A parms molecular marker related to tryptophan content of corn root system and application thereof

By developing PARMS molecular markers based on the 5'UTR region of the maize ZmASB1 gene and using real-time PCR technology, the problem of insufficient correlation between maize root tryptophan content and genetic information was solved, enabling rapid and accurate genotyping and breeding improvement, thereby enhancing maize breeding efficiency and drought resistance.

CN122104977APending Publication Date: 2026-05-29YANGZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610206851.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-12
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

In existing technologies, the correlation between molecular markers related to tryptophan content in maize roots is limited, resulting in low breeding efficiency and making it difficult to achieve rapid and accurate genotype selection and breeding improvement.

Method used

A PARMS molecular marker based on the 5'UTR region of the maize ZmASB1 gene was developed. Using a pair of fluorescently labeled primers and a reverse common primer, the InDel+ and InDel- genotypes were rapidly identified by quantitative real-time PCR amplification, achieving efficient differentiation of tryptophan content in maize roots.

Benefits of technology

This technology enables rapid and accurate identification of tryptophan content in maize roots, providing excellent genetic resources, shortening the breeding cycle, improving breeding efficiency, constructing a molecular breeding technology system, and enhancing maize drought resistance and yield.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104977A_ABST
    Figure CN122104977A_ABST
Patent Text Reader

Abstract

The application discloses a PARMS molecular marker significantly related to the tryptophan content of corn root systems and application thereof, the nucleotide sequence of 150 bp upstream and downstream of the molecular marker is shown as SEQ ID NO. 6, and the primer group nucleotide sequence for detecting the PARMS molecular marker is shown as SEQ ID NO. 1-SEQ ID NO. 3. ZmASB1 The application successfully develops a molecular marker based on the natural variation of the 5'UTR region of the (Zm00001eb080510) gene, the marker is significantly related to the tryptophan content of corn root systems, can accurately, efficiently and stably distinguish the InDel + genotype and the InDel ‑ genotype. The molecular marker can be widely applied to the tryptophan content of corn root system germplasm resources and molecular marker assisted breeding, and provides important technical support and theoretical basis for cultivating new corn varieties with high yield, stable yield and drought resistance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to maize genetic breeding, specifically to a PARMS molecular marker related to tryptophan content in maize roots and its application in marker-assisted breeding. Background Technology

[0002] As one of the world's three major food crops, maize's growth and development are influenced by various external environmental factors and its own genotype. Tryptophan is an essential aromatic amino acid for plants, serving as a basic unit of protein synthesis and a key precursor to physiologically active substances such as auxin, serotonin, and melatonin. Its derivative metabolites widely regulate biological processes such as seed germination, root morphogenesis, organ senescence, and stress response. In plant stress responses, tryptophan can act as a precursor for auxin synthesis to regulate root morphology in response to stress, and it can also participate in reactive oxygen species scavenging and synergistically enhance plant stress resistance with the abscisic acid signaling pathway. In maize, drought stress induces a significant accumulation of tryptophan in the roots, and the expression of key genes such as TSB and AO1 in its synthesis pathway is closely related to phenotypic traits such as root morphogenesis. High expression of tryptophan synthase in root tip meristem and vascular tissue affects local tryptophan and auxin synthesis, and drought stress can also induce... ZmAO1 Changes in gene expression, such as tryptophan, regulate tryptophan metabolism in response to stress signals.

[0003] In recent years, with the rapid development of molecular biology and genomics technologies, marker-assisted selection (MAS) has gradually become a core technology in the field of crop genetic improvement. This technology relies on molecular markers closely linked to target traits to achieve indirect and precise selection of target genotypes. It not only effectively improves breeding efficiency but also significantly shortens the breeding cycle, demonstrating significant advantages in crop breeding practice. The penta-primer amplification refractory mutation system (PARMS) is a novel SNP PCR detection technology that integrates a pair of universal fluorescent primers, a pair of SNP allele-specific primers, and a reverse common primer. It features simple operation and rapid detection and is currently widely used in various research directions such as crop genotyping, marker-assisted selection, and gene mapping.

