A drug for treating heart toxicity caused by vegr inhibitor by targeting cxcl12 gene or protein
By targeting and inhibiting the CXCL12 gene or protein, downregulating its expression or activity, the cardiotoxicity problem caused by VEGFR inhibitors has been solved, providing a new treatment strategy that significantly alleviates cardiac dysfunction and myocardial damage, and improves the safety and efficacy of treating the cardiotoxicity of VEGFR inhibitors.
Patent Information
- Application Number
- CN202610383441.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-26
- Publication Date
- 2026-06-05
AI Technical Summary
VEGFR inhibitors can cause cardiotoxic side effects during treatment, such as atrial fibrillation, left ventricular hypertrophic cardiomyopathy, myocardial infarction, and heart failure. Current treatment options only involve reducing the dosage or discontinuing the medication, which affects treatment efficacy and quality of life.
By targeting and inhibiting the CXCL12 gene or protein, and downregulating the expression or activity of CXCL12 through siRNA, shRNA, adenovirus vector systems, or CXCL12 neutralizing antibodies, the cardiotoxicity induced by VEGFR inhibitors can be intervened.
Significantly alleviates cardiac dysfunction and myocardial damage caused by VEGFR inhibitors, providing new therapeutic targets and effective dosing regimens, and improving the safety and efficacy of clinical applications.
Smart Images

Figure CN122140748A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of pharmaceutical technology, specifically to... CXCL12 Application of the gene or CXCL12 protein as a drug intervention target in the preparation of drugs to treat cardiotoxicity caused by VEGFR inhibitors. Background Technology
[0002] Lenvatinib, axitinib, and other orally effective multi-target receptor tyrosine kinase inhibitors can significantly inhibit receptors such as VEGFRs, PDGFRs, FGFRs, and KIT. They are often referred to as VEGFR inhibitors and have been approved as first-line treatments for solid tumors such as advanced hepatocellular carcinoma. They are also suitable for patients with unresectable hepatocellular carcinoma who have not previously received systemic therapy, as well as patients with advanced, locally advanced, or metastatic radioactive iodine-refractory differentiated thyroid cancer and advanced renal cell carcinoma.
[0003] However, VEGFR inhibitors can cause serious cardiotoxicity during treatment, including atrial fibrillation, hypertrophic cardiomyopathy of the left ventricle, myocardial infarction, and heart failure. Several fatal cases of heart failure have been reported clinically. The use of lenvatinib and similar medications can lead to adverse cardiovascular events such as hypertension, heart failure, arterial thromboembolic events, and QT interval prolongation (LJ Scott, Lenvatinib: first global approval). Drugs , 2015,75(5):553-560.). 7% of patients with differentiated thyroid cancer treated with lenvatinib developed heart failure (M. Schlumberger, 2015,75(5):553-560.). et al ., Lenvatinib versus placebo in radioiodine-refractorythyroid cancer. N Engl J Med (2015, 372(7):621-630.) The incidence of heart failure in patients with renal cell carcinoma is as high as 10%, suggesting that lenvatinib has a significant damaging effect on the heart. Other VEGFR inhibitors have also shown varying degrees of cardiotoxicity in clinical use (Bronte G, 2015, 372(7):621-630.). et al ., Conquests and perspectives of cardio-oncology in the field of tumor angiogenesis-targeting tyrosinekinase inhibitor-based therapy. Expert Opin Drug Saf. 2015 Feb;14(2):253-267; Kavsak PA, et al ., Cardiotoxicity associated with sunitinib. Lancet . 2008 Apr12;371(9620):1244).
[0004] Currently, the only clinical approach to managing the cardiotoxicity of VEGFR inhibitors is to reduce the dosage or discontinue the medication, which severely impacts patient treatment outcomes and quality of life. Therefore, in-depth research into the mechanisms of cardiotoxicity and the identification of potential intervention targets and drugs are urgently needed to address the cardiotoxicity problem of VEGFR inhibitors, and have significant clinical and toxicological research implications. Summary of the Invention
[0005] The purpose of this invention is to explore genes / proteins related to the cardiotoxicity induced by VEGFR inhibitors such as lenvatinib, and to use these genes / proteins as targets for the prevention and treatment of VEGFR inhibitor cardiotoxicity. This will allow for the screening of drugs to treat the cardiotoxic side effects of VEGFR inhibitors, thereby addressing the cardiotoxic side effects of VEGFR inhibitors and expanding their clinical application value and safety.
