Silarge3 gene related to millet yield and application thereof
By editing or suppressing the SiLARGE3 gene, the gap in millet yield regulation was filled, resulting in a significant increase in grain size and number of grains per spike, thereby improving millet yield and providing a new breeding method.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
- Filing Date
- 2026-03-08
- Publication Date
- 2026-06-05
AI Technical Summary
In the current technology, research on millet genetic improvement and yield is lagging behind. The function of the SiLARGE3 gene in regulating grain size and number of grains per ear is not clear, making it difficult to meet the needs of modern large-scale agriculture.
By reducing or inhibiting the expression or protein activity of the SiLARGE3 gene, editing the SiLARGE3 gene using CRISPR/Cas9 technology, or inhibiting its expression using RNA interference technology, we can obtain SiLARGE3 functionally weakened or lost mutants, which synergistically increase grain width, grain length, thousand-grain weight, and number of grains per ear.
It significantly increases millet yield, with improved grain size and number of grains per spike, resulting in a yield increase of 25.0%-30.7%, providing new gene targets and operational methods for high-yield millet breeding.
Smart Images

Figure CN122146714A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering and genetic breeding, specifically relating to a SiLARGE3 gene related to millet yield, its encoded protein, and its application in increasing millet yield. Background Technology
[0002] Millet ( Setaria italica Originating in China, millet is a traditional specialty crop domesticated from foxtail grass and is also a newly emerging model plant of the C4 Poaceae family. As the "king of grains," millet has outstanding characteristics such as drought resistance, tolerance to poor soil, balanced nutrition, and dual use as grain and forage. It plays an irreplaceable role in ensuring food security in arid and semi-arid regions, enriching the dietary structure of residents, and promoting the green and circular development of agriculture.
[0003] However, compared with staple crops such as rice, wheat, and corn, research on the genetic improvement and yield of millet has long lagged behind. Since the 1980s, affected by factors such as low yield per unit area and insufficient mechanization, the planting area of millet in my country has shrunk from nearly 130 million mu to less than 10 million mu. Although traditional high-quality varieties have excellent taste, they generally suffer from poor disease resistance, weak lodging resistance, and reliance on manual thinning and weeding, making them difficult to adapt to the production needs of modern large-scale and mechanized agriculture. In the past half-century, the grain yield of staple crops has increased by about 4-8 times, while the breeding progress and genetic basis research of millet and other miscellaneous grains have lagged behind, and the molecular mechanisms of their high and stable yields are still unclear.
[0004] Grain size and number of grains per spike are core traits that constitute millet yield and directly determine the final yield level. In recent years, some yield-related genes have been discovered in millet, such as SGD1, SiMADS34, and SiGW3, but these genes mainly affect yield by regulating single traits such as spike development or grain weight.
[0005] SiLARGE3 is a histone-binding protein located in the cell nucleus, containing a nuclear localization signal (NLS), a PWWP domain, and an LXXLL motif. However, its function in regulating millet yield remains a mystery. Currently, there are no reports on the function of the SiLARGE3 gene in regulating millet grain size and number of grains per spike, nor are there any applied studies on its ability to increase yield through mutation. Therefore, elucidating the function of the SiLARGE3 gene in regulating millet yield will not only enrich our theoretical understanding of the molecular mechanisms of high-yield millet but also provide new gene targets for high-yield millet breeding, possessing significant theoretical and applied value. Summary of the Invention The purpose of this invention is to provide a SiLARGE3 gene related to millet yield, its encoded protein, and its applications.
[0006] This invention reveals for the first time that the SiLARGE3 gene is a negative regulator of millet yield. By reducing or inhibiting the expression or protein activity of the SiLARGE3 gene, grain width, grain length, and thousand-grain weight can be synergistically increased, while the number of secondary branches and grains per spike can be significantly increased, ultimately resulting in a significant increase in millet yield.
[0007] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides an isolated DNA molecule, said DNA molecule being selected from any one of the following: (1) The genomic DNA sequence of the SiLARGE3 gene, the nucleotide sequence of which is shown in SEQ ID NO.1; wherein SEQ ID NO.1 contains a 5'UTR, a coding region (CDS) and a 3'UTR; (2) The promoter sequence of the SiLARGE3 gene, the nucleotide sequence of which is shown in SEQ ID NO.2; (3) The coding sequence (CDS) of the SiLARGE3 gene, the nucleotide sequence of which is shown in SEQ ID NO.3.
