Use of a molecular marker for apple scab resistance

By developing molecular markers Del772, Del231, and SNP947, the accuracy and applicability issues of apple anthracnose leaf blight resistance detection in existing technologies have been resolved, enabling efficient and broad-ranging apple breeding selection and improving breeding efficiency.

CN122104978APending Publication Date: 2026-05-29SHANDONG INST OF POMOLOGY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SHANDONG INST OF POMOLOGY
Filing Date
2026-03-05
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

The existing molecular markers for resistance to apple anthracnose leaf blight have a predictive accuracy of less than 96%, which is insufficient to meet the selection precision requirements of breeding practices, and their applicability is limited, resulting in low efficiency in apple breeding.

Method used

Novel molecular markers Del772, Del231, and SNP947 were developed and used to efficiently and accurately detect apple resistance to anthracnose leaf blight by PCR amplification and fluorescence signal detection. These markers are applicable to a variety of apple varieties.

Benefits of technology

It achieves efficient and accurate detection of resistance to apple anthracnose leaf blight, with an identification efficiency of 97.6% for molecular markers Del772, Del231, and SNP947. It has a wide range of applications and supports precise selection in apple breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104978A_ABST
    Figure CN122104978A_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of apple molecular breeding, and particularly relates to application of a detection reagent of a molecular marker related to apple anthracnose leaf blight resistance, the molecular marker being Del772, Del231 and SNP947, the nucleotide sequence of Del772 being shown as SEQ ID NO. 1, the nucleotide sequence of Del231 being shown as SEQ ID NO. 4, and the nucleotide sequence of SNP947 being shown as SEQ ID NO. 5, the application further develops the detection reagent of the molecular markers Del772, Del231 and SNP947, the detection reagent can detect or identify the resistance of apples to anthracnose leaf blight, and a method for identifying the resistance of apples to anthracnose leaf blight is developed, thereby providing a new way for breeding disease-resistant apples.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of apple molecular breeding technology, specifically involving the application of detection reagents for molecular markers related to resistance to apple anthracnose leaf blight. Background Technology

[0002] apple( Malus domestica Anthracnose is an important economic crop in my country, and its healthy development has a significant impact on the agricultural and rural economy. Anthracnose leaf blight ( Glomerella Leaf spot is a serious foliar disease caused by fungi, which mainly affects apple leaves, causing premature leaf drop, significant weakening of the tree, and ultimately a serious decline in fruit yield and quality, resulting in huge economic losses to apple production.

[0003] In disease resistance breeding research, it has been clearly established that different apple varieties exhibit significant differences in resistance to anthracnose leaf blight. Among the widely cultivated varieties, 'Gala' and 'Golden Delicious' are highly susceptible, while 'Fuji' and its derivatives are highly resistant. Genetic studies have shown that this resistance trait is controlled by a single recessive gene, with the susceptible genotype being RR or Rr and the resistant genotype being rr. Molecular mapping studies have anchored the resistance gene locus to a specific region on apple chromosome 15, and molecular markers have been developed based on these mapping results for selection assistance. However, the overall predictive accuracy of these molecular markers is less than 96%, which is insufficient to meet the precision requirements of breeding practices. Although some reports have been made based on... MdTNL1 Developed molecular marker SNP 7309212 The screening accuracy was 100% in a limited sample, but this validation was based on only 23 germplasm resources and 33 'Golden Delicious' × 'Fuji' hybrids, which is insufficiently representative. More importantly, the marker falsely detected a susceptible genotype in the resistant variety 'Jonathan' (false positive), and genotypic segregation occurred in the hybrids of the two resistant varieties 'Fuji' and 'Jonathan'. Statistically, MdTNL1 The actual identification accuracy of the markers was less than 95.16%, indicating serious deficiencies in their predictive accuracy and varietal applicability. Therefore, it is essential to discover molecular markers with higher accuracy and wider applicability related to apple anthracnose leaf blight resistance and to develop matching detection reagents for rapid screening and genetic improvement of apple traits. Summary of the Invention

[0004] To address the aforementioned issues, this invention provides the application of detection reagents for molecular markers related to apple anthracnose leaf blight resistance. Detection reagents amplifying molecular markers Del772, Del231, and SNP947 can efficiently and accurately detect apple resistance to anthracnose leaf blight and have a wide range of applicable apple varieties.

