Methods for detecting african swine fever virus and related kits

By amplifying natural quadruplex DNA in the genome of African swine fever virus and utilizing a colorimetric reaction, the problems of equipment dependence and nonspecificity of existing detection methods are solved, enabling rapid, simple, and specific virus detection suitable for grassroots laboratories and field applications.

CN122105012APending Publication Date: 2026-05-29HORIZON OMICS BIOTECH LTD +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
HORIZON OMICS BIOTECH LTD
Filing Date
2026-04-13
Publication Date
2026-05-29

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application provides an African swine fever virus detection method and kit based on the properties of four-strand DNA oxidoreductase. The method uses isothermal amplification technology to amplify the genomic fragment containing the four-strand DNA sequence in the African swine fever virus genome, and realizes rapid and visual detection of the African swine fever virus by adding hematin and oxidoreductase substrate for color development.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Related applications

[0002] This application claims priority and related benefits to Chinese Patent Application No. 202510465607.5, filed on April 14, 2025, the entire contents of which are incorporated herein by reference. Invention Field

[0003] This application relates to the field of pathogen detection technology. Specifically, this application provides a method and corresponding kit for detecting African swine fever virus based on the properties of tetrastranded DNA oxidoreductase. Background of the Invention

[0004] African swine fever (ASFV) is currently the most serious and deadly infectious disease threatening the global pig industry, causing enormous economic losses. Characterized by high morbidity and mortality rates in both domestic and wild pigs, it is listed as a notifiable animal disease by the World Organisation for Animal Health (WOAH). Currently, there are no safe and effective commercially available vaccines or antiviral drugs, making the situation for ASF prevention and control extremely serious. Existing methods for detecting ASF mainly include polymerase chain reaction (PCR), real-time fluorescent PCR (qPCR), and loop-mediated isothermal amplification (LAMP) techniques, as described below.

[0005] Polymerase chain reaction (PCR): This method relies on PCR instruments for amplification, and the products are identified by electrophoresis after amplification. It is highly technical, requiring sophisticated laboratory equipment, high-quality reagents, and skilled operators. The electrophoresis process is time-consuming and necessitates the use of specialized equipment such as electrophoresis apparatus and gel imaging systems.

[0006] Real-time fluorescence PCR (qPCR): This method uses a Q-PCR instrument for amplification and identification. The equipment and reagents used are expensive, limiting its widespread application in primary laboratories. Furthermore, the operation is complex, requiring specialized training and demanding high skill levels from the testing personnel.

[0007] Loop-mediated isothermal amplification (LAMP): This technique uses isothermal amplification and does not rely on complex equipment. However, product identification usually requires electrophoresis or staining with non-specific dyes, resulting in poor specificity and a high false-positive rate. Existing methods combining isothermal LAMP amplification and the redox properties of quadruplex DNA for nucleic acid detection involve designing quadruplex DNA into the primers, leading to non-specific amplification being identified as positive.

[0008] Therefore, these existing methods all have some limitations. Developing a simple, rapid, and effective detection method is of great significance for rapid on-site screening of African swine fever virus. Summary of the Invention

[0009] This application utilizes the naturally occurring quadruplex DNA sequence in the African swine fever virus genome. The amplified product combines with heme chloride to form a complex with oxidoreductase activity, catalyzing a color change in the chromogenic substrate, enabling naked-eye visual detection. The operation is simple, and neither amplification nor identification requires expensive instruments. The inventors of this application also unexpectedly discovered that directly amplifying endogenous quadruplex sequences in the microbial genome avoids the risk of non-specific recognition caused by introducing exogenous quadruplex structures in primer design. By designing the quadruplex DNA into the product, non-specific amplification will not be recognized, significantly improving detection specificity.

[0010] On the one hand, this application provides a method for detecting African swine fever virus, which includes the following steps: 1) Amplify the specific nucleic acid fragments in African swine fever virus that can form quadruplex DNA to obtain quadruplex DNA products.

[0011] 2) Add heme and oxidoreductase substrate to the obtained quadruplex DNA product and determine the presence of African swine fever virus by colorimetric reaction.

[0012] In some embodiments, the quadruplex DNA product has oxidoreductase activity, which can colorimetrically react with the substrate.

