A recombinant Bacillus subtilis strain producing high-activity β-galactosidase and its application

By optimizing the PphrE promoter, NCS sequence, and 5'-UTR in Bacillus subtilis WG600, the expression efficiency of β-galactosidase was improved, solving the problem of low expression efficiency in the prior art. This enabled the production of β-galactosidase with high enzyme activity, which is suitable for the industrial application of galactooligosaccharides.

CN122128202APending Publication Date: 2026-06-02JIANGNAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
JIANGNAN UNIV
Filing Date
2026-04-02
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

In existing technologies, β-galactosidase has low expression efficiency and insufficient thermal stability in Bacillus subtilis, and Escherichia coli has endotoxin issues, which limit the efficiency and cost of industrial production of galactooligosaccharides.

Method used

Using Bacillus subtilis WG600 as the host strain, and employing β-galactosidase derived from Enterobacter sp., a recombinant strain was constructed through synergistic optimization of the PphrE promoter, NCS sequence (glnA-30bp, MLD42), and 5'-UTR (UTR13, UTR7) to achieve efficient expression of β-galactosidase.

Benefits of technology

The fermentation enzyme activity of β-galactosidase was increased to over 500 U/mL, reaching a maximum of 584.2 U/mL, meeting the needs of industrial production, reducing production costs and simplifying the fermentation process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

This invention relates to a recombinant Bacillus subtilis strain producing high-activity β-galactosidase and its application. The recombinant Bacillus subtilis strain uses Bacillus subtilis WG600 as the host strain, derived from... Enterobacter Using sp. β-galactosidase as the target gene, through the promoter (P) phrE Synergistic optimization of the NCS sequence (glnA-30bp, MLD42) and 5'-UTR (UTR13, UTR4, UTR7) enabled the fermentation enzyme activity of Ensp-β-galactosidase in Bacillus subtilis to reach over 500 U / mL, with a maximum of 584.2 U / mL. Compared with existing technologies, the enzyme activity has been greatly improved, representing the highest level of enzyme activity for β-galactosidase production in Bacillus subtilis, which can meet the demand for high-activity enzymes in industrial production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of enzyme genetic engineering technology, specifically relating to a recombinant strain of Bacillus subtilis that produces high-activity β-galactosidase and its application. Background Technology

[0002] Galacto-oligosaccharides (GOS) are a class of lactose derivatives with great application potential. Belonging to the food-grade prebiotic category, they cannot be digested and absorbed by the human body, but can exert various beneficial effects in the gut, such as promoting the proliferation of beneficial intestinal bacteria, reducing the incidence of colonic infections, regulating colonic pH, promoting mineral absorption, and regulating blood lipid and cholesterol levels. Currently, they are widely used in various food industries.

[0003] β-galactosidase, as the core catalytic enzyme for the synthesis of GOS using lactose as a substrate, has enzymatic properties and expression levels that directly affect the production efficiency and cost of galactooligosaccharides.

[0004] Regarding heterologous expression, industrial β-galactosidase is currently mainly derived from Aspergillus niger (… Aspergillus black ), Bacillus circularis ( Circulating Bacillus Kluyveromycin (lactic acid yeast) Kluyveromyces lactis Microorganisms such as Escherichia coli, and usually Escherichia coli (E. coli) E. coli It is expressed in [the following text is incomplete and likely refers to a different process]. However, *E. coli* suffers from low yield, insufficient heat stability, and the production of endotoxins. In contrast, *Bacillus subtilis* ([the following text is incomplete and likely refers to a different process]) Bacillus subtilis As a generally recognized safe (GRAS) microbial host, Bacillus subtilis possesses advantages such as high protein secretion capacity, absence of endotoxins, and low culture costs, making it one of the ideal hosts for heterologous expression of industrial enzymes. Currently, reports on the expression of β-galactosidase in Bacillus subtilis are still relatively limited. The main studies are as follows: 1) from Bacillus megaterium (… Bacillus megaterium 1) The β-galactosidase of strain YZ08 is not inhibited by galactose or glucose. This enzyme can be secreted extracellularly in Bacillus subtilis, and after 72 hours of fermentation, the peak enzyme activity reaches 17.55 U / mL. 2) Derived from Bacillus aryepasis... Bacillus Aryabhatta β-galactosidase is secreted in Bacillus subtilis via a non-classical protein secretion pathway, with a maximum enzyme activity of 17.41 U / mL. 3) Three copies of β-galactosidase Bgal1-3 obtained from a marine metagenomic library can be expressed and secreted in Bacillus subtilis via both Tat-dependent (diarginine transport) and Tat-independent pathways, with a fermentation enzyme activity of 2.15 U / mL. 4) Kosakonia oryzendophyticaThe β-galactosidase derived from pP43NMK was obtained through co-optimization of the promoter and 5'-UTR of recombinant Bacillus subtilis. Its enzyme activity in the supernatant of fermentation broth reached 106.2 U / mL. Although it achieved high enzyme activity, it is still some distance away from industrial application.

[0005] Therefore, developing a more efficient food-grade Bacillus subtilis β-galactosidase expression system is of great significance for the industrial application of β-galactosidase. Summary of the Invention

[0006] The purpose of this invention is to overcome the deficiencies in the prior art and provide a recombinant strain of Bacillus subtilis that produces β-galactosidase with high enzyme activity and its application. This strain greatly improves the fermentation enzyme activity of β-galactosidase and lays the foundation for the industrial production of galactooligosaccharides.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows: A recombinant Bacillus subtilis strain producing high-activity β-galactosidase is characterized by using Bacillus subtilis as the host cell, pP43NMK as the expression vector, and employing P... phrE The promoter replaced the P promoter of the pP43NMK expression vector. 43 The gene was obtained by modifying β-galactosidase using any one of the following AC modifications: A: Replace the 5'-UTR sequence of the pP43NMK expression vector with a 5'-UTR sequence (UTR4) as shown in SEQ ID No:37 or having at least 95% identity with SEQ ID No:37; and insert an NCS sequence glnA-30bp as shown in SEQ ID No:5 or having at least 95% identity with SEQ ID No:5 before the β-galactosidase gene sequence; B: Replace the 5'-UTR sequence of the pP43NMK expression vector with a 5'-UTR sequence (UTR7) as shown in SEQ ID No:39 or having at least 95% identity with SEQ ID No:39; and insert the NCS sequence MLD42 as shown in SEQ ID No:32 or having at least 95% identity with SEQ ID No:32 before the β-galactosidase gene sequence; C: Replace the 5'-UTR sequence of the pP43NMK expression vector with a 5'-UTR sequence (UTR13) as shown in SEQ ID No:4 or having at least 95% identity with SEQ ID No:4; and insert an NCS sequence glnA-30bp as shown in SEQ ID No:5 or having at least 95% identity with SEQ ID No:5 before the β-galactosidase gene sequence.

[0008] As a further technical solution, the β-galactosidase is derived from... Enterobacter sp.

[0009] As a further technical solution, the nucleotide sequence of the β-galactosidase is as shown in SEQ ID No:1 or has at least 90% identity with SEQ ID No:1.

[0010] As a further technical solution, the P phrE The nucleotide sequence of the promoter is as shown in SEQ ID No:3 or has at least 95% identity with SEQ ID No:3.

[0011] As a further technical solution, the Bacillus subtilis is used. B. subtilis WG600.

[0012] A method for efficiently producing β-galactosidase using the recombinant strain of Bacillus subtilis.

[0013] As a further technical solution, the recombinant strain of Bacillus subtilis is inoculated into a fermentation medium to ferment and produce β-galactosidase. The fermentation medium comprises: 12 g / L peptone, 24 g / L yeast extract, 12.54 g / L K2HPO4, 2.54 g / L KH2PO4, and 50 μg / mL kanamycin; the fermentation conditions are: fermentation at 33℃ and 200 rpm for 48-60 h.

[0014] As a further technical solution, the recombinant Bacillus subtilis strain is first grafted onto a seed culture medium for activation culture before being inoculated into the fermentation medium; the seed culture medium includes: 5 g / L yeast extract, 10 g / L peptone, 10 g / L NaCl, and 50 μg / mL kanamycin; the activation culture is carried out at 37℃ and 200 rpm for 12-14 hours.

[0015] Application of the β-galactosidase produced by the method or the fermentation broth containing β-galactosidase in the production of galactooligosaccharides.

[0016] A method for preparing galactooligosaccharides, using lactose as a substrate, and employing β-galactosidase produced by the method described in any one of claims 6-7 or fermentation broth containing β-galactosidase for enzymatic hydrolysis to produce galactooligosaccharides. As a further technical solution, the final concentration of lactose in the enzymatic hydrolysis system is 300 g / L; the enzymatic hydrolysis conditions are: 40℃, pH 7.5, 1mM Mg 2+ The reaction was carried out in 100 mM HEPES buffer with a final β-galactosidase concentration of 120 U / mL for 10 h.