[0005] To achieve the above objectives, the specific technical solution of the present invention is as follows: The first aspect of this invention provides the application of a detection reagent for molecular markers associated with resistance to apple anthracnose leaf blight, wherein the molecular markers are any one of Del772, Del231 and SNP947; The nucleotide sequence of Del772 is shown in SEQ ID NO.1, and the sequence shown in SEQ ID NO.1 has a deletion polymorphism from 134bp to 165bp. The nucleotide sequence of Del231 is shown in SEQ ID NO.4, and the 18th to 20th bp of the sequence shown in SEQ ID NO.4 has a deletion polymorphism. The nucleotide sequence of SNP947 is shown in SEQ ID NO.5, and a T / A polymorphism exists at position 35 of the sequence shown in SEQ ID NO.5; The application involves using the detection reagent to assist in the breeding of apple varieties with resistance to anthracnose leaf blight or to identify the resistance of apples to anthracnose leaf blight.

[0006] Furthermore, a specific deletion exists in the nucleotide sequence from 134bp to 165bp in the sequence shown in SEQ ID NO.1 of apples susceptible to anthracnose leaf blight; a homozygous deletion exists in the nucleotide sequence from 18bp to 20bp in the sequence shown in SEQ ID NO.4 of apples resistant to anthracnose leaf blight; and the genotype at the SNP site at 35bp in the sequence shown in SEQ ID NO.5 of apples resistant to anthracnose leaf blight is AA.

[0007] Furthermore, the detection reagent is a primer set for detecting molecular markers associated with resistance to apple anthracnose leaf blight.

[0008] Furthermore, the primer set for detecting Del772 consists of one forward primer and one reverse primer, the nucleotide sequence of which is shown in SEQ ID NO.2 and the nucleotide sequence of which is shown in SEQ ID NO.3; The primer set for detecting Del231 consists of two forward primers and one reverse primer. The nucleotide sequences of the forward primers are shown in SEQ ID NO.6 and SEQ ID NO.7, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.8. The primer set for detecting SNP947 consists of two forward primers and one reverse primer. The nucleotide sequences of the forward primers are shown in SEQ ID NO.9 and SEQ ID NO.10, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.11.

[0009] Furthermore, the varieties of apples to be tested are 'Beidou', 'Luyan', 'Rocket Fruit', 'Venus Gold', 'Australian Green Apple', 'Yanfu 3', 'Yanfu 10', 'Ruixue', 'Asus', 'Breben', 'Jonagkin', 'World One', 'Shinano Sweet', 'Shinano Gold', 'Shinano Red', 'Cherry Gala', 'Italian Early Red 1', 'Italian Early Red 2', and 'Ruby'. Pink', Sweetie', Mutsu', Early Green, Fujimaki No. 1, Luli', Fuji', Ruby', Red Apple's Flesh, Wang Lin', Red Star', Cockscomb', Xiushui', Qin Yang', Marshal Maoli's, Golden Crown', Gala's, Lu Ping 1', Lu Ping 2', Qin Cui's, GM310', Maiden's, Takuji's, Dai Green's, Dragon Gold Honey's, MD001', M9T337', Golden Crown's and Fuji's The hybrid offspring of 'Luli' × 'Red Flesh Apple', 'Shouhong', 'India', 'SH1', 'SH6', 'SH18', 'Red Agate', 'Aifei', 'Zhumei Begonia', 'Pingyi Sweet Tea', 'Luping 5', 'B9', 'Jingxiang', 'Luping 23', 'Luping 53', 'Marshal', 'Short Branch Fuji', 'Gala-4×', 'Changfu 2', 'Danding', 'GL-3', 'GM256', 'Huafeng', and 'Huali' are any one or more of these varieties.

[0010] A second aspect of the present invention provides a kit for detecting resistance of apples to anthracnose leaf blight, the kit comprising any one or more of the primer sets described above.

[0011] A third aspect of the present invention provides the application of the above-described reagent kit in detecting resistance of apples to anthracnose leaf blight.

[0012] A fourth aspect of the present invention provides a method for identifying resistance to apple anthracnose leaf blight, comprising the following steps: Extract DNA from the apple to be tested; Using the extracted DNA from the apple to be tested as a template, PCR amplification was performed using any one of the primers described above to obtain the amplification product; The amplified products are sequenced or fluorescence signals are detected. The resistance of the apple to be tested is determined based on the results of sequencing or fluorescence signal readings. Using the primer set for amplifying Del772: If the amplified band size is 242 bp, the apple being tested is resistant to apple anthracnose leaf blight; or Using the primer set for amplifying Del231: If the allele type of the sequence shown in SEQ ID NO.4 of the amplified product is a homozygous deletion genotype from 18bp to 20bp, then the apple being tested is resistant to apple anthracnose leaf blight; or Using the primer set for amplifying SNP947: If the genotype of the 35th bp of the sequence shown in SEQ ID NO.5 of the amplified product is AA, then the apple to be tested is resistant to apple anthracnose leaf blight.