[0006] To achieve the above objectives, the present invention adopts the following technical solution: This invention provides targeted inhibition CXCL12 The use of substances containing the gene or CXCL12 protein in the preparation of drugs for treating cardiotoxicity induced by VEGFR inhibitors, wherein the cardiotoxicity is caused by VEGFR inhibitors affecting vascular endothelial cells. CXCL12 Increased transcription levels lead to the release of CXCL12.
[0007] Furthermore, the VEGFR inhibitor is lenvatinib, axitinib, anlotinib, sorafenib, or regorafenib. This invention is not limited thereto.
[0008] Furthermore, the manifestations of cardiotoxicity include at least one of the following: cardiomyocyte apoptosis, decreased cardiac function indicators EF and FS values, ventricular cytoplasmic swelling, cardiomyocyte disorder, and decreased compactness.
[0009] This invention has found that VEGFR inhibitors such as lenvatinib can induce vasopressin in vascular endothelial cells. CXCL12 Increased gene transcription levels and protein release; exogenous addition of recombinant CXCL12 protein can directly cause cardiomyocyte death and myocardial damage; while silencing... CXCL12The gene can block lenvatinib-induced cardiomyocyte apoptosis and cardiotoxicity. These results suggest that the accumulation of CXCL12 protein is a key cause of cardiotoxicity induced by VEGFR inhibitors such as lenvatinib, and CXCL12 may be a potential target for preventing or treating VEGFR inhibitor-induced cardiotoxicity. Therefore, inhibiting the expression of the CXCL12 gene / protein can be used as a means to intervene in VEGFR inhibitor cardiotoxicity.
[0010] In this study, shRNA technology was used to knock down the human umbilical vein endothelial cell line HUVECs. CXCL12 The results showed that knocking down HUVECs cells CXCL12 Following administration of lenvatinib, the ability of the vascular endothelial cell conditioned medium to kill cardiomyocytes was significantly reduced compared to the group transfected with the blank vector. This invention provides a new therapeutic target for intervening in the cardiotoxicity caused by VEGFR inhibitors such as lenvatinib. CXCL12 Develop corresponding drug formulations to knock down the expression of this gene, thereby regulating its expression. CXCL12 Gene expression is used to treat the cardiotoxic side effects caused by VEGFR inhibitors.
[0011] Furthermore, the substance downregulates vascular endothelial cells CXCL12 siRNA or shRNA that regulates gene expression or CXCL12 protein accumulation. This invention is not limited to this; other downregulation methods may also be used. CXCL12 Small molecule drugs that promote gene expression or accumulate CXCL12 protein.
[0012] Specifically, human resources CXCL12 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence of the human CXCL12 protein is shown in SEQ ID NO.2; the mouse-derived... CXCL12 The nucleotide sequence of the gene is shown in SEQ ID NO.3, and the amino acid sequence of the mouse CXCL12 protein is shown in SEQ ID NO.4.
[0013] As a specific embodiment of the present invention, targeting human-derived... CXCL12 The gene, wherein the target sequence of the siRNA or shRNA is 5′-CCGTCAGCCTGAGCTACAGAT-3′.
[0014] As a specific embodiment of the present invention, targeting rodent sources CXCL12 The gene, wherein the target sequence of the siRNA or shRNA is 5′-TGTGCATTGACCCGAAATTAA-3′.
[0015] In one specific embodiment of the present invention, the drug comprises an adenovirus vector system. The present invention utilizes an adenovirus vector system to deliver RNA interference plasmids to vascular endothelial cells to achieve targeted inhibition. CXCL12 Gene expression. This invention is not limited to this; for example, lentiviral vector systems may also be used.
[0016] This invention found that inhibiting CXCL12 protein activity can significantly alleviate cardiac dysfunction and myocardial damage caused by lenvatinib.
[0017] Furthermore, the substance is a CXCL12 neutralizing antibody that inhibits the activity of the CXCL12 protein.
[0018] Another object of the present invention is to provide an antitumor combination pharmaceutical composition comprising a first formulation consisting of lenvatinib and a pharmaceutically acceptable carrier, and a second formulation consisting of a CXCL12 neutralizing antibody and a pharmaceutically acceptable carrier.
[0019] This invention provides an effective treatment for cardiotoxicity caused by lenvatinib. Animal experiments showed that, compared with lenvatinib monotherapy, administration of lenvatinib after injection of CXCL12 neutralizing antibody effectively alleviated cardiac dysfunction and myocardial damage caused by lenvatinib; and no other toxic reactions were observed in the experiments, indicating that the combination therapy is highly safe.