[0017] Compared with the prior art, the beneficial effects of the present invention are as follows: 1. This invention selects Bacillus subtilis WG600 as the host strain, derived from... Enterobacter Using sp. β-galactosidase as the target gene, through the promoter (P) phrE Synergistic optimization of the NCS sequence (glnA-30bp, MLD42) and 5'-UTR (UTR13, UTR4, UTR7) enabled the fermentation enzyme activity of Ensp-β-galactosidase in Bacillus subtilis to reach over 500 U / mL, with a maximum of 584.2 U / mL. Compared with existing technologies, the enzyme activity has been greatly improved, representing the highest level of enzyme activity for β-galactosidase production in Bacillus subtilis, which can meet the demand for high-activity enzymes in industrial production.

[0018] 2. This invention selects Bacillus subtilis WG600 as the host strain. This strain is free of endotoxins, has a high protein secretion capacity, and has simple culture conditions and low cost. The optimized expression system does not require an inducer (such as IPTG) and achieves continuous synthesis of the target protein through constitutive expression, simplifying the fermentation process and reducing production costs. Attached Figure Description

[0019] Figure 1 This is a comparison diagram of enzyme activities of recombinant engineered strains constructed with different promoters in Example 3; Figure 2 This is a comparison diagram of enzyme activities of recombinant engineered strains constructed with different NCS sequences in Example 4; Figure 3 A comparison of enzyme activities of recombinant engineered strains constructed with different 5'-UTR sequences in Example 5; Figure 4 This is a comparison diagram of enzyme activities of recombinant engineered strains constructed with different promoters, NCS, and different 5'-UTR sequence combinations in Example 6. Figure 5 The recombinant engineered strain BS-Ensp-β-gal-P in Example 7 phrEGOS yield at different times and temperatures during the fermentation broth of -glnA-30bp-UTR13 for GOS production. Detailed Implementation

[0020] The technical solution of the present invention will be clearly and completely described below with reference to specific embodiments. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0021] Additionally, it should be noted that the terms “comprising,” “including,” or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0022] In this invention, Unless otherwise specified, all raw materials used in this invention are commercially available.

[0023] Example 1: Ensp-β-gal-P phrE Preparation of the glnA-30bp-UTR13 recombinant expression vector 1. Obtaining the recombinant plasmid pP43NMK-Ensp-β-gal: Containing the original signal peptide and derived from Enterobacter The β-galactosidase of *Sp. sp.* (accession number: WP_069303746.1, nucleotide sequence as shown in SEQ ID NO.1, amino acid sequence as shown in SEQ ID NO.2) was constructed into the vector BS-pP43NMK to obtain the recombinant plasmid pP43NMK-Ensp-β-gal, specifically: According to the source Enterobacter The gene fragment of β-galactosidase from *Sp. sp.* was obtained, and the corresponding plasmid pET28a-Ensp-β-gal was commercially synthesized. Using this plasmid as a template, PCR was performed to obtain the desired target gene fragment. Using the pP43NMK plasmid as a template, PCR was performed to obtain the corresponding vector fragment for ligating the target gene. The target gene and vector were ligated using a ligation system to obtain the recombinant plasmid pP43NMK-Ensp-β-gal.

[0024] The primers used for PCR are as follows: Forward primer P1 for constructing the target gene fragment: 5'-GAATGTACACATGTCCACGACGAGCCCGCTGACAC-3'; Reverse primer P2 for constructing the target gene fragment: 5'-CTTTCATCAAGGATTTTGTTGCCAAGAGAATGTATAACGCAGTTGTCTCG-3'; Forward primer P3 for constructing the vector fragment: 5'-CAACAAAATCCTTGATGAAAGCTTGGCGTAATCATGGTCATAGCTG-3'; P4, the reverse primer for constructing the vector fragment: 5'-GTCGTGGACATGTGTACATTCCTCTCTTACCTATAATGGTACCGCTATCAC-3'; The composition of the PCR reaction system is shown in Table 1; Table 1

[0025] The amplification conditions for the target gene fragment were as follows: pre-denaturation at 95℃ for 3 min; followed by denaturation at 94℃ for 30 s, annealing at 56-58℃ for 30 s, extension at 72℃ for 2 min, for 33 cycles; and finally extension at 72℃ for 5 min, followed by incubation at 4℃.

[0026] The vector fragment amplification conditions were as follows: pre-denaturation at 95℃ for 3 min; followed by denaturation at 94℃ for 30 s, annealing at 56-58℃ for 30 s, extension at 72℃ for 5 min, for 30 cycles; and finally extension at 72℃ for 5 min, followed by holding at 4℃.

[0027] PCR amplification products need to be detected by agarose gel electrophoresis and purified by gel extraction. After purification by agarose gel extraction, the PCR amplification products are then processed with the restriction enzyme QuickCut. TM Dpn I removes the template. Only relatively pure fragments can be used for ligation to construct recombinant plasmids.

[0028] The composition of the target gene-vector ligation reaction system is shown in Table 2; Table 2

[0029] The constructed pP43NMK-Ensp-β-gal plasmid was transformed into E. coli. E. coli In DH5α competent cells, in a solution containing 100 µ After culturing overnight in LB solid medium at a concentration of 100 g / mL ampicillin sodium, single colonies were picked at 100 μL. µThe cells were cultured in LB liquid medium at a concentration of g / mL ampicillin sodium, and then the recombinant plasmid pP43NMK-Ensp-β-gal was extracted and sequenced to screen for the correct recombinant plasmid pP43NMK-Ensp-β-gal.

[0030] 2. Recombinant plasmid pP43NMK-Ensp-β-gal-P phrE Obtaining: Containing Bacillus subtilis B. subtilis Genome-derived promoter P phrE (Encoding promoter P) phrE The nucleotide sequence shown in SEQ ID No:3 replaces the promoter P in pP43NMK. 43 (Encoding promoter P) 43 The nucleotide sequence is shown in SEQ ID No:6), and the recombinant plasmid pP43NMK-Ensp-β-gal-P was obtained. phrE Specifically: Bacillus subtilis B. subtilis PCR was performed using the whole genome as a template to obtain the promoter P. phrE The target gene fragment was obtained by PCR using the BS-pP43NMK-Ensp-β-gal plasmid as a template. The target gene and the vector were ligated using a ligation system to obtain the recombinant plasmid pP43NMK-Ensp-β-gal-P. phrE .

[0031] The primers used for PCR are as follows: Constructing the target gene fragment (P) phrE Forward primer P5: 5'-TTTTTTGAGCAACTGGATCCCGTTGATTTATTTTAAACAAGGCAAAAAAGAACAAGCAATG-3'; Constructing the target gene fragment (P) phrE The reverse primer P6: 5'-ATGTGTACATTCCTCTCTTACGCTTTTGAGCATATACCATCTTCTTGAAACAGATGATAC-3', Forward primer P7 for constructing the vector fragment: 5'-GTAAGAGAGGAATGTACACATGTCCACGACGAGCCCGCTGAC-3'; P8, the reverse primer for constructing the vector fragment: 5'-GGATCCAGTTGCTCAAAAAAATCTCGGTCAGATGTTAC-3', The composition of the PCR reaction system is shown in Table 1; promoter P phrE The amplification conditions for the target gene fragment were as follows: pre-denaturation at 95℃ for 3 min; followed by denaturation at 94℃ for 30 s, annealing at 58℃ for 30 s, extension at 72℃ for 30 s, for 33 cycles; and finally extension at 72℃ for 5 min, followed by incubation at 4℃.

[0032] The vector fragment amplification conditions were as follows: pre-denaturation at 95℃ for 3 min; followed by denaturation at 94℃ for 30 s, annealing at 58℃ for 30 s, extension at 72℃ for 5 min, for 30 cycles; and finally extension at 72℃ for 5 min, followed by holding at 4℃.

[0033] PCR amplification products need to be detected by agarose gel electrophoresis and purified by gel extraction. After purification by agarose gel extraction, the PCR amplification products are then processed with the restriction enzyme QuickCut. TM Dpn I removes the template. Only relatively pure fragments can be used for ligation to construct recombinant plasmids.