[0004] Although some research has been reported on genes related to tryptophan content in maize, the number of identified genes remains relatively small. Therefore, developing molecular markers that are closely linked to maize root tryptophan content, possess both stability and reliability, and rapidly applying them to maize breeding practices has become a crucial issue that urgently needs to be addressed in this field. Summary of the Invention

[0005] To address the limited correlation between existing molecular markers and tryptophan content in maize roots, this invention provides a PARMS molecular marker related to tryptophan content in maize roots and its application. This marker is significantly correlated with tryptophan content in maize roots and can accurately, efficiently, and stably distinguish InDel. + Genotype and InDel - Genotypes can be widely used for high-throughput screening of maize germplasm resources with high tryptophan content, functional studies of tryptophan-related genes, and molecular marker-assisted breeding.

[0006] To achieve the above objectives, the present invention provides a PARMS molecular marker that is significantly associated with tryptophan content in maize roots. This molecular marker is based on maize... ZmASB1 (Zm00001eb080510) Gene 5'UTR region natural variation, ZmASB1 Located on chromosome 2 of maize, the physical location of the molecular marker on the maize B73 reference genome Zm-B73-REFERENCE-NAM-5.0 is Chr2:42789871-42795010. The nucleotide sequences of the marker upstream and downstream for 150 bp are shown in SEQ ID NO. 6. The physical location of this marker is located on the maize B73 reference genome (Zm-B73-REFERENCE-NAM-5.0) Chr2:42789916, InDel - The genotype at this position has a base of A-------, InDel + The genotype at this location is ATTAAACT, where InDel + The tryptophan content of genotype maize lines was significantly higher than that of InDel. - Genotype maize lines.

[0007] SEQ D NO.6: CGGGCAGGGCGGGACACCAGCACCACACCACGTCACGTCAGTGCGCGGTGGCGGCGGCGCGAAGTGGAAAACGAGGAAAATGCGCTGCTGCAGCTGCTCCACGCGACTCTCTCTTTCAGTCTTTCTCTCTCTCTCTCCTGTCGTTAATTATTAA ACTTTAAACGATAAAAACCCCAGATATCAGCCTGACCCAAAAACGTTTTTCTTTTTCACCAAGTCTGTAAAATTCTATTTATAGAGGCAGCAAAACCTCGCCCACTCTACAAACACGTGACACCTCCGCCCACCCTCGCCCCCTCCCTACCGG.

[0008] A second aspect of the present invention provides a primer set for detecting the aforementioned PARMS molecular markers, the primer set being based on maize genes. ZmASB1 Developed by (Zm00001eb080510), including a positive competitive primer with a nucleotide sequence as shown in SEQ ID NO.1. ZmASB1 -INDE1-F1, positive competitive primer with nucleotide sequence as shown in SEQ ID NO.2 ZmASB1 -INDEL-F2, reverse universal primer with nucleotide sequence as shown in SEQ ID NO.3 ZmASB1 -INDEL-R.

[0009] A third aspect of the present invention provides a kit for detecting the above-described PARMS molecular markers, comprising the above-described primer set.

[0010] The fourth aspect of this invention provides the application of the above-described primer set or kit in detecting tryptophan content in maize roots.

[0011] The fifth aspect of this invention discloses a method for detecting the tryptophan content in maize roots, comprising the following steps: In the above ZmASB1 The 5' end of -INDEL-F1 is linked to a FAM fluorescent probe (its nucleotide sequence is shown in SEQ ID NO. 4). ZmASB1 The 5' end of the -INDEL-F2 probe is linked to a HEX fluorescent probe (its nucleotide sequence is shown in SEQ ID NO.5). Using the genomic DNA of the maize to be tested as a template, quantitative real-time PCR amplification is performed using the primer set described above. The amplification products are then scanned for fluorescence signals, and genotyping of the maize material to be tested is performed based on the fluorescence signals. If the maize material to be tested contains the positive primer in the primer set... ZmASB1-INDEL-F1 fluorescent probe signal (fluorescence aggregates near the X-axis, showing a blue sample), without containing a forward primer. ZmASB1 If the fluorescent probe signal of -INDEL-F2 is detected, then the maize material being tested does not contain the QTL site for tryptophan content in maize roots, indicating that it is InDel. + genotype; If the maize material to be tested contains the positive primer in the primer set... ZmASB1 -INDEL-F2 fluorescent probe signal (fluorescence aggregates near the Y-axis, showing green), without containing a forward primer. ZmASB1 If the fluorescent probe signal of -INDEL-F1 is received, then the maize material being tested contains the QTL site for tryptophan content in maize roots, denoted as InDel. - genotype; InDel + The tryptophan content of genotype maize lines was significantly higher than that of InDel. - Genotype maize lines.

