A gene related to blackened leaf trait and application thereof
By regulating the bright leaf trait in plants using the dominant control gene BraA02g02617P and its recombinant expression vector, the problem of the difficulty in applying dominant genes in breeding was solved, and the dominant control and breeding improvement of the bright leaf trait in black cabbage were realized.
Patent Information
- Application Number
- CN202610489194.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-14
- Publication Date
- 2026-06-02
AI Technical Summary
In existing technologies, it is difficult to effectively utilize dominant genes to control the glossy leaf trait in black cabbage, which limits the application of breeding techniques.
A dominant control gene BraA02g02617P and its related recombinant expression vector and expression cassette are provided for regulating the bright leaf trait in plants. The gene function is verified by heterologous transformation of Arabidopsis thaliana.
This study revealed the key role of BrERF084 in the formation of waxy crystals on the epidermis of 'Rugao Black Cabbage', providing a new genetic resource for the commercial improvement of green-stemmed cabbage and realizing dominant-controlled breeding of the bright leaf trait.
Smart Images

Figure CN122128326A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular genetic breeding technology, and specifically relates to a gene related to the bright leaf trait of black cabbage and its application. Background Technology
[0002] Chinese cabbage (Brassica rapa ssp. chinensis) is an important leafy vegetable belonging to the Brassicaceae family. As the main edible part, the glossiness of the leaves is a key indicator for evaluating their commercial value. Common Chinese cabbage leaves are dull gray due to the waxy coating, while glossy leaves exhibit a bright green sheen due to reduced or absent wax. This characteristic is determined by the wax crystal structure of the cuticle. The main components of the epidermal wax are long-chain fatty acids (C26-C34) and their derivatives (alkanes, aldehydes, alcohols, etc.). Their biosynthetic pathway includes de novo fatty acid synthesis in the plastids (C16-C18 fatty acids produced via the FAS pathway), endoplasmic reticulum fatty acid elongation (C26-C28 long-chain fatty acids formed via the FAE system), and subsequent decarboxylation / acyl reduction reactions, ultimately forming a waxy coating on the epidermis via membrane transport proteins.
[0003] With the development of molecular breeding, several genes controlling glossy leaves have been discovered in Brassica genus plants, such as head cabbage. BoCgl2 Purple seaweed shoots BrCER4 ,Chinese cabbage BrMYB31 and BrWAX2 However, the bright leaf trait is mostly controlled by recessive genes, limiting its application in breeding. Identifying and revealing the function of dominant bright leaf genes has high application value in breeding new varieties of bright-leaved green-stemmed vegetables. Summary of the Invention
[0004] To solve the above-mentioned technical problems, the present invention provides the following technical solution: A gene controlling the bright leaf trait in plants is provided.
[0005] In some implementations, the gene is a dominant control gene.
[0006] In some implementations, the gene is BraA02g02617P; In some specific implementation plans, Its nucleosides Acid sequences such as As shown in SEQ ID NO:7.
[0007] In some embodiments, the gene undergoes a mutation; in some specific embodiments, the mutation includes non-synonymous mutations (SNPs) in the gene coding region, insertional non-synonymous mutations, and / or frameshift mutations; in some specific embodiments, the gene mutation causes amino acid substitutions and premature termination of translation; in some specific embodiments, the nucleotide sequence after the gene mutation is shown in SEQ ID NO:8.
[0008] In some embodiments, the plant includes cruciferous plants; in some specific embodiments, the plant includes plants of the genus Brassica; in some specific embodiments, the plant includes Chinese cabbage, bok choy, cabbage, rapeseed, radish, mustard greens, or turnip, etc.
[0009] In some embodiments, the plant is a cruciferous plant; in some specific embodiments, the plant is a Brassica plant; in some specific embodiments, the plant is Chinese cabbage, bok choy, cabbage, rapeseed, radish, mustard greens, or turnip, etc.; in some specific embodiments, the plant is Chinese cabbage; in some specific embodiments, the plant is bok choy; in some specific embodiments, the plant is Rugao black cabbage.