[0008] Secondly, the present invention provides a protein, namely SiLARGE3 protein, the amino acid sequence of which is shown in SEQ ID NO.4, and the protein is encoded by the nucleotide sequence shown in SEQ ID NO.3. Bioinformatics analysis shows that the SiLARGE3 protein contains a nuclear localization signal (NLS), a PWWP domain, and an LXXLL motif.
[0009] Thirdly, the present invention provides variant sequences associated with the DNA molecule described in the first aspect, the variant sequences being selected from: (1) A nucleotide sequence that has at least 90% sequence identity with the nucleotide sequence shown in SEQ ID NO.3 and encodes a protein that has the function of regulating millet yield-related traits; (2) A nucleotide sequence that has at least 90% sequence identity with the promoter sequence shown in SEQ ID NO.2 and has promoter activity; (3) A nucleotide sequence that hybridizes with the nucleotide sequence shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3 under strict conditions.
[0010] Fourthly, the present invention provides a functionally weakened or lost mutant of the SiLARGE3 gene, said mutant being obtained by mutating the DNA molecule described in the first aspect or the variant sequence described in the third aspect, said mutation resulting in reduced or lost expression or function of the SiLARGE3 gene or its homologs.
[0011] Fifthly, according to the mutant described in the fourth aspect, compared with wild-type millet, the mutant has one or more of the following traits: increased grain size, increased number of grains per ear, and increased yield.
[0012] In a sixth aspect, the present invention provides a gene editing vector for creating mutants as described in the fourth or fifth aspect, the vector comprising a gRNA expression cassette targeting the SiLARGE3 locus; the SiLARGE3 locus comprising the genomic DNA sequence, promoter sequence, or coding sequence described in the first aspect.
[0013] In a seventh aspect, the present invention provides the application of the DNA molecule described in the first aspect, the protein described in the second aspect, the variant sequence described in the third aspect, the mutant described in the fourth or fifth aspect, or the gene editing vector described in the sixth aspect in regulating millet yield-related traits, wherein the yield-related traits include one or more of grain size, number of grains per ear, and yield.
[0014] Eighthly, the present invention provides a method for obtaining millet material with weakened or lost SiLARGE3 gene function, wherein the method is selected from any of the following: (1) Transgenic millet plants were obtained by editing the SiLARGE3 locus using gene editing technology; (2) The expression of the SiLARGE3 gene was suppressed by RNA interference technology to obtain millet plants with reduced expression; (3) Screening for natural mutants of the SiLARGE3 gene; (4) Obtain SiLARGE3 gene mutants from the mutant library.
[0015] Ninth aspect, according to the method of the eighth aspect, the gene editing technology is selected from at least one of CRISPR / Cas9, TALEN, and ZFN; the gene editing is achieved by a vector containing a gRNA expression cassette targeting the SiLARGE3 locus, the vector being introduced into millet cells by a plant genetic transformation method.
[0016] In a tenth aspect, the present invention provides a method for improving millet yield-related traits, comprising the following steps: (1) Obtain millet materials with weakened or lost SiLARGE3 gene function by using the method described in the eighth or ninth aspect; (2) Using the millet material obtained in step (1), millet plants with increased grain size, increased number of grains per ear and / or increased yield are cultivated through self-pollination or hybridization breeding methods.
[0017] To clearly define this invention, the following terms are defined: The SiLARGE3 locus refers to the region containing the coding region of the SiLARGE3 gene, its upstream regulatory regions (including the 5'UTR region and promoter region), and its downstream regulatory region (3'UTR region). Editing of this locus includes editing the coding region (leading to loss or weakening of protein function), editing the promoter region (leading to reduced gene expression), and editing other regulatory elements.
[0018] Attenuated or lost-function mutants: These are mutants in which the expression level of the SiLARGE3 gene is reduced, or the activity of its encoded protein is reduced or lost, compared to the wild type. The mutations include nucleotide deletions, insertions, or substitutions.
[0019] Millet material: refers to millet plants, seeds, tissues, cells and their progeny. The material can be wild-type or mutant material carrying a weakened or lost-function mutation of the SiLARGE3 gene.
[0020] Wild type: refers to millet materials with normal SiLARGE3 gene function, whose genotype is SiLARGE3 / SiLARGE3.
[0021] Yield: refers to the economic yield of millet, including but not limited to commonly used yield measures in this field such as ear weight, yield per plant, plot yield, and yield per acre. Increased yield is manifested as a significant improvement in one or more yield-related traits compared to the wild type.
