acquired using the software included with the Roche LightCycler® 96 real-time fluorescence PCR instrument, and cluster analysis was performed. The results are as follows: Figure 4 As shown, the KASP genotyping results of all 10 samples were completely consistent with the known WGS sequencing genotype results, with an accuracy of 100%, proving that the KASP marker primers designed in this invention have extremely high reliability and accuracy.

[0043] Example 4: Validation and Application of Markers in Population Materials Materials and phenotypic determination: Eighty rapeseed germplasm from natural populations were randomly selected and planted in the field at conventional density (Yangluo Experimental Base). The length of the rosette leaves was measured and recorded using a meter stick at the leaf canopy closure stage (when the rosette leaves had grown and matured and the leaves of adjacent plants began to interlock).

[0044] Allele detection: DNA was extracted from 80 natural populations and genotyped according to the method in Example 3.

[0045] KASP test results: 80 samples were successfully divided into two groups: 19 samples carrying the Hap1 allele for short rosette leaves (homozygous AA type), 52 samples carrying the Hap2 allele for long rosette leaves (homozygous GG type), and 9 samples with heterozygous genotypes (AG type). Figure 5 As shown in the figure, the X-axis represents the FAM fluorescence signal intensity; the Y-axis represents the HEX fluorescence signal intensity; clusters: two clusters are clearly shown in the figure, representing the homozygous genotype AA (cluster 1) and the homozygous genotype GG (cluster 2), respectively, as well as invalid data points (lower left corner), indicating that the primer typing effect is good and the resolution is high.

[0046] Results Analysis: Based on the measured rosette leaf length of 80 materials and the corresponding molecular marker typing results, as shown in Table 1, a comparison of rosette leaf length among different rapeseed allele populations revealed that the mean leaf length of the Hap2 population (30.7 cm) was significantly higher than that of the Hap1 population (25.1 cm). Figure 6The figure shows box plots of rosette leaf length for different genotypes. The X-axis represents the groups, with Hap1 representing the GG genotype population and Hap2 representing the CC genotype population; the Y-axis represents rosette leaf length. Statistical significance tests: p<0.0001(****), p<0.001(***), p<0.01(**), p<0.05(*).

[0047] Table 1. FAM and HEX signal values ​​and rosette leaf length information for 80 different genotype materials. The above description is merely a specific embodiment of the present invention, and the scope of protection of the present invention is not limited thereto. Any transformations or substitutions that can be conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. A molecular marker tightly linked to the major QTL site qLL.A02 that regulates the length of rosette leaves in rapeseed, characterized in that, The molecular marker was developed based on the lead SNP at site qLL.A02, which is located at 9828644bp on chromosome A02 of the rapeseed ZS11.v10 reference genome. The allelic variation is A / G, and the G allele is highly correlated with the dominant materials of rapeseed rosette leaf length and leaf area.

2. The molecular marker as described in claim 1, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where [G / A] at 151 bp represents a single nucleotide sequence of G or A. Among them, the rosette leaves of rapeseed carrying the G genotype are significantly larger than those of rapeseed carrying the A genotype in terms of leaf length and leaf area.

3. The molecular marker as described in claim 1, characterized in that, The locus qLL.A02 was identified by GWAS analysis of key traits of rosette leaves in natural population materials, and its lead SNP is distributed between 9.74 and 10.98 Mb on chromosome A02.

4. A primer set for the molecular marker according to any one of claims 1-3, characterized in that, It includes the upstream universal primer MLLA02F and the downstream primers MLLA02R1 and MLLA02R2, wherein the primer sequences are as follows: MLLA02F: 5´-TAGTTGGGCATGATCACTATCAGG -3´; MLLA02R1: 5´- GAAGGTGACCAAGTTCATGCTATTCATAGTCTCCAAGCCTGAATC -3´; MLLA02R2: 5´-GAAGGTCGGAGTCAACGGATTATTCATAGTCTCCAAGCCTGAATT-3´.

5. A method for detecting the molecular marker according to any one of claims 1-3, characterized in that, Includes the following steps: (a) Extracting genomic DNA from the rapeseed plants to be tested; (b) Perform competitive allele-specific PCR using the primer pair of claim 4; (c) The genotype of the locus named SNP_chrA2_9828644 was determined by fluorescence signal analysis; (d) Determining the rosette leaf length phenotype of rapeseed based on the correlation between genotype and phenotype: homozygous GG genotype indicates a longer rosette leaf phenotype, while homozygous AA genotype indicates a shorter rosette leaf phenotype.

6. The method as described in claim 5, characterized in that, If the universal tag FAM fluorescent adapter sequence is detected, the genotype is GG, and the corresponding rosette leaves of rapeseed are longer; if the universal tag HEX fluorescent adapter sequence is detected, the genotype is AA, and the corresponding rosette leaves of rapeseed are shorter.

7. The application of the molecular marker as described in any one of claims 1-3, the primer set as described in claim 4, or the method as described in claim 6 in rapeseed breeding.

8. The application of the molecular markers as described in any one of claims 1-3, the primer set as described in claim 4, or the method described in claim 6 in the rapid identification of rapeseed leaf type and seedling biomass dominant materials.

9. The application of the molecular marker as described in any one of claims 1-3, the primer set as described in claim 4, or the method as described in claim 6 in detecting and predicting the length of rosette leaves in rapeseed.