[0010] In some implementations, the plant is Arabidopsis thaliana.
[0011] A recombinant expression vector is also provided.
[0012] In some embodiments, the recombinant expression vector contains the plant bright leaf trait control gene as described in any of the above embodiments.
[0013] In some embodiments, the recombinant expression vector contains a nucleotide sequence as shown in SEQ ID NO:8.
[0014] An expression box is also provided.
[0015] In some implementations, the expression cassette is a recombinant expression vector as described in any of the preceding embodiments.
[0016] In some embodiments, the expression cassette contains a plant bright leaf trait control gene as described in any of the above embodiments.
[0017] In some embodiments, the expression cassette contains a nucleotide sequence as shown in SEQ ID NO:8.
[0018] An engineered bacterium is also provided.
[0019] In some embodiments, the engineered bacteria contain the plant bright leaf trait control gene as described in any of the above embodiments, or the recombinant expression vector as described in any of the above embodiments.
[0020] It also provides the application of the plant bright leaf trait control gene or its encoded protein as described in any of the above, the recombinant expression vector as described in any of the above, and the engineered bacteria as described in any of the above, in any of the following: (1) Increase the brightness of plant leaves; (2) Cultivate plants with glossy leaves; (3) Identify or screen plants with glossy leaves; (4) Regulate the expression level of genes related to bright leaves in plants.
[0021] In some embodiments, the plant is a cruciferous plant; in some specific embodiments, the plant is a Brassica plant; in some specific embodiments, the plant is Chinese cabbage, bok choy, cabbage, rapeseed, radish, mustard greens, or turnip, etc.; in some specific embodiments, the plant is Chinese cabbage; in some specific embodiments, the plant is bok choy; in some specific embodiments, the plant is Rugao black cabbage.
[0022] In some implementations, the plant is Arabidopsis thaliana.
[0023] It also provides the plant bright leaf trait control gene or its encoded protein as described in any of the above, the recombinant expression vector as described in any of the above, and the application of the engineered bacteria as described in any of the above in the preparation of transgenic plants.
[0024] In some embodiments, the genetically modified plant contains BraA02g02617P Gene mutations have resulted in transgenic plants possessing the trait of glossy leaves.
[0025] In some embodiments, the nucleotide sequence of the mutated gene is shown in SEQ ID NO:8.
[0026] In some embodiments, the plant is a cruciferous plant; in some specific embodiments, the plant is a Brassica plant; in some specific embodiments, the plant is Chinese cabbage, bok choy, cabbage, rapeseed, radish, mustard greens, or turnip, etc.; in some specific embodiments, the plant is Chinese cabbage; in some specific embodiments, the plant is bok choy; in some specific embodiments, the plant is Rugao black cabbage.
[0027] In some implementations, the plant is Arabidopsis thaliana.
[0028] The present invention has the following technical effects: (1) revealed Brerf084 The novel function of this gene clarifies its key role in the formation of waxy crystals on the epidermis of 'Rugao Black Vegetable', providing a new genetic resource for the commercial improvement of green-stemmed vegetables.
[0029] (2) The controlling gene for the glossy leaf trait of 'Rugao Black Cabbage' was screened. Brerf084 The gene function was verified through Arabidopsis heterologous transformation experiments, and similar experimental conclusions were also found in Brassica plants such as 'Rugao Black Vegetable'. Attached Figure Description
[0030] Figure 1The phenotypic characteristics of 536 and 'RHL' are shown. In A, the first row of three plants represents 536, and the second row of three plants represents 'RHL'; in B, the three leaves on the left represent 536 leaves, and the three leaves on the right represent 'RHL' leaves; CD compares the total wax content and the three main cuticle wax components of 536 and 'RHL', respectively. Scale bar = 2cm. (*) P <0.05; **, P <0.01).