[0034] Target gene fragment (promoter P) phrE The composition of the reaction system connected with the carrier is shown in Table 2; The constructed pP43NMK-Ensp-β-gal-P phrE plasmid transformation into E. coli E. coli In DH5α competent cells, in a solution containing 100 µ After culturing overnight in LB solid medium at a concentration of 100 g / mL ampicillin sodium, single colonies were picked at 100 μL. µ The culture was carried out in LB liquid medium at a concentration of g / mL ampicillin sodium, and then the recombinant plasmid pP43NMK-Ensp-β-gal-P was extracted. phrE Sequencing was performed to screen for the correct recombinant plasmid pP43NMK-Ensp-β-gal-P. phrE .

[0035] 3. Recombinant plasmid pP43NMK-Ensp-β-gal-P phrE - Obtaining glnA-30bp: The NCS sequence glnA-30bp, as shown in SEQ ID No:5, was inserted into the recombinant plasmid pP43NMK-Ensp-β-gal-P. phrE Before obtaining the Ensp-β-gal sequence of the vector, the recombinant plasmid pP43NMK-Ensp-β-gal-P was obtained. phrE - glnA-30bp, specifically: Using recombinant plasmid pP43NMK-Ensp-β-gal-P phrE Using pP43NMK-Ensp-β-gal-P as a template, PCR was performed on the recombinant plasmid pP43NMK-Ensp-β-gal-P phrE The Ensp-β-gal gene in the sample was encoded by the NCS sequence glnA-30bp of SEQ ID No:5, resulting in the recombinant plasmid pP43NMK-Ensp-β-gal-P. phrE - glnA-30bp.

[0036] The primers used for PCR are as follows: Reconstruct the recombinant plasmid pP43NMK-Ensp-β-gal-P phrE - Forward primer P9 for glnA-30bp: 5'-GTACACTAGAGAAGATATCGAAATGTCCACGACGAGCCCGCTG-3'; Reconstruct the recombinant plasmid pP43NMK-Ensp-β-gal-P phrE - The reverse primer P10 for glnA-30bp: 5'-GATATCTCTCTAGTGTACTTTGCCATGTGTACATTCCTCTCTTACGCTTTTGAGCATATACC-3'; The composition of the PCR reaction system is shown in Table 1; The amplification conditions were as follows: pre-denaturation at 95℃ for 3 min; followed by denaturation at 94℃ for 30 s, annealing at 55-58℃ for 30 s, extension at 72℃ for 5 min, for 30 cycles; and finally extension at 72℃ for 5 min, followed by holding at 4℃.

[0037] PCR amplification products need to be detected by agarose gel electrophoresis and purified by gel extraction. After purification by agarose gel extraction, the PCR amplification products are then processed with the restriction enzyme QuickCut. TM Dpn I removes the template. Only relatively pure fragments can be used for ligation to construct recombinant plasmids.

[0038] The recombinant plasmid pP43NMK-Ensp-β-gal-P was constructed. phrE - glnA-30bp transformed into Escherichia coli E. to be cultivated In DH5α competent cells, in a solution containing 100 µ After culturing overnight in LB solid medium at a concentration of 100 g / mL ampicillin sodium, single colonies were picked at 100 μL. µThe culture was carried out in LB liquid medium at a concentration of g / mL ampicillin sodium, and then the recombinant plasmid pP43NMK-Ensp-β-gal-P was extracted. phrE - glnA-30bp was sequenced, and the correct recombinant plasmid pP43NMK-Ensp-β-gal-P was selected. phrE - glnA-30bp.

[0039] 3. Recombinant plasmid pP43NMK-Ensp-β-gal-P phrE - Obtaining glnA-30bp-UTR13: The original 5'-UTR sequence of the pP43NMK plasmid was replaced with the 5'-UTR sequence UTR13 as shown in SEQ ID No:4 to obtain the recombinant plasmid pP43NMK-Ensp-β-gal-P phrE - glnA-30bp-UTR13, specifically: Using recombinant plasmid pP43NMK-Ensp-β-gal-P phrE - Using glnA-30bp as a template, PCR was performed, and the recombinant plasmid pP43NMK-Ensp-β-gal-P was added. phrE - The original 5'-UTR sequence in glnA-30bp is replaced with the 5'-UTR sequence UTR13, as shown in SEQ ID No:4.

[0040] The primers used for PCR are as follows: Reconstruct the recombinant plasmid pP43NMK-Ensp-β-gal-P phrE - Forward primer P11 for glnA-30bp-UTR13: 5'-GTGATTAGAAAGGAGGAATGTACAATGGCAAAGTACACTAGAGAAGATATCGAAATGTCC-3'; Reconstruct the recombinant plasmid pP43NMK-Ensp-β-gal-P phrE - The reverse primer P12 for glnA-30bp: 5'-TTCCTCCTTTTCTAATCACGCTTTTGAGCATATACCATCTTCTTGAAACAGATGATACTATCC-3'; The composition of the PCR reaction system is shown in Table 1; The amplification conditions were as follows: pre-denaturation at 95℃ for 3 min; followed by denaturation at 94℃ for 30 s, annealing at 56-58℃ for 30 s, extension at 72℃ for 5 min, for 30 cycles; and finally extension at 72℃ for 5 min, followed by holding at 4℃.

[0041] PCR amplification products need to be detected by agarose gel electrophoresis and purified by gel extraction. After purification by agarose gel extraction, the PCR amplification products are then processed with the restriction enzyme QuickCut. TM Dpn I removes the template. Only relatively pure fragments can be used for ligation to construct recombinant plasmids.

[0042] The recombinant plasmid pP43NMK-Ensp-β-gal-P was constructed. phrE - glnA-30bp-UTR13 transformed into Escherichia coli E. coli In DH5α competent cells, in a solution containing 100 µ After culturing overnight in LB solid medium at a concentration of 100 g / mL ampicillin sodium, single colonies were picked at 100 μL. µ The culture was carried out in LB liquid medium at a concentration of g / mL ampicillin sodium, and then the recombinant plasmid pP43NMK-Ensp-β-gal-P was extracted. phrE - glnA-30bp-UTR13 was sequenced, and the correct recombinant plasmid pP43NMK-Ensp-β-gal-P was selected. phrE - glnA-30bp-UTR13.

[0043] Example 2: Recombinant engineered strain of Bacillus subtilis BS-pP43NMK-Ensp-β-gal-P phrE - Construction of glnA-30bp-UTR13 The recombinant plasmid pP43NMK-Ensp-β-gal-P from Example 1 was used. phrE - glnA-30bp-UTR13 transformed into Bacillus subtilis B. subtilis Recombinant engineered strain BS-pP43NMK-Ensp-β-gal-P was obtained from WB600 competent cells. phrE - glnA-30bp-UTR13.

[0044] The conversion method used is as follows: Add 100-200 ng of plasmid to Bacillus subtilis B. subtilis WG600 competent cells were incubated at 37°C and 200 rpm for 2 h, and then spread to a concentration of 50 mg / L.µ Cultured on LB solid medium plates containing g / mL kanamycin resistance.

[0045] Among them, Bacillus subtilis B. subtilis The preparation process of WG600 competent cells is as follows: Bacillus subtilis B. subtilis After streaking WG600 onto LB agar plates overnight, pick approximately a single colony and transfer it to 1 ml of LB medium (or a 50 ml centrifuge tube). Incubate at 37°C and 220 rpm for approximately 8 hours (OD). 600 After reaching approximately 7.5-8.0, add 4 ml of LB medium and 300 μL of 50% xylose. Incubate for 2 hours to obtain the desired product. B. subtilis WG600 competent cells. When stored frozen at -80°C, each 4ml B. subtilis Add 1 ml of 50% glycerol to WG600 competent cells.

[0046] Example 3: Promoter Screening This embodiment performs P amyE P hemA P Hpall P mmgA P odhA P phrE P sdhB P secA P spoVG P srfAA P veg P yceC P yqfD P yvyD The screening of 14 promoters, whose nucleotide sequences are shown in SEQ ID No:7-19 and SEQ ID No:3, respectively.

[0047] 1. Construction of recombinant expression vectors According to the recombinant plasmid pP43NMK-Ensp-β-gal-P in Example 1 phrE The construction method of P respectively amyE P hemA P Hpall P mmgA P odhA P phrE P sdhB P secA P spoVG P srfAA P veg P yceC P yqfD P yvyD (They all come from) B. subtleThe genome was replaced by overlap extension PCR, which replaced the promoter P in the recombinant plasmid pP43NMK-Ensp-β-gal. 43 Fourteen recombinant plasmids containing different promoters, pP43NMK-Ensp-β-gal-P, were constructed. amyE pP43NMK-Ensp-β-gal-P hemA pP43NMK-Ensp-β-gal-P Hpall pP43NMK-Ensp-β-gal-P mmgA pP43NMK-Ensp-β-gal-P odhA pP43NMK-Ensp-β-gal-P phrE pP43NMK-Ensp-β-gal-P sdhB pP43NMK-Ensp-β-gal-P secA 、 pP43NMK-Ensp-β-gal-P spoVG pP43NMK-Ensp-β-gal-P srfAA pP43NMK-Ensp-β-gal-P veg pP43NMK-Ensp-β-gal-P yceC pP43NMK-Ensp-β-gal-P yqfD pP43NMK-Ensp-β-gal-P yvyD .