[0022] Yield-related traits include, but are not limited to, grain size, number of grains per ear, and yield. Grain size includes grain width, grain length, and thousand-grain weight.
[0023] Grain size: refers to the dimensions of millet grains, including but not limited to grain length, grain width, and thousand-grain weight. Increased grain size is manifested as a significant increase in grain length, grain width, and / or thousand-grain weight compared to the wild type.
[0024] Grain number per ear: refers to the number of grains produced in a single ear of grain. An increase in grain number per ear is manifested as a significant increase in the number of grains per ear compared to the wild type.
[0025] Plant genetic transformation methods refer to methods for introducing exogenous nucleic acids into plant cells, including but not limited to Agrobacterium-mediated transformation, gene gun transformation, PEG-mediated transformation, electroporation transformation, pollen tube pathway transformation, and other transformation techniques commonly used in the field. Those skilled in the art can select appropriate transformation methods based on the type of recipient material.
[0026] RNA interference refers to the sequence-specific inhibition of gene expression induced by double-stranded RNA molecules. Methods of achieving RNA interference include, but are not limited to, small interfering RNA (siRNA) and short hairpin RNA (shRNA). Beneficial effects
[0027] Compared with the prior art, the present invention has the following beneficial effects: (1) The new function of the SiLARGE3 gene was revealed for the first time: SiLARGE3 was found to be a negative regulator of millet yield, filling the research gap in the field of millet yield regulation.
[0028] (2) Synergistic improvement of multiple yield traits: Compared with the wild type, the SiLARGE3 gene mutants (silarge3-1, silarge3-2) showed a significant increase in grain width, grain length and thousand-grain weight, while the number of secondary branches and the number of grains per ear were also significantly increased, ultimately resulting in a 25.0%-30.7% increase in millet yield.
[0029] (3) Clear application value: This invention provides new gene targets and operation methods for high-yield millet breeding, which can be used to create new high-yield millet germplasm, and has important theoretical and practical significance for the genetic improvement and molecular breeding of millet.
[0030] In Example 5 of this invention, two homozygous mutants (silarge3-1 and silarge3-2) obtained using CRISPR / Cas9 technology both underwent frameshift mutations, resulting in complete loss of SiLARGE3 protein function. Phenotypic analysis confirmed a significant increase in yield. Based on the following reasons, those skilled in the art can reasonably expect that reduced (rather than complete) function of the SiLARGE3 gene can also lead to increased millet yield: (1) Dosage effect principle: In biology, the expression level of many genes is dose-dependent on phenotype. As a negative regulator, the reduction of SiLARGE3 expression level (even if not completely lost) will partially relieve the inhibition of yield traits, thereby producing a yield-increasing effect.
[0031] (2) Cumulative effect of partial loss of function: Improvement of multiple yield-related traits (grain size, number of grains per ear) is often the cumulative result of the minor effects of multiple genes. Any degree of weakening of the SiLARGE3 gene function may have a positive contribution to these traits.
[0032] (3) Current technical consensus: In plant gene function research, partial inhibition (knock-down) and complete knock-out of gene expression achieved by techniques such as RNA interference often show similar phenotypic trends, only the degree may be different.
[0033] Therefore, the "functionally weakened or lost mutants" and their applications protected by this invention cover all cases from partial functional inhibition to complete functional loss, all of which fall within the reasonable scope of protection of this invention. Attached Figure Description
[0034] Figure 1 The diagram shows the structure of the SiLARGE3 gene and its encoded protein. (a) shows the gene structure of SiLARGE3, including the mutation locations of the mutants silarge3-1 and silarge3-2. (b) shows the protein structure of SiLARGE3, including the NLS, PWWP, and LXXLL domains of the wild-type protein, as well as the truncated and aberrant sequences caused by frameshifts in the silarge3-1 and silarge3-2 mutants.