[0012] Specifically, the PCR amplification reaction system is as follows: 10-100 ng DNA template, 0.15 μL ZmASB1 -INDEL-F1, 0.15 μL ZmASB1 -INDEL-F2, 0.4 μL ZmASB1 -INDEL-R, 5μL 2×PARMS master mix, ddH2O to bring the total to 10μL; The PCR amplification reaction conditions are as follows: 1) Activation at 94°C for 20 min; 2) Denaturation at 94°C for 20 s, annealing and extension at 65~57°C for 60 s, 10 Touch-down cycles, with the temperature decreasing by 0.8°C per cycle; 3) Denaturation at 94°C for 20 s, annealing at 57°C for 60 s, 32 cycles.

[0013] Through the above technical solution, the present invention achieves the following beneficial effects: 1) This molecular marker can be used to quickly and accurately identify InDel. + Genotype-specific maize germplasm resources provide excellent genetic resources for drought-resistant maize breeding. 2) This molecular marker can be used to track... ZmASB1 The distribution and transmission patterns of InDel variants in the 5'UTR region of maize provide a powerful tool for in-depth research on their genetic mechanism in maize root tryptophan content. 3) This molecular marker can be combined with molecular markers of other related genes to construct a molecular breeding technology system for maize tryptophan content, achieving precise improvement of maize root tryptophan content. Attached Figure Description

[0014] Figure 1The images show the location of the InDel variant site (A) and the sequence differences between different genotypes (B). Circles and triangles represent SNPs and InDel, respectively. Figure 2 It is InDel + and InDel - Genotypic differential phenotypes: tryptophan content (A) and gene expression level (B); Figure 3 This is the result of genotyping of molecular markers in a population of maize inbred lines. Detailed Implementation

[0015] The specific embodiments of the present invention will be described in detail below with reference to examples. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit the present invention.

[0016] Example 1: Validation of candidate genes Association analysis was performed on 169 maize inbred lines, revealing 16 variant sites significantly associated with tryptophan content. Three variant sites within the 5' UTR showed complete linkage disequilibrium, dividing the maize inbred lines into two distinct haplotypes (e.g., ...). Figure 1 (As shown). Carrying InDel + Allele germplasm ratio carrying InDel - Alleles have higher tryptophan content and higher [unclear text - possibly related to genetic material]. ZmASB1 Gene expression level ( p =7.34×10 -7 , p =2.43×10 -8 This indicates that these variations may affect tryptophan levels and ZmASB1 Gene expression ( Figure 2 ).

[0017] Example 2: Application of PARMS molecular markers 1. Development of PARMS molecular markers based on ZmASB1 The InDel variant in the 5'UTR region of the gene was used to design a primer set, including a pair of forward primers labeled with FAM and HEX fluorescent tags respectively, and a reverse primer. The two forward primers are denoted as follows: ZmASB1 -INDEL-F1 and ZmASB1 -INDEL-F2, the downstream primer is denoted as ZmASB1 -INDEL-R, the developed PARMS molecular marker is denoted as ZmASB1 -INDEL. The nucleotide sequences of the three primers are as follows: ZmASB1-INDEL-F1 (SEQ ID NO.1): 5'-GAAGGTGACCAAGTTCATGCTCTCTCTCCTGTCGTTAATTATTAAACT-3'; ZmASB1 -INDEL-F2 (SEQ ID NO.2): 5'-GAAGGTCGGAGTCAACGGATTCTCTCCTGTCGTTAATTATTAAACG-3'; ZmASB1 -INDEL-R (SEQ ID NO.3): 5'-TTTGGGTCAGGCTGATATCTG-3'.

[0018] In order to detect PCR amplification products using a fluorescence reader, the upstream primer... ZmASB1 -INDEL-F1 binds a FAM fluorescent group to its 5' end, in the upstream primer ZmASB1 The 5' end of the -INDEL-F2 probe binds to the HEX fluorescent group. The nucleotide sequence of the fluorescent probe tag is as follows: FAM fluorescent probe tag (SEQ ID NO.4): 5'-GAAGGTGACCAAGTTCATGCT-3'; HEX fluorescent probe tag (SEQ ID NO.5): 5'-GAAGGTCGGAGTCAACGGATT-3'.