[0031] Figure 2 The preliminary mapping of the bright leaf gene by BSA-seq is shown. A: SNP-index results; the red line represents the Δ(SNP-index) distribution displayed as a window, with windows of 99% confidence or higher considered candidate intervals. B: Regions exceeding the 5th thousandth percentile threshold were selected as candidate regions related to the trait.
[0032] Figure 3 The fine mapping of the glossy leaf gene in 'Rugao Black Vegetable' is shown. A: Indel polymorphic molecular marker; B: Fine mapping diagram of the glossy leaf gene.
[0033] Figure 4 Candidate genes for glossy leaves in 536 and 'Rugao Black Vegetable' were shown. BraA02g02617P The promoter sequences were cloned and aligned. Among them, 536 is the corresponding gene sequence of the high-generation inbred line 536 of *Gnaphalium affine*, 'RHL' is the corresponding gene sequence of 'Rugao black cabbage', and reference is the corresponding gene sequence in the reference genome.
[0034] Figure 5 Candidate genes for glossy leaves in 536 and 'Rugao Black Vegetable' were shown. BraA02g02617P The coding region sequence was cloned and aligned. Where, A: BraA02g02617P Cloning and alignment of the coding region base sequence. B: BraA02g02617P Protein sequence cloning and alignment.
[0035] Figure 6 Candidate genes for glossy leaves in 536 and 'Rugao Black Vegetable' were shown. BrERF084 Verification of transgenic function in Arabidopsis thaliana. A: Identification using the three-primer method. erf084 Homozygous mutant Arabidopsis thaliana plants, HM: homozygous genotype, HZ: heterozygous genotype; B: 4-week-old Arabidopsis thaliana plants Col-0, erf084 , Pro35S :: Brerf084 and Pro35S :: BrERF084 Phenotypic identification, Pro35S :: Brerf084 and Pro35S :: BrERF084All plants were T3 generation plants; C: Arabidopsis seeds that successfully infected the plant were screened using hygromycin-resistant agar plates. The top plate is a standard 1 / 2 MS agar plate, and the bottom plate is a hygromycin agar plate. Scale bar = 2 cm.
[0036] Figure 7 It shows BrERF084 Expression levels in different organs of 536 plants. Detailed Implementation
[0037] The present invention will now be described in detail with reference to embodiments, but the embodiments provided herein are for illustrative purposes only and are not intended to limit the present invention.
[0038] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, all materials and reagents used are commercially available.
[0039] The various terms and phrases used in this invention have their general meanings known to those skilled in the art. Nevertheless, this invention still intends to provide a more detailed description and explanation of these terms and phrases. In the event of any inconsistency between the terms and phrases mentioned and their known meanings, the meanings expressed in this invention shall prevail.
[0040] Example 1: Localization population construction, phenotypic identification, and genetic analysis 1.1 Experimental Methods A positioning population was constructed using 'Rugao black cabbage' and a high-generation inbred line 536 of green-stemmed cabbage with thick wax powder.
[0041] Cuticle wax was extracted by soaking equal areas of 536 and 'Rugao Black Vegetable' leaves in chloroform for 1 minute at room temperature. Tetracosane was added to the extract as an internal standard. Subsequently, the samples were derivatized with 100 μL of N,O-bis(trimethylsilyl)trifluoroacetamide and 100 μL of pyridine, sealed, and incubated at 70°C for 60 minutes. Sample analysis was performed using an AGILENT 6890-5973N gas chromatograph equipped with a mass spectrometer detector.
[0042] 536 (P1) was crossed with 'Rugao Black Cabbage' (P2) to obtain the F1 generation. The F1 generation was backcrossed with each of the two parents to obtain the BC1 population. Self-pollination of the F1 plants produced the F2 segregating population. The phenotypes of the P1, P2, F1, BC1, and F2 populations were systematically recorded. The chi-square test (χ²) was used. 2 The segregation ratios of the BC1 and F2 populations were analyzed using a test.