[0035] Figure 2 This section presents a comparison of yield-related phenotypes between the millet mutants silarge3-1 and silarge3-2 and the wild type (Ci846). Specifically: (a) is a comparison of seeds between the wild type and the mutants silarge3-1 and silarge3-2 (scale bar = 1 mm); (b) to (d) are statistical graphs showing the measurement results of grain length (b), grain width (c), and thousand-grain weight (d) of seeds between the wild type and the mutants silarge3-1 and silarge3-2, respectively. Data are expressed as mean ± standard deviation. Grain length and width n=30 (30 seeds were randomly selected from each genotype for measurement), and thousand-grain weight n=3. Student's t-test was used for significance analysis; (e) is a comparison of panicles between the wild type and the mutants silarge3-1 and silarge3-2 (scale bar = 5 cm); (f) is a comparison of the lower primary branches of the panicle between the wild type and the mutants silarge3-1 and silarge3-2 (scale bar = 2 cm). (cm); (g) to (n) are statistical graphs of the results of ear length (g), length of primary branches (h), number of primary branches (i), number of secondary branches (j), ear width (k), number of grains per ear (l), ear weight (m), and plot yield (n) of wild type and mutant silarge3-1 and silarge3-2, respectively. The data are expressed as mean ± standard deviation. Ear traits (g, km, n=7; h, n=10; ij, n = 5) (plants were randomly selected for each genotype for measurement), and plot yield (n) n=3 (3 replicate plots were set up). Student's t-test was used for significance analysis. Detailed Implementation
[0036] The present invention will be further described below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions as described in Molecular Cloning: A Laboratory Manual, or as recommended by the manufacturer.
[0037] Experimental Materials: The wild-type millet varieties Yugu 1 and Ci846 used in this invention were provided by the Institute of Crop Science, Chinese Academy of Agricultural Sciences. Yugu 1 was used for cloning and sequence analysis of the SiLARGE3 gene, while Ci846 was used for genetic transformation and mutant creation. The mutants silarge3-1 and silarge3-2 were created collaboratively by the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, and the Institute of Crop Science, Chinese Academy of Agricultural Sciences, using Ci846 as a background and obtained through CRISPR / Cas9 technology. They are preserved by the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. The genotypes of each material are as follows: Ci846 is SiLARGE3 / SiLARGE3, Yugu 1 is SiLARGE3 / SiLARGE3, mutant silarge3-1 is silarge3-1 / silarge3-1, and mutant silarge3-2 is silarge3-2 / silarge3-2.
[0038] This invention provides four sequences, which are composed as follows: SEQ ID NO.1: Genomic DNA sequence of the SiLARGE3 gene, containing a 5'UTR, a coding region and a 3'UTR, with a length of 4285 bp; SEQ ID NO.2: Promoter sequence of the SiLARGE3 gene, 2000 bp in length (2000 bp upstream of the start codon); SEQ ID NO.3: The coding sequence (CDS) of the SiLARGE3 gene, with a length of 2154 bp; SEQ ID NO.4: The amino acid sequence of the SiLARGE3 protein, encoded by SEQ ID NO.3, contains 717 amino acids.
[0039] Example 1: Cloning and Sequence Analysis of the SiLARGE3 Gene Genomic DNA was extracted from leaves of the millet variety Yugu No. 1 using the CTAB method. Specific primers were designed based on information from the millet genome database, and the full-length genome sequence of the SiLARGE3 gene and its upstream promoter region were obtained by PCR amplification. The PCR product was ligated into the pGEM-T vector (purchased from Promega), transformed into E. coli DH5α, and positive clones were selected for sequencing verification.
[0040] Sequencing results showed that the genomic DNA sequence of the SiLARGE3 gene was 4285 bp in length, containing a 5'UTR, a coding region, and a 3'UTR, as shown in SEQ ID NO.1; its promoter sequence (2000 bp upstream of the start codon) was shown in SEQ ID NO.2; its coding region (CDS) sequence was 2154 bp in length, as shown in SEQ ID NO.3; and the encoded protein contained 717 amino acids, the amino acid sequence of which was shown in SEQ ID NO.4.
[0041] Bioinformatics analysis showed that the SiLARGE3 protein is located in the cell nucleus and contains a nuclear localization signal (NLS), a PWWP domain, and an LXXLL motif. Its gene structure is as follows: Figure 1 As shown in a, the protein structure is as follows: Figure 1 As shown in b.