[0048] in , pP43NMK-Ensp-β-gal-P amyE plasmid promoter P amyE Forward primer P13 for fragment construction: 5'-TGACCGAGATTTTTTTGAGCAACTGGATCCTGATTGTGAAGCTGGCTTACAGAAGAGCG-3'; Reverse primer P14: 5'-TGTGTACATTCCTTCTTACTCTTGACACTCCTTATTTGATTTTTTGAAGACTTACTTCGGAG-3'; pP43NMK-Ensp-β-gal-P hemA plasmid promoter P hemA Forward primer P15 for fragment construction: 5'-ATTTTTTTGAGCAACTGGATCCATGAGGAGAACAGGCCATTGATCCTGC-3'; Reverse primer P16: 5'-GTGTACATTCCTCTCTTACACATAGAACTCATTATTTATAATAATTATAACATAGTTTCTTTCACAAAATGTGAACAGATTTTAAAATTC-3'; pP43NMK-Ensp-β-gal-P Hpall plasmid promoter P Hpall Forward primer P17 for fragment construction: 5'-ATTTTTTTGAGCAACTGGATCCGATCTTCTCAAAAAATACTACCTGTCCCTTGCTG -3'; Reverse primer P18: 5'-ATGTGTACATTCCTCTCTTACTTAGGTGGCACAAATGTGAGGCATTTTC -3'; pP43NMK-Ensp-β-gal-P mmgA plasmid promoter P mmgA Forward primer P19 for fragment construction: 5'-TTTTTTGAGCAACTGGATCCTCGATATATCGCGTCTATTCCGGCTTCCG -3'; Reverse primer P20: 5'-ATGTGTACATTCCTCTCTTACGTCTTCTATGAATGTATGCTTTGAAACGGGCATG -3'; pP43NMK-Ensp-β-gal-P odhA plasmid promoter P odhA Forward primer P21 for fragment construction: 5'-TTTTTTGAGCAACTGGATCCGAATAGAAGTGATAAATGTTTTTCTCTCCAACTCAGAAATAGAAGAATCG -3'; Reverse primer P22: 5'-ATGTGTACATTCCTCTCTTACCAACGATATTTTACCACTGTTTGCAATTTGATTCTACCTTG -3'; pP43NMK-Ensp-β-gal-P phrE plasmid promoter P phrE For the forward primers used in fragment construction, see primer page 5: The reverse primer is shown on primer page 6: pP43NMK-Ensp-β-gal-P sdhB plasmid promoter P sdhB Forward primer P23 for fragment construction: 5'-TTTTTTTGAGCAACTGGATCCAATTTCTTTTTAGGTTGTCAATAGATGCTTCAAATTTAGACTTCATATCTG-3'; Reverse primer P24: 5'-ATGTGTACATTCCTCTCTTACAATCTCTTCCCCCACTTCTTTCAATTGTAAGCAC-3'; pP43NMK-Ensp-β-gal-P secA plasmid promoter P secA Reverse primer P25 for fragment construction: 5'-TTTTTTGAGCAACTGGATCCGAGGAGAGCTTGGACATCGTCCGTC-3'; Reverse primer P26: 5'-ATGTGTACATTCCTCTCTTACCTAGTCCATGTATACCTCTCATTATCATATCATACCTTTTGTTATTTCC-3'; pP43NMK-Ensp-β-gal-P spoVG plasmid promoter P spoVG Forward primer P27 for fragment construction: 5'-TTTTTTGAGCAACTGGATCCTGCGGAAGTAAACGAAGTGTACGGAC -3'; Reverse primer P28: 5'-ATGTGTACATTCCTCTCTTACCTATATAAAAGCATTAGTGTATCAATTCCACGATTTTTTCTGAAATCCTG -3'; pP43NMK-Ensp-β-gal-P srfAA plasmid promoter P srfAA Forward primer P29 for fragment construction: 5'-TTTTTTGAGCAACTGGATCCGACGCTCTCGCAAGGGTGTCTTTTTTTG -3'; pP43NMK-Ensp-β-gal-P srfAA plasmid promoter P srfAA Reverse primer P30 constructed from the fragment: 5'-ATGTGTACATTCCTCTTACATATTTTTTATCTTTCTACCGTTCAGTTTAAATGAAAAAAATGTTTTTATC -3'; pP43NMK-Ensp-β-gal-P veg plasmid promoter P veg Forward primer P31 for fragment construction: 5'-TTTTTTGAGCAACTGGATCCATTTTGTCAAAATAATTTTATTGACAACGTCTTATTAACGTTG-3'; Reverse primer P32: 5'-GTGTACATTCCTCTCTTACTGCATCCACCTCACTACATTTATTGTACAACACGAGC-3'; pP43NMK-Ensp-β-gal-P yceC plasmid promoter P yceC Forward primer P33 for fragment construction: 5'-TTTTTTGAGCAACTGGATCCTTCTCCTTTAGAAACAGGTGCCTGATCAAGTATG -3'; Reverse primer P34: 5'-ATGTGTACATTCCTCTCTTACATAGTCACATTTATTTTTACGCTCACAAGGAAAATAAGCC -3'; pP43NMK-Ensp-β-gal-P yqfD plasmid promoter P yqfD Forward primer P35 for fragment construction: 5'-TTTTTTGAGCAACTGGATCCTTCTCCTTTAGAAACAGGTGCCTGATCAAGTATG -3'; Reverse primer P36: 5'-ATGTGTACATTCCTCTCTTACTTTCATCTCATATGTATGATTTGAAAGGAGGTTCTAACACTTTAATTTTTACGGGCCG -3'; pP43NMK-Ensp-β-gal-P yvyD plasmid promoter P yvyD Forward primer P37 for fragment construction: 5'-TTTTTTGAGCAACTGGATCCGATCAATTGGTCTCTTTCTCTTTTCCCTCTCATGAG-3'; Reverse primer P38: 5'-ATGTGTACATTCCTCTCTTACATTAAGGATATGTATCTATTTCTCTTTTACCCTTTACAATTCCTGCTG-3'; The vector primers required to construct the above plasmids are the same, see forward primer P7 and reverse primer P8; 2. Construction of recombinant strains by transformation of Bacillus subtilis Fourteen recombinant plasmids containing different promoters, constructed according to the method described in Example 2, were transformed into Bacillus subtilis. B. subtilis Fourteen recombinant engineered strains, BS-pP43NMK-Ensp-β-gal-P, were obtained from WG600 competent cells. amyE BS-pP43NMK-Ensp-β-gal-P hemA BS-pP43NMK-Ensp-β-gal-P Hpall BS-pP43NMK-Ensp-β-gal-P mmgA BS-pP43NMK-Ensp-β-gal-P odhA BS-pP43NMK-Ensp-β-gal-P phrE BS-pP43NMK-Ensp-β-gal-P sdhB BS-pP43NMK-Ensp-β-gal-P secA 、 BS-pP43NMK-Ensp-β-gal-P spoVG BS-pP43NMK-Ensp-β-gal-P srfAA BS-pP43NMK-Ensp-β-gal-P veg BS-pP43NMK-Ensp-β-gal-P yceC BS-pP43NMK-Ensp-β-gal-P yqfD BS-pP43NMK-Ensp-β-gal-P yvyD .

[0049] 3. Fermentation and enzyme activity assay The 14 recombinant engineered strains were fermented and cultured according to the following methods. The fermentation broth was diluted, and then their enzyme activities were measured. The results are shown in the figure. Figure 1 ; 1) Activation and scale-up culture of microorganisms A single colony of the recombinant engineered strain constructed in Example 3 was inoculated into a seed culture medium for activation and culture to obtain a seed liquid; then the seed liquid was inoculated into a fermentation culture medium at an inoculation rate of 1%, and fermented to produce β-galactosidase, thus obtaining a fermentation broth containing β-galactosidase. The fermentation broth containing β-galactosidase was centrifuged to obtain the fermentation supernatant (i.e., the fermentation supernatant containing β-galactosidase). The centrifugation conditions were: centrifugation at 8000 rpm for 10 min at 4℃. The seed culture medium used is LB liquid medium containing 50 µg / mL kanamycin. The volume is 4 mL / tube. LB liquid medium consists of: 5 g / L yeast extract, 10 g / L peptone, and 10 g / L NaCl; The activation culture conditions are: 37℃, 200 r / min for 12-14 h; The fermentation medium used was TB liquid medium containing 50 µg / mL kanamycin, with a volume of 100 mL / 500 mL Erlenmeyer flask. TB liquid culture medium includes: 12 g / L peptone, 24 g / L yeast extract, ; The fermentation conditions were: constant temperature shaking culture at 33℃ and 200 r / min for 48-60 h.