[0043] 1.2 Experimental Results Phenotypic characteristics of 'Rugao Black Cabbage': Throughout its growth period, 'Rugao Black Cabbage' ('RHL') exhibits a glossy leaf phenotype, while the leaves of the high-generation inbred line 536 are grayish-white. Figure 1 The total wax content and the content of the main wax components of the two parents were compared by gas chromatography-mass spectrometry (GC-MS). It was found that the wax content of 'RHL' was significantly lower than that of 536, and there was a significant difference in the alkane content between the two. Figure 1 (CD in the middle).
[0044] The chi-square test showed a 3:1 segregation ratio, proving that the glossy leaf trait of 'Rugao Black Cabbage' is a single-gene inheritance. The BC1P2 generation produced by backcrossing with 'Rugao Black Cabbage' all exhibited the waxy phenotype consistent with the wild type; however, the BC1P1 generation produced by backcrossing with 536 showed phenotypic segregation, clearly distinguishing between the waxy and glossy leaf phenotypes. The segregation ratio, after statistical analysis and chi-square test, was found to be a 1:1 segregation ratio, further confirming that the glossy leaf trait of 'Rugao Black Cabbage' is a single-gene dominant inheritance (Table 1).
[0045] Table 1. The glossy leaf trait of 'Rugao Black Cabbage' is a single-gene dominant inheritance trait.
[0046]
[0047] Example 2: Localization of the bright leaf mutant gene 2.1 Experimental Methods To identify the genetic loci controlling the bright leaf trait, we selected individual plants exhibiting the bright leaf phenotype from the F2 population and extracted genomic DNA. Fifty high-quality DNA samples were mixed in equal volumes to construct a pool for 'Rugao Black Cabbage'. Similarly, DNA samples from 536 plants (P1) and 'Rugao Black Cabbage' (P2) were mixed separately to construct pools P1 and P2. First, the raw high-throughput sequencing data were preliminarily evaluated and filtered based on sequence quality to obtain high-quality data. The high-quality data were aligned to a reference genome, and the alignment information was statistically analyzed. Variant sites were identified, and variant information was statistically analyzed. The difference in SNP-index between the two pools was calculated, i.e., Δ(SNP-index) = SNP-index (extreme trait P1) – SNP-index (extreme trait P2). 10,000 permutation tests were performed, and 95% (green) and 99% (orange) confidence levels were selected as screening thresholds. The red line in the figure represents the Δ(SNP-index) distribution in window form, with windows having a confidence level of 99% or higher as candidate intervals. ED analysis was then performed. Before sequencing, due to trait selection across all pooled samples, pools with extreme traits were selected for sequencing. That is, the higher the SNP-index value, the stronger the linkage between the SNP at that locus and the target trait, and the higher the association with the target trait; conversely, the lower the linkage between the SNP at that locus and the target trait, the lower the association with the target trait. Regions exceeding the 5th percentile threshold were selected as candidate regions for trait-related associations.
[0048] 1120 F2 plants with obvious wax powder and phenotypically distinct parents were selected for fine mapping. DNA was extracted from young leaves using the cetyltrimethylammonium bromide method (Murray and Thompson 1980), and mutation sites were identified by genome resequencing and BSA-Seq analysis. Gene sequences were downloaded from the Brassica genus database (BRAD, http: / / brassicadb.cn / ), and 70 pairs of InDel markers were designed using Premier 5.0 software. Fourteen pairs of polymorphic InDel markers were screened by DNA denaturing polyacrylamide gel electrophoresis, and recombinant single plants were further screened to shorten the candidate interval.
[0049] 2.2 Experimental Results Combining the SNP-index and ED results from the BSA-seq analysis, the preliminary localization was found to be within the 7.72 Mb-18.00 Mb range on chromosome A02 (see...). Figure 2 (AB in the middle).
[0050] Fourteen pairs of Indel polymorphic molecular markers were developed for fine mapping of bright leaf genes. Ultimately, the mapping interval was narrowed to 43.70 kb, with seven genes identified within the candidate interval (see...). Figure 3 (AB in the middle).