[0019] 2. Identification of InDel locus genotype Molecular markers were used to target the InDel sites of 50 natural population materials. ZmASB1 Genotyping is performed using the INDEL (Indexed Index). The specific steps include: (1) PCR amplification (i) PCR amplification was performed on the DNA of the maize variety to be tested to obtain PCR products. The PCR amplification system was as follows: 10-100 ng DNA template, 0.15 μL ZmASB1 -INDEL -F1, 0.15 μL ZmASB1 -INDEL -F2, 0.4 μL ZmASB1 -INDEL-R, 5μL 2×PARMS master mix (Wuhan Jingtai), ddH2O to bring the total to 10μL; (ii) The PCR amplification reaction conditions are as follows: 1) Activation at 94°C for 20 min; 2) Denaturation at 94°C for 20 s, annealing and extension at 65~57°C for 60 s, 10 Touch-down cycles, with the temperature decreasing by 0.8°C each cycle; 3) Denaturation at 94°C for 20 s, annealing at 57°C for 60 s, 32 cycles.

[0020] (2) Genotyping and determination of tryptophan content After PCR, the fluorescence signal was read using a TECAN Infinite M1000 microplate reader, and then the fluorescence signal was analyzed and converted using the online software snpdecoder to obtain a clear and intuitive genotyping diagram. The genotype results were output according to the different colors.

[0021] The results showed that ZmASB1 - The INDEL site-specific primer is linked to the FAM fluorescent group and appears in blue in the detection result, indicating InDel. + Type gene, ZmASB1 - An INDEL site-specific primer linked to a HEX fluorescent group will appear green in the detection result, indicating a missing base, i.e., InDel. - Genotype. Results as follows: Figure 3 As shown in Table 1.

[0022] Determination of tryptophan content: The roots of the frozen corn samples were ground into a fine powder in liquid nitrogen. Approximately 200 mg (±1%) of each sample was weighed and transferred to a 2 mL EP tube. Then, 600 μL of 2-chlorophenylalanine (4 ppm) in methanol (pre-cooled to -20℃) was added. The mixture was vortexed for 30 s, ground into a fine powder using a tissue homogenizer at 50 Hz for 60 s, sonicated at room temperature for 15 min, and centrifuged at 13,523 rcf for 10 min at 25℃. The resulting supernatant (300 μL) was filtered through a 0.22 μm membrane and transferred to a detection vial for liquid chromatography-mass spectrometry (LC-MS) analysis. 20 μL of each sample was combined into a quality control (QC) sample to monitor deviations in the analytical results and distinguish these deviations from potential instrument errors. The remaining sample was used for LC-MS analysis. Chromatographic separation was performed using a Thermo Vanquish system (Thermo Fisher, Shanghai, China) equipped with an ACQUITY UPLC® HSS T3 (150 × 2.1 mm, 1.8 µm, Waters) column. ESI-MSn experiments were conducted using a Thermo Q Precision Mass Spectrometer (Thermo Fisher, Shanghai, China) with spray voltages set to 3.5 kV and -2.5 kV, in both positive and negative ionization modes. The analyzer had a scan mass range of 81 to 1,000 m / z and a full scan mass resolution of 70,000. Sheath gas and auxiliary gas flow rates were set to 30 and 10, respectively, and the capillary temperature was maintained at 325 °C. In addition to full scan acquisition, data-dependent MS / MS experiments were performed with a normalized collision energy of 30 eV. Raw metabolomics data were converted to mzXML format using Proteowizard software (v3.0.8789) and processed in the R language XCMS package for peak identification, filtering, and alignment. The tryptophan content in the roots of each sample was obtained by correcting the peak area of ​​tryptophan extracted by ion chromatography and the peak area of ​​the internal standard 2-chlorophenylalanine. The results are shown in Table 1.

[0023] Table 1. Genotypes and phenotypes of tested maize inbred lines.

[0024] Statistical analysis was performed using SPSS 25.0. Comparison of InDel data in Table 1... + InDel - Genotypes and tryptophan content phenotypic data of materials carrying these two genotypes respectively. The results showed that InDel... + The tryptophan content of genotype-specific maize is significantly higher than that of InDel-carrying maize. - Tryptophan content of genotype type (Figure 2 (A)

[0025] Statistical analysis ( t Further testing revealed that the polytryptophan genotype (InDel) + Genotype) and low-tryptophan genotype (InDel) - The phenotypic differences (genotypes) reached a highly significant level (Table 2).