[0050] 2) Method for determining the enzyme activity of β-galactosidase The hydrolytic activity unit (U) of β-galactosidase is defined as the amount of enzyme required to hydrolyze 1 μmol of o-nitrophenyl-β-D-galactopyranoside (ONPG) per minute under specific assay conditions.

[0051] Add 900 μl of 15 mM ONPG (pH 7.5, 100 mM HEPES buffer) to a 2 ml Eppendorf tube and preheat in a 50°C water bath for 5 min. Add 100 μl of diluted fermentation supernatant to the above system and react in a 50°C water bath for 5 min. Add 1 mL of 1 M sodium carbonate solution to terminate the enzymatic reaction and completely inactivate the enzyme. Measure the absorbance at 420 nm using a Tecan Infinite200pro microplate reader, calculate the concentration of released o-nitrophenol (ONP) based on the absorbance value, and calculate the enzyme activity. Enzyme activity (U / mL) = (m×N×V1) / (T×V2); Wherein, m represents the reducing sugar content (μmol / mL) produced by the enzymatic reaction of the crude enzyme solution, calculated based on the ONPG standard curve and OD...420 calculate; N – Fermentation broth dilution factor (undiluted broth is 1); V1——Total volume of the reaction system (mL); T—Enzyme-catalyzed reaction time; V2 — Volume of enzyme solution (fermentation broth) (mL); 3) Results from Figure 1 It can be known that the recombinant engineered strain BS-pP43NMK-Ensp-β-gal-P phrE The enzyme activity was the highest, reaching 52.8 U / mL, which was about 4.13 times higher than that of the control group (BS-pP43NMK-Ensp-β-gal).

[0052] Example 4: Optimization of NCS Sequences This embodiment optimizes 17 NCS sequences: glnA, glnA-30bp, glnA-Up, Hag, Hag-30bp, Hag-Up, yvyD, yvyD-30bp, yvyD-Up, rsbV, rsbV-30bp, rsbV-Up, MLD40, MLD42, MLD47, MLD62, and MLD62-30. The nucleotide sequences encoding these 17 NCS sequences are shown in SEQ ID No:20-35 and SEQ ID No:5.

[0053] 1. Construction of recombinant expression vectors Taking the recombinant plasmid pP43NMK-Ensp-β-gal-glnA as an example, this paper introduces the methods for obtaining recombinant plasmids containing different NCS sequences, specifically: Using the recombinant plasmid pP43NMK-Ensp-β-gal as a template, the NCS sequence glnA (SEQ ID. NO20) was inserted before the Ensp-β-gal gene encoding the recombinant plasmid pP43NMK-Ensp-β-gal by PCR, thus obtaining the recombinant plasmid pP43NMK-Ensp-β-gal-glnA.

[0054] The primers used for PCR are as follows: Forward primer P39 for reconstructing the plasmid pP43NMK-Ensp-β-gal-glnA: 5'-GAAGATATCGAAAAATTAGTAAAAGAAATGTCCACGACGAGCCCGCTG-3'; The reverse primer P40 for reconstructing the plasmid pP43NMK-Ensp-β-gal-glnA: 5'-ACTAATTTTTCGATATCTTTCTCTAGTGTACTTTGCCATGTGTACATTCCTCTCTTACCTATAATGGTACC-3'; The composition of the PCR reaction system is shown in Table 1; The amplification conditions were as follows: pre-denaturation at 95℃ for 3 min; followed by denaturation at 94℃ for 30 s, annealing at 56-58℃ for 30 s, extension at 72℃ for 5 min, for 30 cycles; and finally extension at 72℃ for 5 min, followed by holding at 4℃.

[0055] PCR amplification products need to be detected by agarose gel electrophoresis and purified by gel extraction. After purification by agarose gel extraction, the PCR amplification products are then processed with the restriction enzyme QuickCut. TM Dpn I removes the template. Only the relatively clean fragments obtained can be used for conversion.

[0056] The constructed pP43NMK-Ensp-β-gal-P yvyD - glnA plasmid transformed into E. coli E. coli In DH5α competent cells, in a solution containing 100 µ After culturing overnight in LB solid medium at a concentration of 100 g / mL ampicillin sodium, single colonies were picked at 100 μL. µ The cells were cultured in LB liquid medium at a concentration of g / mL ampicillin sodium, and then the recombinant plasmid pP43NMK-Ensp-β-gal-glnA was extracted and sequenced to screen for the correct recombinant plasmid pP43NMK-Ensp-β-gal-glnA.