[0013] In some implementations, the above detection method further includes analyzing, prior to step 1), whether there are species-specific nucleic acid fragments in the African swine fever virus capable of forming a quadruplex DNA structure.

[0014] In some implementations, the above detection method further includes analyzing, prior to step 1), whether there is a species-specific nucleic acid fragment in the African swine fever virus that can form a quadruplex DNA structure, and the quadruplex DNA structure has oxidoreductase activity that can colorimetrically react with the substrate.

[0015] In some embodiments, the amplification is isothermal amplification. In a preferred embodiment, loop-mediated isothermal amplification (LAMP) is used for amplification.

[0016] In some embodiments, the oxidoreductase substrate is 3,3',5,5'-tetramethylbenzidine (TMB) and hydrogen peroxide (H2O2).

[0017] On the other hand, this application provides a kit for the aforementioned detection method of African swine fever virus, which includes: reagents for amplification reaction; heme; and oxidoreductase substrate, etc.

[0018] In some implementations, the reagents used for the amplification reaction include amplification primers, amplification reaction buffers, polymerases, etc.

[0019] In some implementations, the reagent used for the amplification reaction is a LAMP amplification reagent. Brief description of the attached figures

[0020] Figure 1A-1B The combined isothermal amplification and redox properties of tetrastranded DNA were used to detect African swine fever virus (ASFV), showing amplification bands of ASFV at different copy numbers. Figure 1A ) and color development results ( Figure 1B ).

[0021] Figure 2A-2B The image shows amplification bands specific to African swine fever virus primers, obtained by combining isothermal amplification and redox properties of tetrastranded DNA. Figure 2A ) and color development results ( Figure 2B ).

[0022] Figures 3A-3B The combined isothermal amplification and tetrastranded DNA redox properties demonstrated the specificity of detecting African swine fever virus, among which... Figure 3A For the color development results, Figure 3B The amplified bands of the viral plasmid without the G4 sequence are shown. Detailed Implementation

[0023] This application provides a method and kit for rapid detection of African swine fever virus based on the oxidoreductase properties of quadruplex DNA. The method utilizes the oxidoreductase properties of quadruplex DNA to achieve rapid and visual detection of African swine fever virus through isothermal amplification and colorimetric reactions.

[0024] In the specific implementation plan, this application amplifies the sequence of quadruplex DNA in the genome of African swine fever virus using isothermal amplification technology, and then uses heme and oxidoreductase substrates (such as H2O2, TMB) for colorimetric reaction. The result is judged by observing the color change with the naked eye, which does not require complicated instruments and equipment and reduces the detection cost.

[0025] Quadruplex DNA (G-quadruplex DNA) is a special nucleic acid structure, unlike the traditional double-stranded DNA structure. It is an atypical structure formed by the folding of a guanine (G)-rich DNA sequence. The core of quadruplex DNA is a planar structure called a G-tetrad, formed by four guanine residues interacting through hydrogen bonds. Each G-tetrad consists of four Gs linked by eight hydrogen bonds, forming a stable plane. Multiple G-tetrads can stack together to form the overall structure of quadruplex DNA. Quadruplex DNA can interact with certain oxidoreductases (such as peroxidases) and participate in redox reactions. For example, quadruplex DNA can bind heme, forming a peroxidase-like active site that catalyzes the decomposition of H₂O₂ and the oxidation of TMB, producing a blue product.

[0026] The structure of G-quadruplexes can be predicted and verified using conventional methods in this field. For example, specialized G-quadruplex prediction tools such as QGRS Mapper, G4Hunter, and G4-Explorer can be used to analyze whether structures that may form G-quadruplexes exist in the sequence. For example, the structure and stability of G-quadruplexes can be verified using methods such as DNase I footprinting, fluorescence resonance energy transfer (FRET), nuclear magnetic resonance (NMR), X-ray crystallography, or thermal stability analysis.

[0027] In the specific implementation plan, this application designs the quadruplex DNA in the amplification product rather than in the primer, which effectively avoids interference from non-specific amplification and improves the specificity of detection.