[0013] Furthermore, the varieties of apples to be tested are 'Beidou', 'Luyan', 'Rocket Fruit', 'Venus Gold', 'Australian Green Apple', 'Yanfu 3', 'Yanfu 10', 'Ruixue', 'Huashuo', 'Briben', 'Jonagkin', 'Sekaiichi', 'Shinano Sweet', 'Shinano Gold', 'Shinano Red', 'Cherry Gala', 'Italian Early Red 1', 'Italian Early Red 2', and 'Ruby'. Pink', Sweetie', Mutsu', Zao Cui Lü', Fujimu No. 1', Luli', Fuji', Beni', Red Apple's Red Flesh ... Any one or more of the following: 'India', 'SH1', 'SH6', 'SH18', 'Red Agate', 'Aifei', 'Zhumei Begonia', 'Pingyi Sweet Tea', 'Luping 5', 'B9', 'Jingxiang', 'Luping 23', 'Luping 53', 'Marshal', 'Short-branch Fuji', 'Gala-4×', 'Changfu 2', 'Danting', 'GL-3', 'GM256', 'Huafeng', and 'Huali'.

[0014] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention discloses the application of a detection reagent for molecular markers associated with resistance to apple anthracnose leaf blight. Utilizing the genetic map of a 'Golden Delicious' × 'Fuji' hybrid population, this invention developed a QTL associated with resistance to apple anthracnose leaf blight. The QTL is located on chromosome 15 of the apple GDDH13 reference genome, with a physical location of 4.70Mb-8.04Mb in 'Golden Delicious' and 1.39Mb-6.94Mb in 'Fuji'. Three molecular markers, Del772, Del231, and SNP947, were developed within the QTL range to identify resistance to anthracnose leaf blight in apples. The nucleotide sequence of Del772 is shown in SEQ ID NO.1, the nucleotide sequence of Del231 is shown in SEQ ID NO.4, and the nucleotide sequence of SNP947 is shown in SEQ ID NO.5. Experiments showed that the identification efficiency of molecular marker Del772 was 97.6%, and the identification efficiencies of molecular markers Del231 and SNP947 were both as high as 97.6%, indicating a wide range of applicable apple varieties.

[0015] This invention also developed detection reagents for molecular markers Del772, Del231, and SNP947, which can be used to detect or identify the resistance of apples to anthracnose leaf blight. Furthermore, a method for identifying apple anthracnose leaf blight resistance was developed, which can identify the resistance or susceptibility of apple germplasm or hybrid offspring to anthracnose leaf blight, providing a new approach for breeding disease-resistant apples. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0017] Figure 1 This shows the colocalization of QTLs on apple chromosome 15. Figure 1 In the diagram, A represents the genetic linkage map and QTL mapping of the 'Golden Crown' apple variety. Figure 1 B in the diagram represents the genetic linkage map and QTL mapping of the 'Fuji' apple. Figure 1 In the figure, C represents the physical location of the QTL (GDDH13 reference genome annotation).

[0018] Figure 2 Development and polymorphism detection of the Del772 marker. Lanes 1-8 correspond to the following apple varieties: 'Luli', 'Fuji', 'Red Jade', 'Red Flesh Apple', 'Golden Delicious', 'Gala', 'Luping 1', and 'Qincui', respectively.

[0019] Figure 3 Development and validation of KASP tags (SNP947 and Del231).