[0057] Following the above method, other NCS sequences glnA-30bp, glnA-Up, Hag, Hag-30bp, Hag-Up, yvyD, yvyD-30bp, yvyD-Up, rsbV, rsbV-30bp, rsbV-Up, MLD40, MLD42, MLD47, MLD62, and MLD62-30bp were inserted into the Ensp-β-gal sequence of the recombinant plasmid pP43NMK-Ensp-β-gal via overlap extension PCR, respectively, to construct recombinant plasmids pP43NMK-Ensp-β-gal-glnA-30bp, pP43NMK-Ensp-β-gal-glnA-Up, pP43NMK-Ensp-β-gal-Hag, pP43NMK-Ensp-β-gal-Hag-30bp, and pP43NMK-Ensp-β-gal-Hag-30bp containing different NCS sequences. 43NMK-Ensp-β-gal-Hag-Up, pP43NMK-Ensp-β-gal-yvyD, pP43NMK-Ensp-β-gal-yvyD-30bp, p P43NMK-Ensp-β-gal-yvyD-Up, pP43NMK-Ensp-β-gal-rsbV, pP43NMK-Ensp-β-gal-rsbV-30bp, pP43NMK-Ensp-β-gal-rsbV-Up, pP43NMK-Ensp-β-gal-MLD40, pP43NMK-Ensp-β-gal-MLD42, p P43NMK-Ensp-β-gal-MLD47, pP43NMK-Ensp-β-gal-MLD62, pP43NMK-Ensp-β-gal-MLD62-30bp; Among them, the forward primer P41 for constructing pP43NMK-Ensp-β-gal-glnA-30bp was: 5'-GTACACTAGAGAAGATATCGAAATGTCCACGACGAGCCCGCTG-3'; Reverse primer P42: 5'CGATATCTTTCTCTAGTGTACTTTGCCATGTGTACATTCCTCTCTTACCTATAATGGTACC-3'; Construct the forward primer P43 for pP43NMK-Ensp-β-gal-glnA-Up: 5'-AACATCGAAAAAAAAAGTAAAAGAAATGTCCACGACGAGCCCGCTG-3'; Reverse primer P44: 5'-TTTACTTTTTTTTCGATGTTTTCTTCAGTGTACTTTTTCATGTGTACATTCCTCTCTTACCTATAATGGTACC-3'; Construct the forward primer P45 for pP43NMK-Ensp-β-gal-Hag: 5'-CAATATTGCAGCGCTTAACACACTGAACCGTATGTCCACGACGAGCCCGCTG-3'; Reverse primer P46: 5'-GTGTTAAGCGCTGCAATATTGTGGTTAATTCTCATGTGTACATTCCTCTCTTACCTATAATGGTACC-3'; Construct the forward primer P47 for pP43NMK-Ensp-β-gal-Hag-30bp: 5'-CAATATTGCAGCGCTTATGTCCACGACGAGCCCGCTG-3'; Reverse primer P48: 5'-GACATAAGCGCTGCAATATTGTGGTTAATTCTCATGTGTACATTCCTCTCTTACCTATAATGGTACC-3'; Construct the forward primer P49 for pP43NMK-Ensp-β-gal-Hag-Up: 5'-CAATATTGAAGAACAAAACACAAACAACCGTAGTCCACGACGAGCCCGCTG-3'; Reverse primer P50: 5'-AGTGTTTTGTTCTTCAATATTGTTTTTAATTTTCATGTGTACATTCCTCTCTTACCTATAATGGTACCG-3'; Construct the forward primer P51 for pP43NMK-Ensp-β-gal-yvyD: 5'-ACAAACGAACAATTTAATGAACTGATTCAAATGTCCACGACGAGCCCGCTG-3'; Reverse primer P52: 5'-TCATTAAATTGTTCGTTTGTTGTGATTTTTTTCATGTGTACATTCCTCTCTTACCTATAATGGTACC-3'; Construct the forward primer P53 for pP43NMK-Ensp-β-gal-yvyD-30bp: 5'-CAGAGGAGAAAATATTATGTCCACGACGAGCCCGCTG-3'; Reverse primer P54: 5'-CATAATATTTTCTCCTCTGATGTTATAGTTCATGTGTACATTCCTCTCTTACCTATAATGGTACC-3'; Construct the forward primer P55 for pP43NMK-Ensp-β-gal-yvyD-Up: 5'-GAAAATATTGAAGTGACACCCAACATGTCCACGACGAGCCCGCTG-3'; Reverse primer P56: 5'-GGTGTCACTTCAATATTTTCGTTGTTGATGTTGTTGTTCATGTGTACATTCCTCTCTTACCTATAATGGTACC-3'; Construct the forward primer P57 for pP43NMK-Ensp-β-gal-rsbV: 5'-GAAGCAAAACGAGAATGATATACAAATGTCCACGACGAGCCCGCTG-3'; Reverse primer P58: 5'-TATCATTCTCGTTTTGCTTCACATCAACATTTATATTCATGTGTACATTCCTCTCTTACCTATAATGGTACC-3'; Construct the forward primer P59 for pP43NMK-Ensp-β-gal-rsbV-30bp: 5'-TAAATGTTGATGTGAAGCAAAACATGTCCACGACGAGCCCGCTG-3'; Reverse primer P60: 5'-TTGCTTCACATCAACATTTATATTCATGTGTACATTCCTCTCTTACCTATAATGGTACC-3'; Construct the forward primer P61 for pP43NMK-Ensp-β-gal-rsbV-Up: 5'-GCAAAACGAGAATAAAATACAAATGTCCACGACGAGCCCGCTG-3'; Reverse primer P62: 5'-gtATTTTATTCTCGTTTTGCTTTTTTTTCAACATTTATATTCATGTGTACATTCCTCTCTTACCTATAATGGTACC-3'; Construct the forward primer P63 for pP43NMK-Ensp-β-gal-MLD40: 5'-CACAAATAACAGGCAAAACCAAACACTGAAACAAATGTCCACGACGAGCCCGCTG-3'; Reverse primer P64: 5'-GGTTTTGCCTGTTATTTGTGATTTTTTTCATGTGTACATTCCTCTCTTACCTATAATGGTACCGCTATCAC-3'; Construct the forward primer P65 for pP43NMK-Ensp-β-gal-MLD42: 5'-ACAACAAACAGGCAAAACCAAAATCTGAAACAAATGTCCACGACGAGCCCGCTG-3'; Reverse primer P66: 5'-TGGTTTTGCCTGTTTGTTGTTTTTTTTTTCATGTGTACATTCCTCTCTTACCTATAATGGTACCGCTATCAC-3'; Construct the forward primer P67 for pP43NMK-Ensp-β-gal-MLD47: 5'-CAAACAAACAAAACAATGAAGTCAAACAGATGTCCACGACGAGCCCGCTG-3'; Reverse primer P68: 5'-CTTCATTGTTTTGTTTGTTTGTTGTGATTTTTTTCATGTGTACATTCCTCTCTTACCTATAATGGTACCGCTATCAC-3'; Construct the forward primer P69 for pP43NMK-Ensp-β-gal-MLD62: 5'-CAACAGGCAAAACCAAACACTGAAAGGTATGTCCACGACGAGCCCGCTG-3'; Reverse primer P70: 5'-GTGTTTGGTTTTGCCTGTTGTTTGTGATTTTTTTCATGTGTACATTCCTCTCTTACCTATAATGGTACCGCTATCAC-3'; Construct the forward primer P71 for pP43NMK-Ensp-β-gal-MLD62-30bp: 5'-GAAAAAAATCACAAACAACAGGCAAAACATGTCCACGACGAGCCCGCTG-3'; Reverse primer P72: 5'-TGTTGTTTTGTGATTTTTTCATGTGTACATTCCTCTCTTACCTATAATGGTACCGCTATCAC-3'; 2. Construction of recombinant strains by transformation of Bacillus subtilis Seventeen recombinant plasmids containing different NCS sequences, constructed according to the method described in Example 2, were transformed into Bacillus subtilis. B. subtilis In WB600 competent cells, 17 recombinant engineering strains were obtained: BS-pP43NMK-Ensp-β-gal-glnA, BS-pP43NMK-Ensp-β-gal-glnA-30bp, BS-pP43NMK-Ensp-β-gal-glnA-Up, BS-pP43NMK-Ensp-β- gal-Hag, BS-pP43NMK-Ensp-β-gal-Hag-30bp, BS-pP43NMK-Ensp-β-gal-Hag-Up, BS-pP43NMK-Ensp-β-gal-yvyD, BS-pP43NMK-Ensp-β-gal-yvyD-30bp, BS- pP43NMK-Ensp-β-gal-yvyD-Up, BS-pP43NMK-Ensp-β-gal-rsbV, BS-pP43NMK-Ensp-β-gal-rsbV-30bp, BS-pP43NMK-Ensp-β-gal-rsbV-Up, BS-pP43NMK-Ens p-β-gal-MLD40, BS-pP43NMK-Ensp-β-gal-MLD42, BS-pP43NMK-Ensp-β-gal-MLD47, BS-pP43NMK-Ensp-β-gal-MLD62, BS-pP43NMK-Ensp-β-gal-MLD62-30bp; 3. Fermentation and enzyme activity assay The 17 recombinant engineered strains were fermented and cultured according to the method described in Example 3, and their enzyme activities were then measured according to the method described in Example 3. The results are shown in [Figure 3]. Figure 2 ; Depend on Figure 2 It can be seen that the enzyme activities of the recombinant strains glnA, glnA-30bp, Hag, Hag-30bp, and MLD42 all reached a high level, with enzyme activities of 271.70, 383.30, 263.09, 332.69, and 259.57 U / mL, respectively, which are more than 24 times higher than the control group (BS-pP43NMK-Ensp-β-gal).

[0058] Example 5: Optimization of 5'-UTR Sequence This embodiment optimizes 12 5'-UTR sequences: UTR3, UTR4, UTR6, UTR7, UTR8, UTR10, UTR12, UTR13, UTR-H1, UTR-H2, UTR-M1, and UTR-M2. The nucleotide sequences encoding these 12 5'-UTR sequences are shown in SEQ ID No:36-46 and SEQ ID No:4.

[0059] 1. Construction of recombinant expression vectors Taking the recombinant plasmid pP43NMK-Ensp-β-gal-UTR3 as an example, this paper introduces the methods for obtaining recombinant plasmids containing different 5'-UTR sequences, specifically: Using pP43NMK-Ensp-β-gal plasmid as a template, PCR was performed to replace the 5'-UTR sequence before the Ensp-β-gal gene encoding in the pP43NMK-Ensp-β-gal plasmid with the 5'-UTR sequence UTR3 of SEQ ID No:36, to obtain the recombinant plasmid pP43NMK-Ensp-β-gal-UTR3.

[0060] The primers used for PCR are as follows: Forward primer P73 for reconstructing plasmid pP43NMK-Ensp-β-gal-UTR3: 5'-TAGAAAGGAGGAATGTACACATGTCCACGACGAGCCCGCTGAC-3'; Reverse primer P74: 5'-GTGTACATTCCTCCTTTCTAATCACTTTATATTTTACATAATCGCGCGCTTTTTTTCACG-3'; The composition of the PCR reaction system is shown in Table 1; The amplification conditions were as follows: pre-denaturation at 95℃ for 3 min; followed by denaturation at 94℃ for 30 s, annealing at 56-58℃ for 30 s, extension at 72℃ for 5 min, for 30 cycles; and finally extension at 72℃ for 5 min, followed by holding at 4℃.

[0061] PCR amplification products need to be detected by agarose gel electrophoresis and purified by gel extraction. After purification by agarose gel extraction, the PCR amplification products are then processed with the restriction enzyme QuickCut. TM Dpn I removes the template. Only relatively pure fragments can be used for ligation to construct recombinant plasmids.

[0062] The recombinant plasmid pP43NMK-Ensp-β-gal was constructed. - UTR3 is converted into E. coli E. coli In DH5α competent cells, in a solution containing 100 µ After culturing overnight in LB solid medium at a concentration of 100 g / mL ampicillin sodium, single colonies were picked at 100 μL. µ The cells were cultured in LB liquid medium at a concentration of g / mL ampicillin sodium, and then the recombinant plasmid pP43NMK-Ensp-β-gal-UTR3 was extracted and sequenced to screen for the correct recombinant plasmid pP43NMK-Ensp-β-gal-UTR3.