[0026] Table 2. Statistical analysis results of genotype and phenotype of tested maize inbred lines.

[0027] Note: * indicates a difference at a significance level of 0.05, and ** indicates a difference at a significance level of 0.01.

[0028] This invention successfully developed a corn-based ZmASB1 A molecular marker for natural variation in the 5'UTR region of the InDel gene, which is significantly associated with tryptophan content in maize roots, can accurately, efficiently, and stably distinguish InDel. + Genotype and InDel - Genotype. This molecular marker can be widely used in high-throughput screening of maize germplasm resources with high tryptophan content, functional studies of tryptophan content-related genes, and marker-assisted breeding, providing important technical support and theoretical basis for breeding high-yielding, stable-yielding, and drought-resistant new maize varieties. This invention not only provides a new molecular tool for the genetic improvement of maize tryptophan content, but also offers a new perspective for a deeper understanding of the molecular mechanisms affecting tryptophan content in maize roots.

[0029] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details of the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0030] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.

[0031] Furthermore, various different embodiments of the present invention can be combined in any way, as long as they do not violate the spirit of the present invention, they should also be regarded as the content disclosed by the present invention.

Claims

1. A PARMS molecular marker significantly associated with tryptophan content in maize roots, characterized in that, The nucleotide sequences of the molecular marker, 150 bp upstream and downstream, are shown in SEQ ID NO.

6. The physical location of this marker is at Chr2:42789916, InDel, of the maize B73 reference genome. - The genotype at this position has a base of A-------, InDel + The genotype at this location is ATTAAACT, where InDel + The tryptophan content of genotype maize lines was significantly higher than that of InDel. - Genotype maize lines.

2. A primer set for detecting the PARMS molecular marker as described in claim 1, characterized in that, The primer set includes a forward primer with a nucleotide sequence as shown in SEQ ID NO.

1. ZmASB1 -INDEL-F1, forward primer with nucleotide sequence as shown in SEQ ID NO.2 ZmASB1 -INDEL-F2, reverse primer with nucleotide sequence as shown in SEQ ID NO.3 ZmASB1 -INDEL-R.

3. A kit for detecting the PARMS molecular marker as described in claim 1, characterized in that, It includes the primer set as described in claim 2.

4. The application of the primer set according to claim 2 or the kit according to claim 3 in the detection of tryptophan content in maize roots.

5. A method for detecting the tryptophan content in maize roots, characterized in that, Includes the following steps: As described in claim 2 ZmASB1 The 5' end of the -INDEL-F1 is connected to a FAM fluorescent probe. ZmASB1 The 5' end of the -INDEL-F2 probe is linked to a HEX fluorescent probe. Using the genomic DNA of the maize to be tested as a template, quantitative real-time PCR amplification is performed using the primer set described above. The fluorescence signal of the amplification product is then scanned, and genotyping of the maize material to be tested is performed based on the fluorescence signal. If the corn to be tested has positive competitive primers ZmASB1 -INDEL-F1 fluorescence signal, but no positive competing primer was observed. ZmASB1 If the fluorescence signal of -INDEL-F2 is detected, the maize material is denoted as InDel. + Genotype; if the maize to be tested has a positive competitive primer ZmASB1 -INDEL-F2 fluorescence signal, but no positive competing primer was observed. ZmASB1 If the fluorescence signal of -INDEL-F1 is detected, the maize material is denoted as InDel. - Genotype; InDel + The tryptophan content of genotype maize lines was significantly higher than that of InDel. - Genotype maize lines.

6. The method according to claim 5, characterized in that, The PCR amplification reaction system is as follows: 10-100 ng DNA template, 0.15 μL... ZmASB1 -INDEL-F1, 0.15 μL ZmASB1 -INDEL-F2, 0.4 μL ZmASB1 -INDEL-R, 5μL 2×PARMS master mix, ddH2O to bring the total to 10μL; The PCR amplification reaction conditions are as follows: 1) Activation at 94°C for 20 min; 2) Denaturation at 94°C for 20 s, annealing and extension at 65~57°C for 60 s, 10 Touch-down cycles, with the temperature decreasing by 0.8°C per cycle; 3) Denaturation at 94°C for 20 s, annealing at 57°C for 60 s, 32 cycles.