[0051] Based on the gene cloning and annotation results, we selected BraA02g02617P as a candidate gene within the localization region (see Table 2).
[0052] Table 2. Candidate genes within fine-mapping regions
[0053]
[0054] Example 3: Cloning and Sequence Analysis of Candidate Genes 3.1 Experimental Methods Obtained from the Brassica genus database (BRAD) BraA02g02617P The genome sequence was used as a PCR template. Gene-specific primers were designed using Primer Premier 5.0 for cloning. BrERF084 Primers are shown in Table 3 below. The target amplified fragment was separated by 2% agarose gel electrophoresis. After purification, the DNA fragment was ligated into the pGEM®-T Easy vector and transformed into *E. coli* TOP10 competent cells. Positive clones were identified by colony PCR and sequencing. Sequence alignment was performed using DNAMAN.
[0055] Table 3. Candidate genes for cloning BraA02g02617P primers
[0056]
[0057] 3.2 Experimental Results clone BraA02g02617P No differences were found in the promoter sequences (see...). Figure 4 Cloning results showed candidate genes in inbred line 536. BraA02g02617P The gene for 'Rugao Black Vegetable' ('RHL') contains no introns, has a CDS sequence of 825 bp, and encodes 274 amino acids. The coding region of this gene contains non-synonymous SNPs and insertional non-synonymous mutations, leading to amino acid substitutions and premature translation termination (see [link to article]). Figure 5 (AB in the middle).
[0058] > BraA02g02617P CDS sequence (inbred line 536) ATGGAAAACACCGTTGATGGTCACCGTCTCCAACTTTCATATCCGCAAAGCTTCGGCGTCGAAACTCATCAAAGTTTAGAAATGTATGGGCTACACAAAGAGACGCCGTTAGTCTGCATGCCTCTTTCAGGAGCTAAAACTCCGTTTTCTAACCTCACGGTGACGGAGCCCTTTAACGGACCTGACACGTTTGATATCTCATCTCTATTCTCTCCTGACCCAAAACCCGTACTCGTAAGTCAGCATCGGGTTATGGATGATTCCATCGCGGCCATAGTTGGCGAAAACGTACTGTTCGGGAATAACAACATAAAAGTCTCCGAGCACTTCACGGCAACTGAGACCGGAGACGGCGTGAAGCGGTGGAGGAAGACGCCGCAGAAGAACGGAGGGTTCAGAGGTGTGAGAAAACGTCCGTGGGGGAGGTGGTCGGCGGAGATAAGAGACAGGATAGGGCGGTGCAGACATTGGTTAGGAACGTTCGACACGGCGGAAGAGGCGGCACGTGCGTATGACGCGGCGGCGGTGAGGCTTAGAGGGACCAAAGCCAAGACCAATTTCGTGGTTCATCCGGTCTTTCCGGAGGAGATAGCTGAGACTCAGTTGTCAACGACGGAGGAGGATAGGAGGAGGAAGAAGAAGAAGAGGGTGAACGTGAGGAAGTGTGTTAAAGTCACATCGGTTGAACAATTGTTCAGTGATACCACTAGGAACTTAACTTCTTCTAGTAATGATGGAAACGTGACTAATCCCTTTAACAATCTTGAGAAAATGGGCTTAGAGGTTGATTTGAAGTTGGGTTTAGGTTTATTTAGAAACTGTTAA SEQ ID NO:7 > BraA02g02617P CDS sequence ('Rugao black