[0063] Following the method described above, other 5'-UTR sequences UTR4, UTR6, UTR7, UTR8, UTR10, UTR12, UTR13, UTR-H1, UTR-H2, UTR-M1, and UTR-M2 were used to replace the 5'-UTR sequence in the recombinant plasmid pP43NMK-Ensp-β-gal using overlap extension PCR, respectively, to construct recombinant plasmids pP43NMK-Ensp-β-gal-UTR4, pP43NMK-Ensp-β-gal-UTR6, and pP43NMK-Ensp-β-gal containing different 5'-UTR sequences. -gal-UTR7, pP43NMK-Ensp-β-gal-UTR8, pP43NMK-Ensp-β-gal-UTR10, pP43NMK-Ensp-β-gal-UTR12, pP43NMK-Ensp-β-gal-UTR 13. pP43NMK-Ensp-β-gal-UTR-H1, pP43NMK-Ensp-β-gal-UTR-H2, pP43NMK-Ensp-β-gal-UTR-M1, pP43NMK-Ensp-β-gal-UTR-M2; Among them, the forward primer P75 for constructing pP43NMK-Ensp-β-gal-UTR4 was: 5'-CCATTATAGGTAAAGGAGGAATGTACACATGTCCACGACGAGCCCGCTG-3'; Reverse primer P76: 5'-TCCTCCTTTACCTATAATGGTACCGCTATCACTTTATATTTTACATAATCGCGCGCTTTTTTTCACGCC-3'; Construct the forward primer P77 for pP43NMK-Ensp-β-gal-UTR6: 5'-CATTAGAAAGGAGGAATGTACAATGTCCACGACGAGCCCGCTG-3'; Reverse primer P78: 5'-GTACATTCCTCCTTTCTAATGTACCGCTATCACTTTATATTTTACATAATCGCGCGCTTTTTTTCACG-3'; Construct the forward primer P79 for pP43NMK-Ensp-β-gal-UTR7: 5'-TAGAAAGGAGGAATGTATAATGTCCACGACGAGCCCGCTGAC-3'; Reverse primer P80: 5'-TATACATTCCTCCTTTCTAATGTACCGCTATCACTTTATATTTTACATAATCGCGCGCTTTTTTTCACG-3'; Construct the forward primer P81 for pP43NMK-Ensp-β-gal-UTR8: 5'-GTATATTAGAAAGGAGGAATGTATAATGTCCACGACGAGCCCGCTG-3'; Reverse primer P82: 5'-CATTCCTCCTTTCTAATATACCGCTATCACTTTATATTTTACATAATCGCGCGCTTTTTTTCACG-3'; Construct the forward primer P83 for pP43NMK-Ensp-β-gal-UTR10: 5'-ACATTAGAAAGGAGGAATGTACAATGTCCACGACGAGCCCGCTG-3'; Reverse primer P84: 5'-ACATTCCTCCTTTCTAATGTACTTTATATTTTACATAATCGCGCGCTTTTTTTCACG-3'; Construct the forward primer P85 for pP43NMK-Ensp-β-gal-UTR12: 5'-GTATATTAGAAAGGAGGAATATATAATGTCCACGACGAGCCCGCTG-3'; Reverse primer P86: 5'-ATTCCTCCTTTTCTAATATACTTTATATTTTACATAATCGCGCGCTTTTTTTCACGCC-3'; Construct the forward primer P87 for pP43NMK-Ensp-β-gal-UTR13: 5'-GTGATTAGAAAGGAGGAATGTACAATGTCCACGACGAGCCCGCTG-3'; Reverse primer P88: 5'-CATTCCTCCTTTCTAATCACTTTATATTTTACATAATCGCGCGCTTTTTTTCACGCC-3'; Construct the forward primer P89 for pP43NMK-Ensp-β-gal-UTR-H1: 5'-GTACCATTAGAAAGGAGGAATGTACAATGTCCACGACGAGCCCGCTG-3'; Reverse primer P90: 5'-TCCTCCTTTCTAATGGTACCGCTATCACTTTATATTTTACATAATCGCGCGCTTTTTTTCACG-3'; Construct the forward primer P91 for pP43NMK-Ensp-β-gal-UTR-H2: 5'-GTACATTAGAAAGGAGGAATGTACAATGTCCACGACGAGCCCGCTG-3'; Reverse primer P92: 5'-TCCTCCTTTCTAATGTACCGCTATCACTTTATATTTTACATAATCGCGCGCTTTTTTTCACG-3'; Construct the forward primer P93 for pP43NMK-Ensp-β-gal-UTR-M1: 5'-GAAAGGAGGTGTACACGGTATGTCCACGACGAGCCCGCTG-3'; Reverse primer P94: 5'-TACCGTGTACACCTCCTTTCTTATCACTTTATATTTTACATAATCGCGCGCTTTTTTTCACG-3'; Construct the forward primer P95 for pP43NMK-Ensp-β-gal-UTR-M2: 5'-GTGTCACGGTATGTCCACGACGAGCCCGCTG-3'; Reverse primer P96: 5'-TCGTGGACATACCGTGACACCTCCTTTCTTATCACTTTATATTTTACATAATCGCGCGCTTTTTTTCACG-3'; 2. Construction of recombinant strains by transformation of Bacillus subtilis Twelve recombinant plasmids containing different 5'-UTR sequences, constructed according to the method described in Example 2, were transformed into Bacillus subtilis. B. subtilis Twelve recombinant engineered strains, BS-pP43NMK-Ensp-β-galUTR3, were obtained from WG600 competent cells. 、 BS-pP43NMK-Ensp-β-gal-UTR4, BS-pP43NMK-Ensp-β-gal-UTR6, BS-pP43NMK-Ensp-β-gal-UTR7, BS-pP43NMK-Ensp-β-gal-UTR8, BS-pP43NMK-Ensp-β-gal-UTR10, BS-pP43NMK-Ensp-β- gal-UTR12, BS-pP43NMK-Ensp-β-gal-UTR13, BS-pP43NMK-Ensp-β-gal-UTR-H1, BS-pP43NMK-Ensp-β-gal-UTR-H2, BS-pP43NMK-Ensp-β-gal-UTR-M1, BS-pP43NMK-Ensp-β-gal-UTR-M2. 3. Fermentation and enzyme activity assay The 12 recombinant engineered strains were fermented and cultured according to the method described in Example 3, and their enzyme activities were then measured according to the method described in Example 3. The results are shown in [Figure 3]. Figure 3 ; from Figure 3It can be seen that the enzyme activities of the recombinant engineered strains obtained from UTR4, UTR7, UTR10, and UTR13 are much higher than those of other 5'-UTR sequences, with enzyme activities of 177.5, 176.2, 235.0, and 163.0 U / mL, respectively, which are more than 15 times higher than those of the control group (BS-pP43NMK-Ensp-β-gal).

[0064] Example 6: Three-factor synergistic optimization of promoter, NCS and 5'-UTR 1. Construction of recombinant expression vectors This embodiment focuses on the screened high-efficiency promoter P. phrE Combined with the 5'-UTR sequences UTR4, UTR7, UTR10, UTR13 and NCS sequences glnA, glnA-30bp, Hag, Hag-30bp, and MLD42, which have significant enhancement effects, and according to the recombinant plasmid pP43NMK-Ensp-β-gal-P in Example 1. phrE - The method for obtaining glnA-30bp-UTR13, and constructing pP43NMK-Ensp-β-gal-P phrE - glnA-UTR4, pP43NMK-Ensp-β-gal-P phrE - glnA-30bp-UTR4, pP43NMK-Ensp-β-gal-P phrE - Hag-UTR4, pP43NMK-Ensp-β-gal-P phrE - Hag-30bp-UTR4, pP43NMK-Ensp-β-gal-P phrE - MLD42-UTR4, pP43NMK-Ensp-β-gal-P phrE - glnA-UTR7, pP43NMK-Ensp-β-gal-P phrE - glnA-30bp-UTR7, pP43NMK-Ensp-β-gal-P phrE - Hag-UTR7, pP43NMK-Ensp-β-gal-P phrE - Hag-30bp-UTR7, pP43NMK-Ensp-β-gal-P phrE - MLD42-UTR7, pP43NMK-Ensp-β-gal-PphrE - glnA-UTR10, pP43NMK-Ensp-β-gal-P phrE - glnA-30bp-UTR10, pP43NMK-Ensp-β-gal-P phrE - Hag-UTR10, pP43NMK-Ensp-β-gal-P phrE - Hag-30bp-UTR10, pP43NMK-Ensp-β-gal-P phrE - MLD42-UTR10, pP43NMK-Ensp-β-gal-P phrE - glnA-UTR13, pP43NMK-Ensp-β-gal-P phrE - glnA-30bp-UTR13, pP43NMK-Ensp-β-gal-P phrE - Hag-UTR13, pP43NMK-Ensp-β-gal-P phrE - Hag-30bp-UTR13, pP43NMK-Ensp-β-gal-P phrE - MLD42-UTR13 is one of 20 co-regulated recombinant expression vectors.