[0020] Figure 4 This is the verification result of the Del772 marker in the evaluation of disease resistance in apple germplasm resources and hybrid populations in this invention; where M represents the marker, and lanes 1 to 46 correspond to the following apple varieties in sequence: 'Beidou', 'Luyan', 'Rocket Fruit', 'Venus Gold', 'Australian Green Apple', 'Yanfu 3', 'Yanfu 10', 'Ruixue', 'Huashuo', 'Breben', 'Jonagkin', 'World One', 'Shinano Sweet', 'Shinano Gold', 'Shinano Red', 'Cherry Gala', 'Italian Early Red 1', 'Italian Early Red 2', 'Shizuka', and 'Ruby'. Pink', Sweetie', Mutsu', Early Green, Fujimaki No. 1, Luli', Fuji', Ruby', Red Apple's Flesh, Wang Lin', Red Star', Cockscomb', Xiushui', Qin Yang', Marshal Maoli's, Golden Crown', Gala', Lu Ping 1', Lu Ping 2', Qin Cui', GM310', Otome', Takuji', Dai Green', Dragon Gold Honey's, MD001', M9T337', Lane Lanes 47 to 61 correspond to 15 hybrid offspring of 'Golden Delicious' and 'Fuji'. Lanes 62 to 73 correspond to 12 hybrid offspring of 'Luli' and 'Red Flesh Apple'. Lanes 74 to 86 correspond to the following apple varieties in order: 'Shouhong', 'Beidou', 'India', 'SH1', 'SH6', 'SH18', 'Red Agate', 'Aifei', 'Zhumei Begonia', 'Pingyi Sweet Tea', 'Luping 5', 'B9', and 'Jingxiang'.

[0021] Figure 5 Based on MdTNL1 Developed SNP 7309212 Sequencing diagram of PCR products from the disease-resistant variety 'Hongyu' and its five disease-resistant hybrid progeny for genotyping identification. Figure 5 Sequencing samples A, B, C, D, E, and F in the diagram represent the disease-resistant variety 'Hongyu' and its five disease-resistant hybrid progeny, respectively. The arrows indicate SNPs. 7309212 The genotyping results at the locus show that bimodal peaks indicate heterozygous genotypes, while unimodal peaks indicate homozygous genotypes. Detailed Implementation

[0022] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0023] Example 1: Using the 'Golden Crown' × 'Fuji' genetic map and the MapQTL method, resistance-related QTLs were detected on chromosome 15. Details are as follows:

[0024] (1) Test materials: 217 F1 plants obtained by crossing 'Golden Delicious' × 'Fuji' (planted at the Tianpinghu Experimental Base of Shandong Fruit Research Institute).

[0025] (2) Phenotypic survey: Due to the high temperature and humidity in summer in Tai'an, Shandong Province, the conditions are suitable for the occurrence of anthracnose leaf blight pathogen. From 2022 to 2024, the phenotype of anthracnose leaf blight resistance in hybrid populations under natural field disease conditions was investigated for three consecutive years.

[0026] (3) MapQTL localization method: Select interval mapping localization mode, select 'Regression' for the analysis parameter algorithm, and select the default for the other parameters. Determine the QTL region based on 1000 PT tests. For 'Fuji', the whole genome threshold is 6.9 at a confidence level of 1. For 'Gold Crown', the whole genome threshold is 6.6 at a confidence level of 1.

[0027] (4) Using the linear relationship between the genetic map and the physical map, the QTL intervals of the present invention are aligned with the reported QTL intervals on the apple GDDH13 reference genome, and their physical locations are marked using MapChart 2.2 software.

[0028] The results are as follows Figure 1 As shown, the LOD value of QTL (qGLS_GD) on chain group 15 of 'Gold Crown' ranges from 11.37 to 16.38, with a contribution rate between 25.2% and 34.2%, and a physical location of 4.70 to 8.04 Mb; the LOD value of QTL (qGLS_FJ) on chain group 15 of 'Fuji' ranges from 13.59 to 14.29, with a contribution rate between 29.4% and 30.6%, and a physical location of 1.39 Mb to 6.94 Mb.

[0029] (5) The physical location of the overlapping QTL interval of qGLS_GD and qGLS_FJ in this invention is 4.70Mb-6.94Mb.

[0030] (6) The physical location of the overlapping interval between the QTL qGLS_GD of the present invention and the reported QTLs is 7.28Mb-7.86Mb.

[0031] Example 2 The highly polymorphic InDel tag Del772 was developed based on the overlapping QTL interval Chr15 (4.70Mb-6.94Mb) of 'Gold Crown' (qGLS_GD) and 'Fuji' (qGLS_FJ). Details are as follows:

[0032] Test materials: apple anthracnose leaf blight resistant varieties 'Luli', 'Fuji', 'Hongyu' and 'Hongrou Apple', and susceptible varieties 'Jinguan', 'Gala', 'Luping 1' and 'Qincui', all collected from the Tianpinghu Experimental Base of Shandong Provincial Fruit Tree Research Institute.