[0028] In a specific implementation plan, the detection method of this application may include: extracting nucleic acid from the pathogenic microorganism from the sample to be tested; designing LAMP primers targeting the specific nucleic acid sequence (including quadruplex DNA) of the target pathogenic microorganism to perform isothermal amplification of the extracted nucleic acid; adding heme and oxidoreductase substrates (such as H2O2, TMB) to the amplification product to catalyze a colorimetric reaction; and observing the color change of the reaction solution with the naked eye to determine whether the sample contains the target pathogenic microorganism. A positive reaction is blue, and a negative reaction is colorless.

[0029] In a specific implementation, the kit of this application may include: amplification reagents for specific nucleic acid sequences (containing quadruplex DNA) of African swine fever virus, including LAMP primers, amplification reaction buffers, polymerases, etc.; heme; oxidoreductase substrates such as TMB and H2O2; and optional other buffers such as NaH2PO4 buffer.

[0030] The detection method and kit of this application are simple to operate. From nucleic acid extraction to result determination, no complicated equipment or cumbersome steps are required, making them suitable for application in scenarios such as primary laboratories and rapid on-site testing.

[0031] In specific implementation schemes, the detection methods and kits of this application are suitable for rapid detection of African swine fever virus. For example, the entire process from sample processing to result interpretation can be completed in about 1 hour, achieving efficient detection.

[0032] In a specific implementation, the method and kit of this application are capable of detecting African swine fever virus. Preferably, the specific nucleic acid sequence of African swine fever virus used for detection is shown in SEQ ID NO:1.

[0033] In this specification and claims, the words “comprising,” “including,” and “containing” mean “including but not limited to” and are not intended to exclude other parts, additives, components, or steps.

[0034] It should be understood that the features, characteristics, components or steps described in a particular aspect, embodiment or example of this application may be applied to any other aspect, embodiment or example described herein, unless there is any contradiction.

[0035] The foregoing disclosure generally describes the present invention, and the following embodiments further illustrate the invention. These embodiments are described merely to illustrate the invention and not to limit its scope. Although specific terms and values ​​are used herein, they are also to be understood as exemplary and do not limit the scope of the invention. Unless otherwise specified, the reagents, experimental methods, and techniques used in the embodiments are known in the art.

[0036] Example

[0037] Example 1: Sensitivity Detection of African Swine Fever Virus Amplification

[0038] This embodiment verifies the detection of African swine fever virus using the method described in this application. First, a specific fragment of African swine fever virus containing quadruplex DNA was synthesized and cloned into the plasmid vector PUC57. The sequence of the specific fragment of African swine fever virus detected is as follows: AGATCACATGTTTTATCACCATGGCGACATGTCGTTAAACACAAGTATTATAAAAGCCGCCCAGTATTACCCAGGCTCCTCCCACCTCTATCCGGTATTCATAGGCATAGGAAGTTTTGGCTCCAGGCACCTGGGAGGAAAGGATGCAGGATCCCCAAGAT ACATCAGTGTGCAGCTTGCGTCTGAATTTATTAAAACAATGTTCCCCGCGGAGGACTCATGGCTTCTCCCCTACGTCTTTGAGGACGGCCAGCGGGCGGAACCAGAGTACTACGGGGCCCGTCGACTGCAGAGGCCTGCATGCAAGCTTGGCGTAATCATG (SEQ ID NO:1) The primer sequences for LAMP amplification are as follows: F3: GCCGCCCAGTATTACCCA (SEQ ID NO:2) FIP: TTCCTCCCAGGTGCCTGGAGCTCCTCCCACCTCTATCCG (SEQ ID NO:3) BIP: TACATCAGTGTGCAGCTTGCGTAGAAGCCATGAGTCCTCCG (SEQ ID NO:4) B3: CTGGCCGTCCTCAAAGAC (SEQ ID NO:5) LF:CCAAAACTTCCTATGCCTATGAA (SEQ ID NO:6) Add primers and plasmid template (10 0 ~10 7 Mix copy (copy), LAMP buffer, dNTPs, and Bst 3.0 polymerase, and perform the amplification reaction for 30 minutes; Then, a redox reaction was performed: a mixture of heme and acidic NaH2PO4 buffer was added to the amplification product, mixed well, and then a mixture of TMB and H2O2 was added and mixed well.