[0065] 2. Construction of recombinant strains by transformation of Bacillus subtilis Following the method described in Example 2, the above recombinant plasmids were transformed into Bacillus subtilis. B. subtilis Recombinant engineered strain BS-pP43NMK-Ensp-β-gal-P was obtained in WG600 competent cells. phrE - glnA-UTR4, BS-pP43NMK-Ensp-β-gal-P phrE - glnA-30bp-UTR4, BS-pP43NMK-Ensp-β-gal-P phrE - Hag-UTR4, BS-pP43NMK-Ensp-β-gal-P phrE - Hag-30bp-UTR4, BS-pP43NMK-Ensp-β-gal-P phrE -MLD42-UTR4、BS-pP43NMK-Ensp-β-gal-P phrE - glnA-UTR7、BS-pP43NMK-Ensp-β-gal-P phrE - glnA-30bp-UTR7、BS-pP43NMK-Ensp-β-gal-P phrE - Hag-UTR7、BS-pP43NMK-Ensp-β-gal-P phrE - Hag-30bp-UTR7、BS-pP43NMK-Ensp-β-gal-P phrE - MLD42-UTR7、BS-pP43NMK-Ensp-β-gal-P phrE - glnA-UTR10、BS-pP43NMK-Ensp-β-gal-P phrE - glnA-30bp-UTR10、BS-pP43NMK-Ensp-β-gal-P phrE - Hag-UTR10、BS-pP43NMK-Ensp-β-gal-P phrE - Hag-30bp-UTR10、BS-pP43NMK-Ensp-β-gal-P phrE - MLD42-UTR10、BS-pP43NMK-Ensp-β-gal-P phrE - glnA-UTR13、BS-pP43NMK-Ensp-β-gal-P phrE - glnA-30bp-UTR13、BS-pP43NMK-Ensp-β-gal-P phrE - Hag-UTR13、BS-pP43NMK-Ensp-β-gal-P phrE - Hag-30bp-UTR13、BS-pP43NMK-Ensp-β-gal-P phrE - MLD42-UTR13。

[0066] 3、Father Square The 20 recombinant engineered bacterial strains constructed were fermented and cultured according to the method described in Example 3, and their enzyme activities were then measured according to the method described in Example 3. The results are shown in [Figure 3]. Figure 4 ; from Figure 4 It can be known that the recombinant engineered strain BS-pP43NMK-Ensp-β-gal-P phrE - The enzyme activity of glnA-30bp-UTR13 was the highest, at 584.2 U / mL. BS-pP43NMK-Ensp-β-gal-P phrE - glnA-30bp-UTR4 and BS-pP43NMK-Ensp-β-gal-P phrE - The enzyme activities of MLD42-UTR7 were second only, at 540.2 and 561.1 U / mL, respectively.

[0067] Example 7: Production of GOS using fermentation broth from a recombinant engineered strain of Bacillus subtilis The fermentation broth containing β-galactosidase from Example 2 was used for the production of GOS.

[0068] Using lactose as a substrate, with a lactose concentration of 300 g / L and an enzyme addition of 120 U / mL (final concentration), the reaction was carried out in a stable system with 100 mM HEPES buffer at pH 7.5 for 6-14 h at 40-55°C. GOS yield was measured periodically, and the results are shown below. Figure 5 .

[0069] At 40℃, the reaction time was 10 h, and the GOS yield reached its maximum, with a content of 121.1 g / L and a yield of 40.38%.

[0070] The calculation methods for GOS yield and conversion rate are as follows: GOS yield (g / L) = Initial lactose content (g / L) − Total residual lactose, glucose and galactose content (g / L) GOS conversion rate (%) = (Initial lactose content − Total residual lactose, glucose and galactose content) / Initial lactose content] × 100 Product analysis methods Using a differential refractive index detector (RID) and Hypersil TM The APS-2 amino HPLC column was used for the quantitative analysis of lactose content. The concentrations of galactose and glucose were also determined using the same HPLC-RID system, but separated using a Rezex™ ROA-organic acid H⁺ column.

[0071] The mobile phase used for chromatographic separation consisted of 75% acetonitrile (v / v), 25% ultrapure water (v / v), and 0.1% ammonia (v / v).

[0072] The embodiments described above are merely preferred embodiments of the present invention, and not an exhaustive list of all possible implementations of the present invention. Any obvious modifications made by those skilled in the art without departing from the principles and spirit of the present invention should be considered to be included within the scope of protection of the claims of the present invention.

Claims

1. A recombinant strain of Bacillus subtilis producing high-activity β-galactosidase, characterized in that, Using Bacillus subtilis as the host cell and pP43NMK as the expression vector, and employing P... phrE The promoter replaced the P promoter of the pP43NMK expression vector. 43 The gene was obtained by modifying β-galactosidase using any one of the following AC modifications: A: Replace the 5'-UTR sequence of the pP43NMK expression vector with a 5'-UTR sequence as shown in SEQ ID No:37 or having at least 95% identity with SEQ ID No:37; and insert an NCS sequence glnA-30bp as shown in SEQ ID No:5 or having at least 95% identity with SEQ ID No:5 before the β-galactosidase gene sequence; B: Replace the 5'-UTR sequence of the pP43NMK expression vector with a 5'-UTR sequence as shown in SEQ ID No:39 or having at least 95% identity with SEQ ID No:39; and insert the NCS sequence MLD42 as shown in SEQ ID No:32 or having at least 95% identity with SEQ ID No:32 before the β-galactosidase gene sequence; C: Replace the 5'-UTR sequence of the pP43NMK expression vector with a 5'-UTR sequence as shown in SEQ ID No:4 or having at least 95% identity with SEQ ID No:4; and insert an NCS sequence glnA-30bp as shown in SEQ ID No:5 or having at least 95% identity with SEQ ID No:5 before the β-galactosidase gene sequence.

2. The recombinant Bacillus subtilis strain producing high-activity β-galactosidase according to claim 1, characterized in that, The β-galactosidase is derived from Enterobacter sp.

3. The recombinant Bacillus subtilis strain producing high-activity β-galactosidase according to claim 1, characterized in that, The nucleotide sequence of the β-galactosidase is as shown in SEQ ID No:1 or has at least 90% identity with SEQ ID No:1; The P phrE The nucleotide sequence of the promoter is as shown in SEQ ID No:3 or has at least 95% identity with SEQ ID No:

3.

4. The recombinant Bacillus subtilis strain producing high-activity β-galactosidase according to claim 1, characterized in that, The Bacillus subtilis used is Bacillus subtilis. B. subtilis WG600.

5. A method for efficiently producing β-galactosidase using the recombinant strain of Bacillus subtilis as described in any one of claims 1-4.

6. The method as described in claim 5, characterized in that, The recombinant strain of Bacillus subtilis as described in any one of claims 1-4 is inoculated into a fermentation medium to produce β-galactosidase through fermentation. The fermentation medium comprises: 12 g / L peptone, 24 g / L yeast extract, 12.54 g / L K2HPO4, 2.54 g / L KH2PO4, and 50 μg / mL kanamycin; the fermentation conditions are: fermentation at 33℃ and 200 rpm for 48-60 h.

7. The method as described in claim 5, characterized in that, Before inoculating the recombinant Bacillus subtilis strain into the fermentation medium, it was first grafted onto a seed culture medium for activation culture; the seed culture medium consisted of: 5 g / L yeast extract, 10 g / L peptone, 10 g / L NaCl, and 50 μg / mL kanamycin; the activation culture was carried out at 37°C and 200 rpm for 12-14 hours.

8. The use of β-galactosidase or fermentation broth containing β-galactosidase produced by the method according to any one of claims 5-7 in the production of galactooligosaccharides.

9. A method for preparing galactooligosaccharides, characterized in that, Using lactose as a substrate, β-galactosidase produced by the method described in any one of claims 5-7 or fermentation broth containing β-galactosidase is used for enzymatic hydrolysis to produce galacto-oligosaccharides.

10. The preparation method according to claim 9, characterized in that, The final concentration of lactose in the enzymatic hydrolysis system was 300 g / L; the enzymatic hydrolysis conditions were: 40℃, pH 7.5, and 1 mM Mg. 2+ The reaction was carried out in 100 mM HEPES buffer with a final β-galactosidase concentration of 120 U / mL for 10 h.