vegetable' ('RHL')) ATGGAAAACACCGTTGATGATCACCGTCTCCAACTTTCATATCCGCAAAGCTTCGGCGTCGAAACTCATCAAAGTTTAGAAATGTATGGGCTACACAAAGAGACGCCGTTAGTCTGCATGCCTCTTTCAGGAGCTAAAACTCCGTTTTCTAACCTCACGGTGACGGAGCCCTTTAACGGACCTGACACGTTTGATATCTCATCTCTATTCTCTCCTGACCCAAAACCCGTACTCGTAAGTCAGCGTCGGGTTATGGATGATTCCATCGCGGCCATAGTTGGCGAAAACGTACTGTTCGGGAATAACAACATAAAAGTCTCCGAGCACTTCACGGCAACTGAGACCGGAGACGGCGTGAAGCGGTGGAGGAAGACGCCGCAGAAGAACGGAGGGTTCAGAGGTGTGAGAAAACGTCCGTGGGGGAGGTGGTCGGCGGAGATAAGAGACAGGATAGGGCGGTGCAGACATTGGTTAGGAACGTTCGACACGGCGGAAGAGGCGGCACGTGCGTATGACGCGGCGGCGGTGAGGCTTAGAGGGACCAAAGCTAAGACCAATTTCGTGGTTCATCCGGTCTTTCCGGAGGAGATAGCTGAGACTCAGTCGTCAACGACGGAGGAGGATAGGAGGAGGAAGAAGAAGAAGAGGGTGAACGTGAGGAAGTGTGTTAAAGTCACATCGGTTGAACAATTGTTCAGTGATACCACTAGGAACTTAACTTCTTCTAGTAATGATGGAAACGTGACTAATCCCTTTAACAATCTTGAGAAAATGGGCTTAGAGCACCCCCATTAGTGAACCCCATGAAAGGGGTTCACAAAGTATTTT SEQ ID NO:8 Example 4: Verification of Gene Function 4.1 Experimental Method Using the three-primer system based on SIGNAL (http: / / signal.salk.edu / tdnaprimers.2.html) for erf084Genotyping of the mutant (SALK_149386C) was performed, and the primer sequences used to identify homozygous mutants are listed in Table 4. For complementation and overexpression experiments, clones were used... BrERF084 ( 536 BraA02g02617P Gene ) and Brerf084 'RHL' BraA02g02617P Gene ) The encoded sequence (CDS) is used to construct pBWA(V)HS- Pro35S :: BrERF084 ::GFP and pBWA(V)HS- Pro35S :: Brerf084 ::GFP plant expression vector, and the constructed vector was transformed into GFP using Agrobacterium-mediated inflorescence staining. trud1 In homozygous mutants, obtain Pro35S :: BrERF084 Replenishing plants and Pro35S :: Brerf084 Overexpressing plants.
[0059] Table 4. Primer sequences used for verification of homozygous Arabidopsis mutants
[0060]
[0061] Total RNA was extracted from tissue 536 using an RNA extraction kit (Tiangen, Beijing), following the manufacturer's instructions. After passing quality control, 1 μg of RNA was reverse transcribed using the Fast Quant RT Kit (Tiangen, Beijing) to synthesize cDNA. qRT-PCR reactions were performed using SYBR Green PCR Master Mix on a Quant Studio™ 6 Flex system. Two... -ΔΔCt The method performs relative quantitative analysis to BrActin This gene was used as an internal reference. All gene expression analyses were performed in triplicate (biological and technical replicates). The specific primer sequences used are listed in Table 5.
[0062] Table 5. Candidate Genes BrERF084 Primers for quantitative real-time PCR (qRT-PCR)
[0063] 4.2 Experimental Results Brassica genus BrERF084 and Brerf084, It is Arabidopsis thaliana AtERF084 ( AT1G80580 () direct homologous genes. For rapid verification BrERF084 To understand its function, we conducted heterologous transformation experiments in Arabidopsis thaliana.