[0039] Result interpretation: A positive reaction is blue, and a negative reaction is colorless. See Figure 1, where the EP tubes from left to right represent the negative control, 10... 7 copies / μL, 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 103 copies / μL, 10 2 copies / μL, 10 1 copies / μL and 10 0 Copies / μL, capable of detecting down to 10 2 African swine fever virus (ASFV) copies / μL.

[0040] In addition, the amplified products will be subjected to electrophoresis under the following conditions: 200V, 150mA, 30 minutes.

[0041] The results showed that using 10 2 copy / μL-10 7 Significant amplification bands were observed in viral plasmids at concentrations of copies / μL. See [link to relevant documentation]. Figure 1A .

[0042] Example 2: Specific detection of African swine fever virus amplification primers

[0043] The LAMP system was prepared according to Example 1, and pork DNA (22 ng / μL) and African swine fever virus plasmid (3.06 × 10⁻⁶ ng / μL) were amplified simultaneously. 8 Copy / μL and 3.06×10 9 (Copies / μL), incubated at 70℃ for 30 minutes and 50 minutes respectively. After incubation, samples were taken for analysis of LAMP products using agarose gel electrophoresis (1% agarose gel solution was prepared with 1×TAE buffer, and 0.01% nucleic acid dye was added. Electrophoresis was run at 120.0 V for 30.0 min, and imaging was performed under UV light). The remaining samples were mixed with 4 μM heme and chromogenic buffer, and then TMB chromogenic solution was added for color development. Figure 2A-2B As shown in the electrophoresis and colorimetric results, no amplification band was observed and no color development was observed after amplifying pork DNA, while the viral plasmid showed a band and color development. These results demonstrate the specificity of the amplification primers for African swine fever virus.

[0044] Example 3: Specificity of LAMP amplification and chromogenic method – Amplification of gene fragments without the G4 sequence does not produce color development.

[0045] The LAMP system was prepared according to Example 1. Viral plasmids containing the G4 sequence and those without the G4 sequence were amplified separately. The mixtures were incubated at 70°C for 30 minutes. After incubation, samples were taken and analyzed using agarose gel electrophoresis (1% agarose gel solution was prepared with 1×TAE buffer, and 0.01% nucleic acid dye was added. Electrophoresis was run at 120.0 V for 30.0 min, and imaging was performed under ultraviolet light). The remaining samples were mixed with 4 μM heme and chromogenic buffer, and then TMB chromogenic solution was added for color development. Figures 3A-3BAs shown, the amplified plasmid without the G4 sequence showed an amplification band after electrophoresis, indicating the presence of amplification products, but no color development, demonstrating the specificity of this method.

[0046] Experimental results show that the method described in this application can accurately detect African swine fever virus and has high specificity and sensitivity.

[0047] Various changes and equivalent substitutions may be made to the embodiments disclosed in this application without departing from the spirit and scope of this disclosure. Unless the context otherwise requires, any feature, step, or embodiment of the embodiments disclosed herein may be used in combination with any other feature or embodiment.

Claims

1. A method for detecting African swine fever virus, comprising the following steps: 1) Amplify the specific nucleic acid fragments in African swine fever virus that can form quadruplex DNA to obtain quadruplex DNA products; as well as 2) Add heme and oxidoreductase substrate to the obtained quadruplex DNA product and determine the presence of African swine fever virus by colorimetric reaction.

2. The method according to claim 1, further comprising: Before step 1), analyze whether there are species-specific nucleic acid fragments in the African swine fever virus that can form a quadruplex DNA structure.

3. The method according to claim 2, wherein the quadruplex DNA structure has oxidoreductase activity and is capable of colorimetrically reacting with the substrate.

4. The method according to claim 1 or 2, wherein the amplification is isothermal amplification.

5. The method according to claim 4, wherein the amplification employs loop-mediated isothermal amplification (LAMP).

6. The method according to any one of claims 1-5, wherein the oxidoreductase substrate is 3,3',5,5'-tetramethylbenzidine (TMB) and hydrogen peroxide (H2O2).

7. A kit for use in the method for detecting African swine fever virus according to any one of claims 1-6, said kit comprising: Reagents, heme, and oxidoreductase substrates used in the amplification reaction.

8. The kit according to claim 7, wherein the reagents for the amplification reaction include amplification primers, amplification reaction buffer, polymerase, etc.