[0020] Furthermore, the first formulation is an oral dosage form, and the second formulation is an intravenous injection dosage form. The second formulation is administered before the first formulation.
[0021] The present invention also provides the use of the pharmaceutical composition in the preparation of a medicament for treating solid tumors, including hepatocellular carcinoma, thyroid carcinoma, and renal cell carcinoma.
[0022] The beneficial effects of this invention are as follows: This invention provides CXCL12 The application of the gene or CXCL12 protein as a drug target in the preparation of drugs to treat cardiotoxicity caused by VEGFR inhibitors, wherein the drug works by downregulating... CXCL12 Gene expression or the accumulation of CXCL12 protein in the heart can reverse the cardiotoxicity of VEGFR inhibitors such as lenvatinib. Specifically, this invention provides shRNA, neutralizing antibodies, or small molecule drugs targeting CXCL12 as agents to reverse the cardiotoxicity induced by VEGFR inhibitors. This invention provides a new intervention target and effective strategy for intervening in cardiac dysfunction caused by VEGFR inhibitors, offering a feasible treatment regimen for clinical use. Attached Figure Description
[0023] Figure 1The effects of lenvatinib on vascular endothelial cells are shown in Figure A, where A represents the effect of lenvatinib on the transcription and release levels of CXCL12 in vascular endothelial cells, and B represents the effect of different doses of lenvatinib on the CXCL12 protein content in mouse serum.
[0024] Figure 2 The effects of different VEGFR inhibitors on the transcriptional level of the CXCL12 gene in vascular endothelial cells.
[0025] Figure 3 The effects of CXCL12 recombinant protein on cardiomyocytes are shown in Figure A, where A represents the effect of CXCL12 recombinant protein on cardiomyocyte survival rate, and B represents the effect of CXCL12 recombinant protein on the level of apoptosis-related proteins in cardiomyocytes.
[0026] Figure 4 The effects of recombinant CXCL12 protein on mouse heart are shown in Figure A, where A represents mouse cardiac function indicators and B represents pathological analysis of mouse heart sections.
[0027] Figure 5 To knock down CXCL12 The effect on cardiomyocyte survival, where A represents the knockdown efficiency and B represents the effect of lenvatinib conditioned medium on cardiomyocyte survival after knockdown.
[0028] Figure 6 To knock down Cxcl12 Effects on mouse hearts, where A represents mouse cardiac function indicators and B represents pathological analysis of mouse heart slices.
[0029] Figure 7 The effect of CXCL12 neutralizing antibody on mouse heart is shown in Figure 1. A represents mouse cardiac function indicators, B represents pathological analysis of mouse heart sections, and C represents mouse body weight. Detailed Implementation
[0030] The present invention will be further described below with reference to specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the invention.
[0031] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.
[0032] C57BL / 6J mice and ICR / JCL mice were purchased from Hangzhou Qizhen Laboratory Animal Technology Co., Ltd.; 2-hydroxypropyl-β-cyclodextrin (H108813) was purchased from Aladdin; human embryonic myocardial tissue-derived cell lines (RRID: CVCL_VU29, CCC-HEH-2) and human umbilical vein endothelial cell lines HUVECs were purchased from Guangzhou Genio Biotechnology Co., Ltd. CXCL12 antibody (sc-518066) was purchased from Santa Cruz Biotechnology; GAPDH antibody (ET1601-4) was purchased from Hangzhou Huaan Biotechnology Co., Ltd.; c-PARP antibody (ET1608-10) was purchased from Hangzhou Huaan Biotechnology Co., Ltd.; c-Caspase 3 antibody (ET1608-11) was purchased from Hangzhou Huaan Biotechnology Co., Ltd.; siRNA was purchased from Shanghai Gemma Pharmaceutical Co., Ltd., with the negative control (NC) positive strand sequence being 5′-UUCUCCGAACGUGUCACGUTT-3′. Cxcl12 The positive strands corresponding to the targets were 5′-TGTGCATTGACCCGAAATTAA-3′ (mouse) and 5′-CCGTCAGCCTGAGCTACAGAT-3′ (human). The transfection reagent jetPRIME® was purchased from Polyplus Transfection. The blank control antibody IgG and CXCL12 neutralizing antibody were prepared by Nanjing Genscript Biotech Co., Ltd. using recombinant methods. The recombinant CXCL12 protein (HY-P70469) was purchased from MedChemExpress. The restriction endonucleases EcoRI and AgeI were purchased from New England Biolabs. The competent E. coli Tans 5α cells were purchased from Beijing TransGen Biotech Co., Ltd. The Lipofectamine 3000 transfection kit was purchased from Thermo Fisher Scientific.