[0064] Identification was performed using the three-primer method. erf084 homozygous mutant (see) Figure 6 In the A), compared with Col-0, Arabidopsis thaliana erf084 The mutant's leaves exhibit a glossy phenotype (see...) Figure 6 (B) The constructed vector was transferred into the *Agrobacterium*-mediated flower-dipping method. erf084 Among homozygous mutants, Arabidopsis thaliana that successfully infected were screened using hygromycin resistance plates (see...). Figure 6 (C) Phenotypic analysis using T3 generation plants revealed... Pro35S :: BrERF084 The wild-type phenotype was restored. Pro35S :: Brerf084 and erf084 Homozygous mutants have consistent phenotypes (see) Figure 6 (A in the text). These results prove that... BrERF084 mutant, i.e. Brerf084 This will cause the mutant to exhibit the bright leaf phenotype, while BrERF084 Overexpression of wild-type genes will restore the wild-type phenotype.
[0065] qRT-PCR analysis showed that among 536 plants, BrERF084 The highest expression level was observed in leaves, followed by stems and buds (see...). Figure 7 ).
[0066] This invention focuses on identifying genes controlling the glossy leaf trait in 'Rugao Black Cabbage'. Candidate genes were located using BSA-seq sequencing and the development of Indel polymorphic molecular markers. The results were verified through Arabidopsis heterologous transformation experiments. BrERF084 The gene function, the results showed BrERF084 Gene mutations result in the glossy-leaf trait in 'Rugao Black Cabbage'. This reveals... BrERF084 The novel function of this gene clarifies its key role in the formation of waxy crystals on the epidermis of 'Rugao Black Vegetable', providing a new genetic resource for the commercial improvement of green-stemmed vegetables.
[0067] The specific embodiments are merely illustrative of the present invention and are not intended to limit the invention. After reading this specification, those skilled in the art can make modifications to these embodiments without contributing any inventive step, but such modifications are protected by patent law as long as they are within the scope of the claims of the present invention.
Claims
1. A gene controlling the bright leaf trait in plants, characterized in that, The gene is BraA02g02617P, its nucleotide sequence For example As shown in SEQ ID NO:
7.
2. The plant glossy leaf trait control gene as described in claim 1, characterized in that, The gene is mutated, including non-synonymous mutations (SNPs) in the gene coding region, insertional non-synonymous mutations, and / or frameshift mutations, resulting in amino acid substitutions and premature termination of translation.
3. The plant glossy leaf trait control gene according to claim 2, characterized in that, The nucleotide sequence of the mutated gene is shown in SEQ ID NO:
8.
4. The plant glossy leaf trait control gene according to claim 3, characterized in that, The plants mentioned include plants of the genus Brassica.
5. The plant glossy leaf trait control gene according to any one of claims 1-4, characterized in that, The plants mentioned are Chinese cabbage, bok choy, cabbage, rapeseed, radish, mustard greens, or turnip.
6. A recombinant expression vector, characterized in that, It contains the plant glossy leaf trait control gene as described in any one of claims 1-5.
7. An engineered bacterium, characterized in that, It contains the plant bright leaf trait control gene as described in any one of claims 1-5, or the recombinant expression vector as described in claim 6.
8. The plant bright leaf trait control gene or its encoded protein as described in any one of claims 1-5, the recombinant expression vector as described in claim 6, and the engineered bacteria as described in claim 7, in any one of the following applications: (1) Increase the brightness of plant leaves; (2) Cultivate plants with glossy leaves; (3) Identify or screen plants with glossy leaves; (4) Regulate the expression level of genes related to bright leaves in plants.
9. The application of the plant bright leaf trait control gene or its encoded protein as described in any one of claims 1-5, the recombinant expression vector as described in claim 6, and the engineered bacteria as described in claim 7 in the preparation of transgenic plants, wherein: The genetically modified plant contains BraA02g02617P Gene mutations have resulted in transgenic plants possessing the trait of glossy leaves.
10. The application according to claim 9, characterized in that, The nucleotide sequence of the mutated gene is shown in SEQ ID NO:8.
Citation Information
Patent Citations
Gene capable of improving productivity of substance in seed, and method for utilization thereof
CN102459600A
InDel marker related to dominant bright green characters of Chinese cabbage, primer of InDel marker, and application of InDel marker and primer
CN111254213A