[0042] Example 2: Construction of SiLARGE3 gene CRISPR / Cas9 knockout vector A specific gRNA target was designed targeting the CDS region (SEQ ID NO.3) of the SiLARGE3 gene, with the target sequence being AGAAGACACAGACTGAAGGG. Primers were designed based on the target sequence. gRT#+:5'-AGAAGACACAGACTGAAGGGgttttagagctagaaat-3' OsU6aT#-:5'-CCCTTCAGTCTGTGTCTTCTcggcagccaagccagca-3' Universal primers: UF: 5'-CTCCGTTTTACCTGTGGAATCG-3' gR-R: 5'-CGGAGGAAAATTCCATCCAC-3' U-GAL: 5'-ACCGGTAAGGCGCGCCGTAGTGCTCGACTAGTATGGAATCGGCAGCAAAGG-3' Pgs-GAR: 5'-TAGCTCGAGAGGCGCGCCAATGATACCGACGCGTATCCATCCACTCCAAGTCTTG-3' Using the OsU6a plasmid as a template, a first round of PCR amplification was performed using a four-primer method with primers UF, gR-R, gRT#+, and OsU6aT#-. The diluted first-round PCR product was then used as a template for a second round of PCR amplification using U-GAL and Pgs-GAR primers, yielding a product fragment of approximately 700 bp, which was then purified for later use.
[0043] The pYLCRISPR / Cas9-MH vector was digested with Bsa I-HF, and the linearized vector fragment was recovered. The purified PCR product fragment was mixed with the linearized vector, ligated with infusion enzyme, and transformed into E. coli DH5α. Single-colony PCR was performed using U-GAL and Pgs-GAR primers for identification. Positive clones were verified by sequencing, and the correct CRISPR / Cas9 knockout vector was obtained and named pYLCRISPR / Cas9-SiLARGE3.
[0044] Example 3: Genetic transformation of millet and acquisition of transgenic plants The constructed pYLCRISPR / Cas9-SiLARGE3 vector was transformed into Agrobacterium tumefaciens strain EHA105 using the freeze-thaw method for millet genetic transformation. The specific steps are as follows: (1) Callus preparation: Mature seeds of millet variety Ci846 were sterilized and placed on induction medium, and cultured in the dark at 25℃ for 1 month to induce callus. The resulting embryogenic callus was subcultured once and used as a transformation recipient.
[0045] (2) Agrobacterium culture and infection: Agrobacterium strain EHA105 containing the target vector was inoculated into LB liquid medium containing the corresponding antibiotic and cultured at 28°C with shaking until OD600 = 0.5-1.0. An appropriate amount of bacterial suspension was centrifuged, resuspended in co-culture medium, and mixed with the prepared callus for infection for 5 minutes. Excess bacterial suspension was blotted dry with sterile filter paper, and the callus was transferred to co-culture medium and cultured in the dark at 22°C for 3 days.
[0046] (3) Screening of resistant callus: The co-cultured callus tissue was transferred to a screening medium containing screening agent and screened in the dark at 25°C. The culture was repeated every 2 weeks for a total of 3 rounds to obtain resistant callus tissue.
[0047] (4) Plant regeneration and rooting: The resistant callus tissue was transferred to the regeneration medium and cultured under light to induce seedling emergence. When the seedlings grew to 2-3 cm, they were transferred to the rooting medium for rooting culture.
[0048] (5) Hardening and transplanting: After hardening the seedlings with good roots, transplant them into nutrient soil and cultivate them in a greenhouse to obtain T0 generation transgenic plants.
[0049] Example 4: Molecular identification of mutant plants and acquisition of homozygous lines Genomic DNA was extracted from leaves of T0 generation transgenic plants. Specific primers JD-F and JD-R (sequences shown below) were designed to cross the gRNA target site for PCR amplification and sequencing analysis. The results showed that two heterozygous mutant plants with editing at the target site were obtained. Seeds were harvested to obtain T1 generation seeds. Genomic DNA was extracted from the leaves of each individual plant after further sowing for genotyping, and homozygous mutant plants were screened. These were named silarge3-1 and silarge3-2, respectively. The silarge3-1 mutant has a 1 bp deletion (deletion sequence A) at position 330 of the SiLARGE3 gene CDS sequence, resulting in a frameshift that shortens the encoded protein from the normal 717 amino acids to 160 amino acids. The silarge3-2 mutant involves a 61 bp deletion at position 271 of the SiLARGE3 gene CDS sequence (deleted sequence: GATGAATGTATACAAAAAGCAAAGGCTCTAGCTCGCCATCAAAAGAAGACACAGACTGAAG), resulting in a frameshift that shortens the encoded protein from the normal 717 amino acids to 140 amino acids. The mutation sites and resulting protein structural changes in the two homozygous mutants are shown below. Figure 1 As shown.