[0033] Lenvatinib, CAS number 857890-39-2, chemical name 4-[3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy]-7-methoxy-6-quinoline carboxamide, molecular formula C 22 H 23 ClN4O7S, with a molecular weight of 522.96, was purchased from Shanghai Taosu Biochemical Technology Co., Ltd. Its structural formula is as follows: .
[0034] Example 1 1. Human umbilical vein endothelial cell line (HUVECs) was seeded at a density of 60,000 cells / well in 12-well plates. After overnight fixation, 2.5 μM lenvatinib was administered. Total RNA was extracted from the cells 24 h later and analyzed. CXCL12 The mRNA levels were measured. Simultaneously, the supernatant culture medium was collected for ELISA detection of CXCL12 levels.
[0035] Specifically, human resources CXCL12 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence of the CXCL12 protein is shown in SEQ ID NO.2.
[0036] The primer pairs used for qPCR are as follows: CXCL12 -Forward: AGCTACAGATGCCCATGC; CXCL12 -Reverse:GGAGTGTTGAGAATTTTGAGATGC.
[0037] The results are as follows Figure 1 As shown in Figure A, chemokines in HUVEC cells decreased after lenvatinib treatment. CXCL12 Transcriptional levels were upregulated, and the release of CXCL12 was significantly upregulated.
[0038] 2. Eighteen male ICR / JCL mice aged 6-8 weeks were randomly divided into three groups: a control group, a lenvatinib-4 mg / kg group, and a lenvatinib-10 mg / kg group, with six mice in each group. The mice were administered the medication by gavage. The control group received a solvent control (0.4% CMC-Na). After 6 weeks of continuous administration, blood samples were collected, and the CXCL12 content in the mouse serum was measured.
[0039] The results are as follows Figure 1 As shown in B, different doses of lenvatinib can increase the level of CXCL12 protein in mouse serum.
[0040] The above results suggest that lenvatinib promotes the release of CXCL12 from vascular endothelial cells.
[0041] Example 2 Human umbilical vein endothelial cell line (HUVECs) was seeded at a density of 60,000 cells / well in 12-well plates. After overnight fixation, cells were administered 2.5 μM lenvatinib, 0.07 μM axitinib (Axi), 150 nM anlotinib (Anlo), 4.3 μM sorafenib (Sora), 8 μM regorafenib (Regora), or 0.1 μM sunitinib (Suni). Total RNA was extracted from the cells after 24 h and analyzed. CXCL12 The mRNA level.
[0042] Specifically, human resources CXCL12 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence of the CXCL12 protein is shown in SEQ ID NO.2.
[0043] The primer pairs used for qPCR are as follows: CXCL12 -Forward: AGCTACAGATGCCCATGC; CXCL12 -Reverse:GGAGTGTTGAGAATTTTGAGATGC.
[0044] The results are as follows Figure 2 As shown, chemokines in HUVEC cells were affected after treatment with different VEGFR inhibitors. CXCL12 The transcriptional levels were significantly upregulated.
[0045] Example 3 To better elucidate the direct effects of CXCL12 on cardiomyocytes, CCC-HEH-2 cardiomyocytes were administered 20 ng / mL and 40 ng / mL of recombinant CXCL12 protein, respectively, and cardiomyocyte viability was assessed using SRB staining. Cardiomyocytes treated with the recombinant protein were then collected for Western blotting to detect the levels of c-PARP and c-Caspase 3 proteins.
[0046] Cardiac cell survival results as follows Figure 3 As shown in Figure A, the survival rate of cardiomyocytes was significantly reduced after administration of recombinant CXCL12 protein.
[0047] Western blotting results are as follows: Figure 3 As shown in Figure B, compared with the control group, CXCL12 significantly upregulated the levels of c-PARP and c-Caspase 3 proteins in cardiomyocytes with increasing concentration.
[0048] The above results suggest that CXCL12 can directly induce cardiomyocyte apoptosis.
[0049] Example 4 We used 6-8 week old ICR / JCL mice as our research subjects and randomly divided them into two groups: a control group and a CXCL12 recombinant protein group. The control group received sterile saline via tail vein injection for 14 days, while the recombinant protein group received CXCL12 recombinant protein at a concentration of 300 ng / mL prepared with sterile saline and administered it via tail vein for 14 consecutive days (30 ng / mouse / day). Echocardiography was used to detect the effect of the recombinant protein on the cardiac function of the mice.