[0033] (1) Development of InDel marker: Using GDR Rosaceae genome data and whole-genome resequencing variation data of 'Golden Crown', 'Ruby', 'Luli', 'Fuji', 'Red Flesh Apple' and 'Purple Pearl', the InDel molecular marker Del772 located in the apple GDDH13 reference genome Chr15: 5275899 was screened and obtained. This marker is located in the intergenic region between MD15G1077100 and MD15G1077200. The sequence of the Del772 marker is shown in SEQ ID NO.1; SEQ ID NO.1: ATTTCGTCTTTGGTGTATTAGGAAAAAAACTCAACAACATAACAATAACTTTTATGGGACAAGTACATTACAAATTTACAGTGACATTCTATGTCACTTCATGTATAATGTCGTGTGTTAATTTTTTTTCA TATCCATGAAT AATTAACACAGAACACCACAG The nucleotide sequence underlined in the sequence shown in SEQ ID NO.1 of the susceptible variety has a unique deletion.

[0034] (2) Based on the analysis of the differences in nucleotide sequences of the genomes of disease-resistant and disease-susceptible varieties, primers Del772-F and Del772-R were designed to specifically amplify Del772. The primer sequences are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively.

[0035] Del772-F: 5'-ATTTCGTTCTTTGGTGTATTAGG-3', SEQ ID NO. 2.

[0036] Del772-R: 5'-GGATTTGTTGGTAGATTTTGTG-3', SEQ ID NO. 3.

[0037] (3) DNA was extracted from the tested apple varieties 'Luli', 'Fuji', 'Hongyu', 'Red Flesh Apple', 'Golden Delicious', 'Gala', 'Luping 1' and 'Qincui' using the Tiangen DNA Extraction Kit (DP305-02). The extracted DNA was amplified by PCR using Del772-F and Del772-R.

[0038] Each 20 μL PCR amplification system contains: 10 μL 2× Taq Master Mix, 7 μL ddH2O, 1 μL 10 μmol / L Del772-F, 1 μL 10 μmol / L Del772-R, and 1 μL 20 ng / μL DNA.

[0039] PCR amplification program: 95℃ for 3 min; 95℃ for 15 s, 53℃ for 15 s, 72℃ for 15 s, 34 cycles; extension at 72℃ for 5 min.

[0040] (4) Detect the PCR products and determine the genotyping results using agarose gel electrophoresis at a concentration of 2 w / v%.

[0041] The results are as follows Figure 2 As shown, M on the far left is the marker. Lanes 1-4 correspond to the disease-resistant varieties 'Luli', 'Fuji', 'Hongyu', and 'Red Flesh Apple', respectively. The disease-resistant varieties can only amplify one band of size 242bp. Lanes 5-8 correspond to the disease-susceptible varieties 'Golden Delicious', 'Gala', 'Luping 1', and 'Qincui', respectively. The disease-susceptible varieties can amplify two bands of size 242bp and 210bp, respectively, showing a heterozygous pattern.

[0042] (5) PCR products were sent for sequencing. The agarose gel containing the target band was excised under UV light, and the PCR products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing results showed that the resistant variety could amplify a 242bp fragment, while the susceptible variety amplified both 242bp and 210bp heterozygous bands. The 242bp band in the resistant variety was 32bp longer than the 210bp band in the susceptible variety. The extra 32bp sequence is the nucleotide sequence underlined in the sequence shown in SEQ ID NO.1.

[0043] Example 3 Molecular markers Del231 and SNP947 were developed based on the 'Golden Crown' (qGLS_GD) of this invention and the reported QTLs qGLS_1 and qGLS_2 overlapping QTL region Chr15: 7.28-7.86 Mb. Details are as follows:

[0044] (1) Development of KASP markers: Using GDR Rosaceae genome data and whole-genome resequencing variation data of 'Golden Delicious', 'Ruby', 'Luli', 'Fuji', 'Red Flesh Apple' and 'Purple Pearl', molecular markers Del231 and SNP947 located in the QTL interval (Chr15: 7.28-7.86Mb) were developed. Molecular marker Del231 showed deletion polymorphism at Chr15: 7535231 (CTG / -) in the apple GDDH13 reference genome, and molecular marker SNP947 showed base polymorphism at Chr15: 7535947 (T / A) in the apple GDDH13 reference genome.