[0050] The heart was dissected and the heart tissue was embedded, sectioned, and stained with hematoxylin and eosin (HE) to examine myocardial damage.
[0051] Echocardiogram results as follows Figure 4 As shown in Figure A, compared with the control group, the cardiac function indicators EF and FS values of mice injected with CXCL12 recombinant protein via the tail vein were significantly reduced.
[0052] HE staining results are as follows Figure 4 As shown in Figure B, the recombinant protein-treated mice exhibited cardiac damage characterized by cytoplasmic swelling, disordered arrangement of cardiomyocytes, and decreased density in the ventricles, while the mice in the saline control group showed no significant changes in their hearts.
[0053] The above results indicate that recombinant CXCL12 protein can directly cause myocardial damage.
[0054] Example 5 In this embodiment, CXCL12 knockdown HUVECs cells were constructed using shRNA (target sequence 5′-CCGTCAGCCTGAGCTACAGAT-3′). After administration of 2.5 μM lenvatinib, the conditioned medium was collected and further applied to CCC-HEH-2 cells. SRB staining was used to detect cell viability.
[0055] Specifically, the pLKO.1 vector was first double-digested with restriction endonucleases EcoRI and AgeI to obtain a single linearized fragment. Then, the designed forward and reverse primers (Forward: 5′-CCGGCCGTCAGCCTGAGCTACAGATCTCGAGATCTGTAGCTCAGGCTGACGGTTTTTG -3′; Reverse: 5′-AATTCAAAAACCGTCAGCCTGAGCTACAGATCTCGAGATCTGTAGCTCAGGCTGACGG C-3′) were annealed in a 50 μL reaction system. Next, the two primers were mixed at a molar ratio of 1:2 to prepare a recombinant reaction system, and the product was transformed into competent cells for screening and identification. Then, the recombinant plasmid was amplified and a large amount was extracted. Using the reagents from the Lipofectamin 3000 transfection kit, the plasmid-transfection reagent complex was added to well-functioning HUVECs cells. After 6 hours of infection, the medium was replaced with fresh medium, and the infection efficiency was verified before proceeding with subsequent experiments.
[0056] The results of knocking down CXCL12 using shRNA are as follows: Figure 5 As shown in A, HUVECs cells CXCL12 The gene was successfully knocked down.
[0057] The results of SRB staining to detect cell viability are as follows: Figure 5 As shown in B, compared to the group transfected with the blank vector, knockdown in HUVECs cells... CXCL12 After administration of lenvatinib, the ability of vascular endothelial cells in conditioned medium to kill cardiomyocytes was significantly reduced.
[0058] The above results suggest that knocking down CXCL12 can reverse the cardiocytic effect of lenvatinib-vascular endothelial cell conditioned medium.
[0059] Example 6 This study used 6-8 week old ICR / JCL mice as the research subjects, and utilized adeno-associated virus (AAV9) knockdown... Cxcl12 A vascular endothelial cell-specific knockdown was constructed. Cxcl12 The mouse model of the gene was divided into four groups: blank virus control group, lenvatinib group, AAV-shCxcl12 group and AAV-shCxcl12+lenvatinib group. After the virus was stabilized for 3 weeks by tail vein injection in the control group, lenvatinib was administered by gavage at a dose of 4 mg / kg for 6 consecutive weeks, and cardiac function was tested.
[0060] Specifically, the promoter is ICAM2p, which specifically targets and knocks down vascular endothelial cells. Cxcl12 The adeno-associated virus (AAV9) (pAAV-ICAM2p-EGFP-MIR155(MCS)-SV40 PolyA) was provided by Jikai Gene Company at a titer of 6.28E+12 v.g / mL. The pre-diluted virus was diluted to the appropriate titer with sterile saline. Using a 1 mL syringe, the diluted virus solution was slowly injected via the tail vein at a volume of 100 μL per mouse. Subsequent experimental procedures were performed after 3 weeks of stabilization.
[0061] The heart was dissected and the heart tissue was embedded, sectioned, and stained with hematoxylin and eosin (HE) to examine myocardial damage.
[0062] Echocardiogram results as follows Figure 6 As shown in A, knock down Cxcl12 The cardiac function parameters EF and FS values of mice subsequently given lenvatinib were significantly upregulated compared with the control group.
[0063] HE staining results are as follows Figure 6 As shown in Figure B, the heart tissue of mice treated with lenvatinib showed cytoplasmic swelling and disordered arrangement, while the knockdown group... Cxcl12 The above-mentioned phenomena were not caused by subsequent administration of lenvatinib.
[0064] The above results indicate that knocking down Cxcl12 It can improve cardiac dysfunction induced by lenvatinib in mice.
[0065] Example 7 This study used 6-8 week old ICR / JCL mice as research subjects, who were randomly divided into 4 groups: control group (IgG), lenvatinib group (IgG + Lenva), CXCL12 neutralizing antibody group, and CXCL12 neutralizing antibody + lenvatinib group. The control group received blank antibody IgG via tail vein injection for 6 weeks (400 ng / mouse / day). The neutralizing antibody group received CXCL12 neutralizing antibody prepared to a concentration of 4 μg / mL with sterile saline and administered via tail vein for 6 consecutive weeks (400 ng / mouse / day). Then, lenvatinib was administered by gavage at a concentration of 4 mg / kg for 6 consecutive weeks, and cardiac function was tested.
[0066] The heart was dissected and the heart tissue was embedded, sectioned, and stained with hematoxylin and eosin (HE) to examine myocardial damage.
[0067] Echocardiogram results as follows Figure 7 As shown in Figure A, the cardiac function indicators EF and FS values of mice given lenvatinib after injection of CXCL12 neutralizing antibody were significantly higher than those of the lenvatinib monotherapy group.
[0068] HE staining results are as follows Figure 7 As shown in Figure B, in heart slices of mice injected with CXCL12 neutralizing antibody and then given lenvatinib, the cytoplasmic swelling and disordered arrangement of cardiac tissue cells were reduced compared to the lenvatinib monotherapy group.
[0069] like Figure 7 As shown in Figure C, the injection of CXCL12 neutralizing antibody itself does not affect the weight of mice.
[0070] The above results indicate that administration of neutralizing antibodies can alleviate cardiac dysfunction and myocardial damage induced by lenvatinib in mice, and has a high safety profile.
[0071] The above description is merely a specific embodiment of the present invention, intended to enable those skilled in the art to understand the content of the present invention and implement it accordingly, and should not be construed as limiting the scope of protection of the present invention. All equivalent modifications or substitutions made based on the essence of the present invention should be covered within the scope of protection of the present invention.
Claims
1. Targeted inhibition CXCL12 The use of a substance containing the gene or CXCL12 protein in the preparation of a drug for treating cardiotoxicity caused by VEGFR inhibitors, characterized in that... The cardiotoxicity is caused by VEGFR inhibitors leading to vascular endothelial cells... CXCL12 Increased transcription levels lead to the release of CXCL12.
2. The application as described in claim 1, characterized in that, The VEGFR inhibitor is lenvatinib, axitinib, anlotinib, sorafenib, or regorafenib.
3. The application as described in claim 1 or 2, characterized in that, The cardiotoxicity is manifested by at least one of the following: cardiomyocyte apoptosis, decreased cardiac function indicators EF and FS values, ventricular cytoplasmic swelling, cardiomyocyte disorder, and decreased compactness.
4. The application as described in claim 1, characterized in that, The substance is used to downregulate vascular endothelial cells. CXCL12 siRNA or shRNA that expresses the gene or accumulates the CXCL12 protein.
5. The application as described in claim 4, characterized in that, The target sequence of the siRNA or shRNA is 5′-CCGTCAGCCTGAGCTACAGAT-3′ or 5′-TGTGCATTGACCCGAAATTAA-3′.
6. The application as described in claim 4, characterized in that, The drug includes an adenovirus vector system.
7. The application as described in claim 1, characterized in that, The substance is a CXCL12 neutralizing antibody that inhibits the activity of the CXCL12 protein.
8. A combination antitumor drug composition, characterized in that, The pharmaceutical composition comprises a first formulation consisting of lenvatinib and a pharmaceutically acceptable carrier, and a second formulation consisting of a CXCL12 neutralizing antibody and a pharmaceutically acceptable carrier.
9. The pharmaceutical composition according to claim 8, characterized in that, The first formulation is an oral dosage form, and the second formulation is an intravenous injection dosage form.
10. The use of the pharmaceutical composition according to claim 8 or 9 in the preparation of a medicament for treating solid tumors, characterized in that, The solid tumors include: hepatocellular carcinoma, thyroid carcinoma, and renal cell carcinoma.