[0045] The nucleotide sequence of molecular marker Del231 is shown in SEQ ID NO.4. A deletion polymorphism exists in the sequence from 18 bp to 20 bp. The genotype of this variation is "CTG:-" in susceptible varieties and "-:-" (deletion:deletion) in resistant varieties. SEQ ID NO.4: TGGCATCTCAATTTCTG CTG The underlined nucleotide sequence in the sequence shown in SEQ ID NO.4 of the disease-resistant variety has a homozygous deletion. The nucleotide sequence of SNP947 is shown in SEQ ID NO.5. A T / A polymorphism exists at position 35 of the sequence shown in SEQ ID NO.5. The genotype of this variation is "T:A" in susceptible varieties and "A:A" in resistant varieties. SEQ ID NO.5: GAATGGCCTAAACATCTACGATCATCACAGAGACWTGAGACTGGATATTGACAACATG, where W indicates that the base is T or A.

[0046] (2) Using the Primer Premier 3.0 online platform, a KASP primer set was developed for the flanking sequences 200 bp before and after the SNP site: the KASP primer set contains two allele-specific forward primers and one universal reverse primer.

[0047] The primer set for amplifying Del231 consists of the forward primers with nucleotide sequences as shown in SEQ ID NO. 6 and SEQ ID NO. 7, and the reverse primer as shown in SEQ ID NO. 8; SEQ ID NO.6: 5'- GAAGGTGACCAAGTTCATGCTTGGCATCTCAATTTCTGCTG-3'; SEQ ID NO.7: 5'-GAAGGTCGGAGTCAACGGATTGCCATGGCATCTCAATTTCTG-3'; SEQ ID NO. 8: 5'-TCCGAGTCCTAACTGATGCA-3'.

[0048] The primer set for amplifying SNP947 consists of the forward primers with nucleotide sequences as shown in SEQ ID NO.9 and SEQ ID NO.10, and the reverse primer as shown in SEQ ID NO.11.

[0049] SEQ ID NO.9: 5'-AAGGTGACCAAGTTCATGCTCATGTTGTCAATATCCAGTCTCAT-3'; SEQ ID NO.10: 5'-GAAGGTCGGAGTCAACGGATTCATGTTGTCAATATCCAGTCTCAA-3'; SEQ ID NO. 11: 5'-GAATGGCCTAAACATCTACGATCAT-3'.

[0050] In subsequent experiments, FAM and VIC fluorescent adapter sequences were added to the 5' ends of the two forward primers, while the universal reverse primer sequence remained unchanged.

[0051] (3) Each 5µL KASP PCR amplification system contains: 2.5µL 2× Master Mix, 2µL 10ng / μL DNA, 0.07µL primer premix (where the ratio of allele-specific primers to universal primers is 12:12:30, and the working concentration of primers is 10µmol / L) and 0.43µL ddH2O.

[0052] The amplification program is as follows: 94℃, 15min; 94℃, 20s; 61℃~55℃, 1min, 10 cycles (-0.6℃ / cycle); 94℃, 20s; 55℃, 60s, 26~42 cycles.

[0053] After amplification, fluorescence signals were detected using a BMG PHERAstar fluorescence scanner. Raw data were exported using Kraken software and genotyping analysis was performed using SNPviewer. The generated two-dimensional scatter plot ( Figure 3 Each data point represents a sample, and samples with the same genotype will cluster together. Points located near the X-axis or Y-axis represent two different homozygous genotypes, while points distributed along the diagonal represent heterozygous genotypes, thus achieving accurate and visual identification of the population genotype.

[0054] Example 4: Genotyping and phenotypic verification were performed on 108 germplasm resources and their hybrid offspring using the developed molecular markers Del772, Del231, and SNP947. Details are as follows:

[0055] Disease resistance was tested using molecular markers Del772, Del231, and SNP947 on 70 representative apple germplasm resources, 23 hybrids of 'Luli' × 'Red Flesh Apple' (D58, D127, D134, D146, D157, MA17, M9, M30, M34, M48, M51, M54, M56, M58, M59, M64, M88, M94, M95, M118, M129, M130, M150), and 15 hybrids of 'Golden Delicious' × 'Fuji' (GF10~GF17, GF20~GF25). Specific germplasm resource information and test results are shown in Tables 1-6. Figure 4 .

[0056] Table 1. Genotype-phenotype matching results of KASP and InDel markers in germplasm resources and hybrid populations. Note: Correct matching number refers to the number of plants whose genotype prediction results match the actual phenotype results; disease-resistant-susceptible bands indicate that the actual phenotype is disease-resistant, but the genotype prediction result is disease-susceptible; disease-susceptible-resistant bands indicate that the actual phenotype is disease-susceptible, but the genotype prediction result is disease-resistant.

[0057] Table 2 Genotyping results of InDel and KASP markers in germplasm resources and hybrid populations Table 3 is a continuation of Table 2. Table 4 is a continuation of Table 3. Table 5 is a continuation of Table 4. Table 6 is a continuation of Table 5. Note: "-" in Tables 2-6 indicates that it was not measured.

[0058] From Tables 1 to 6 and Figure 4 As can be seen, among the 93 germplasm accessions detected by Del231, all amplified bands matched the anthracnose leaf blight resistance phenotype, with an identification efficiency of 100%. Similarly, among the 94 germplasm accessions detected by SNP947, the amplified bands corresponded perfectly to the resistance phenotype, with an identification efficiency of 100%. Among the 84 germplasm accessions detected by the Del772 marker, the number of individuals with amplified bands matching the resistance phenotype was 82, with an identification efficiency of 97.6%.

[0059] Comparative Example 1: Based on MdTNL1 Developed SNP 7309212 Marker identification capability determination This invention uses the disease-resistant variety 'Jonathan' and its five hybrid offspring (disease-resistant F1 generation single plants obtained by crossing the disease-resistant varieties 'Fuji' and 'Jonathan') as materials. Genomic DNA was extracted using the Tiangen DNA Extraction Kit (DP305-02) and reported SNPs. 7309212 Labeled specific primers (PCRSNP) 7309212 -F: 5'-AGATTGATACTCAGAGACTG-3'; PCRSNP 7309212 PCR amplification was performed using the formula -R: 5'-CAATGAAGGTCCAGGAAGAA-3'. The PCR amplification system was the same as in Example 2. The PCR amplification program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 50℃ annealing for 15 s, 72℃ extension for 15 s, for a total of 34 cycles; final extension at 72℃ for 5 min. The PCR products were sequenced by Sangon Biotech (Shanghai) Co., Ltd. to determine the SNPs. 7309212 The base type of the site.

[0060] Sequencing results as follows Figure 5 As shown, the disease-resistant variety 'Hongyu' has SNP 7309212 The genotype at the locus is AT ( Figure 5The A in the marker. According to the original criteria for this marker (AA genotype indicates a disease-resistant variety, AT genotype indicates a susceptible variety), 'Hongyu' should have been incorrectly classified as a susceptible variety, which contradicts the known field resistance phenotype. Among the 5 offspring of the 'Fuji' × 'Hongyu' hybrid ( Figure 5 The B-F genotypes segregated. However, all five progeny strains exhibited disease resistance.

[0061] This comparative study preliminarily identified SNPs using whole-genome resequencing data. 7309212 The genotype at the locus in 'Hongyu' is AT, which was confirmed by PCR amplification and sequencing experiments: based on MdTNL1 SNPs developed through gene development 7309212 The (A / T) mark has resulted in serious misjudgments when used to identify the anthracnose leaf blight resistance of the apple variety 'Red Jade' and its hybrids with 'Fuji'. Statistics show that... MdTNL1 The actual accuracy of the labeling was less than 95.16% (59 / 62), indicating that the SNP... 7309212 The predictive accuracy and varietal applicability of the marker are seriously flawed. In particular, in disease resistance breeding involving materials such as 'Hongyu', using this marker will lead to incorrect selection and reduce breeding efficiency.

[0062] It should be noted that when numerical ranges are involved in this invention, it should be understood that both endpoints of each numerical range and any value between the two endpoints can be selected. Since the steps and methods used are the same as in the embodiments, preferred embodiments are described here to avoid redundancy. Although preferred embodiments of the invention have been described, those skilled in the art, once they understand the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of this invention.

[0063] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. The application of a detection reagent for molecular markers associated with resistance to apple anthracnose leaf blight, characterized in that, The molecular marker is any one of Del772, Del231 and SNP947; The nucleotide sequence of Del772 is shown in SEQ ID NO.1, and the sequence shown in SEQ ID NO.1 has a deletion polymorphism from 134bp to 165bp. The nucleotide sequence of Del231 is shown in SEQ ID NO.4, and the 18th to 20th bp of the sequence shown in SEQ ID NO.4 has a deletion polymorphism. The nucleotide sequence of SNP947 is shown in SEQ ID NO.5, and the SNP site at position 35 of the sequence shown in SEQ ID NO.5 exhibits a T / A polymorphism; The application is to use the detection reagent to assist in the breeding of apple varieties with resistance to anthracnose leaf blight or to identify apple anthracnose leaf blight resistance.

2. The application of the detection reagent for molecular markers related to resistance to apple anthracnose leaf blight according to claim 1, characterized in that, A specific deletion exists in the nucleotide sequence from 134bp to 165bp in the sequence shown in SEQ ID NO.1 of apples susceptible to anthracnose leaf blight; a homozygous deletion exists in the nucleotide sequence from 18bp to 20bp in the sequence shown in SEQ ID NO.4 of apples resistant to anthracnose leaf blight; and the genotype at the SNP site at 35bp in the sequence shown in SEQ ID NO.5 of apples resistant to anthracnose leaf blight is AA.

3. The application of the detection reagent for molecular markers related to resistance to apple anthracnose leaf blight according to claim 2, characterized in that, The detection reagent is a primer set for detecting molecular markers associated with resistance to apple anthracnose leaf blight.

4. The application of the detection reagent for molecular markers related to resistance to apple anthracnose leaf blight according to claim 3, characterized in that, The primer set for detecting Del772 consists of one forward primer and one reverse primer. The nucleotide sequence of the forward primer is shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.

3. The primer set for detecting Del231 consists of two forward primers and one reverse primer. The nucleotide sequences of the forward primers are shown in SEQ ID NO.6 and SEQ ID NO.7, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.

8. The primer set for detecting SNP947 consists of two forward primers and one reverse primer. The nucleotide sequences of the forward primers are shown in SEQ ID NO.9 and SEQ ID NO.10, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.

11.

5. A kit for detecting resistance of apples to anthracnose leaf blight, characterized in that, The kit contains any one or more of the primers described in claim 4.

6. The use of the kit according to claim 5 in detecting resistance of apples to anthracnose leaf blight.

7. A method for identifying resistance to apple anthracnose leaf blight, characterized in that, Includes the following steps: Extract DNA from the apple to be tested; Using the extracted DNA from the apple to be tested as a template, PCR amplification was performed using any one of the primers described in claim 3 to obtain the amplification product; The amplified products are sequenced or fluorescence signals are detected. The resistance of the apple to be tested is determined based on the results of sequencing or fluorescence signal readings. Using the primer set for amplifying Del772: If the amplified band size is 242 bp, then the apple being tested is resistant to apple anthracnose leaf blight; or Using the primer set for amplifying Del231: If the allele type of the sequence shown in SEQ ID NO.4 of the amplified product is a homozygous deletion genotype from 18bp to 20bp, then the apple being tested is resistant to apple anthracnose leaf blight; or Using the primer set for amplifying SNP947: If the genotype of the 35th bp of the sequence shown in SEQ ID NO.5 of the amplified product is AA, then the apple to be tested is resistant to apple anthracnose leaf blight.

8. The method according to claim 7, characterized in that, The apple varieties tested were 'Beidou', 'Luyan', 'Rocket Fruit', 'Venus Gold', 'Australian Green Apple', 'Yanfu 3', 'Yanfu 10', 'Ruixue', 'Asus', 'Breben', 'Jonagkin', 'World One', 'Shinano Sweet', 'Shinano Gold', 'Shinano Red', 'Cherry Gala', 'Italian Early Red 1', 'Italian Early Red 2', and 'Ruby'. Pink', Sweetie', Mutsu', Early Green, Fujimaki No. 1, Luli', Fuji', Ruby', Red Apple's Flesh, Wang Lin', Red Star', Cockscomb', Xiushui', Qin Yang', Marshal Maoli's, Golden Crown', Gala's, Lu Ping 1', Lu Ping 2', Qin Cui's, GM310', Maiden's, Takuji's, Dai Green's, Dragon Gold Honey's, MD001', M9T337', Golden Crown's and Fuji's The hybrid offspring of 'Luli' × 'Red Flesh Apple', 'Shouhong', 'India', 'SH1', 'SH6', 'SH18', 'Red Agate', 'Aifei', 'Zhumei Begonia', 'Pingyi Sweet Tea', 'Luping 5', 'B9', 'Jingxiang', 'Luping 23', 'Luping 53', 'Marshal', 'Short Branch Fuji', 'Gala-4×', 'Changfu 2', 'Danding', 'GL-3', 'GM256', 'Huafeng', and 'Huali' are any one or more of these varieties.