[0050] JD-F: 5'-CTTTAACTTCTAAAGCGAGTGC-3' JD-R: 5'-TGGACAAATCATAGCCAAAGC-3' Example 5: Investigation of yield traits in mutant plants Wild-type Ci846, mutants silarge3-1 and silarge3-2 were simultaneously planted in the experimental field using a randomized block design with three replicates. The following yield-related traits were assessed at maturity: grain length, grain width, 1000-grain weight, ear length, length of primary branches at the base of the ear, number of primary branches, number of secondary branches, ear width, number of grains per ear, ear weight, and plot yield.
[0051] Statistical analysis: All data are expressed as mean ± standard deviation. Grain traits (grain length, grain width) were measured using 30 randomly selected seeds per genotype (n=30); grain traits (thousand-grain weight) were measured in 3 biological replicates per genotype (n=3); ear traits included ear length (n=7), length of primary branches at the base of the ear (n=10), number of primary branches (n=5), number of secondary branches (n=5), ear width (n=7), number of grains per ear (n=7), and ear weight (n=7); plot yield was measured in 3 replicate plots (n=3). Student's t-test was used for significance analysis, and p-values are marked in the figures.
[0052] result: Grain characteristics ( Figure 2 (ad) Compared with the wild type, the grains of mutants silarge3-1 and silarge3-2 were significantly larger. Specifically, the grain length of the silarge3-1 mutant increased by 7.59%, the grain width increased by 3.11%, and the thousand-grain weight increased by 3.03%; while the grain length of the silarge3-2 mutant increased by 3.16%, the grain width increased by 2.55%, and the thousand-grain weight increased by 2.61%, with the differences reaching a significant level.
[0053] ear characteristics ( Figure 2 (el): Compared with the wild type, the ear structure of the mutants was significantly improved. Specifically, the silarge3-1 mutant showed an increase of 96.12% in the length of the primary branches at the base of the ear, 73.08% in the number of secondary branches, 38.26% in ear width, 24.83% in the number of grains per ear, and 25.8% in ear weight; while the silarge3-2 mutant showed a significant increase of 66.05% in the length of the primary branches at the base of the ear, 61.54% in the number of secondary branches, 21.85% in ear width, 19.70% in the number of grains per ear, and 22.39% in ear weight.
[0054] Yield traits ( Figure 2 mn): Compared with the wild type, the yield of the mutant silarge3-1 increased by 25.04%; the yield of the mutant silarge3-2 increased by 30.72%, and the difference was statistically significant.
[0055] The above results indicate that the SiLARGE3 gene is a negative regulator of millet yield, and knocking out this gene can significantly increase the grain size, number of grains per spike, and final yield of millet. Implementation
[0056] Based on the findings of this invention, those skilled in the art will understand that, in addition to the CRISPR / Cas9 gene editing technology specifically verified in Examples 2-3, other methods can be used to obtain millet materials with weakened or lost SiLARGE3 gene function. For example: Promoter region editing: Promoters are key regulatory elements of gene expression. By mutating or modifying the cis-acting elements in the promoter region of the SiLARGE3 gene, the transcriptional activity of the gene can be effectively altered. Based on the function of the SiLARGE3 gene in negatively regulating yield, as revealed for the first time in this invention, those skilled in the art are motivated to use promoter editing strategies to downregulate the expression of this gene and obtain yield-increasing effects similar to those achieved through coding region editing.
[0057] Utilization of Homologous Genes: This invention experimentally demonstrates that loss of function of the SiLARGE3 gene can significantly increase millet yield. Bioinformatics analysis shows that the SiLARGE3 protein contains nuclear localization signals (NLS), PWWP domains, and LXXLL motifs (such as...). Figure 1 (As shown in b). The two independent mutants, silarge3-1 and silarge3-2, obtained in Example 5 both experienced premature protein termination due to frameshift mutations, disrupting not only the PWWP domain but also completely losing the NLS and LXXLL motifs. This confirms the crucial importance of these functional regions for the function of the SiLARGE3 protein. Based on this, those skilled in the art can reasonably expect that homologous genes with high sequence identity (e.g., over 90%) to SEQ ID NO.3 and encoding proteins containing one or more of the aforementioned key functional regions are likely to possess biological functions similar to the SiLARGE3 gene. Therefore, by performing function-weakening or loss-of-function mutations on these homologous genes (especially disrupting their key functional regions), it is also possible to increase millet yield.
[0058] Functional equivalence of promoter variants: In this invention, the promoter sequence shown in SEQ ID NO.2 is the natural promoter of the SiLARGE3 gene. For the promoter variants described in claim 3(2), those skilled in the art will understand that sequences having at least 90% sequence identity with SEQ ID NO.2 and retaining key cis-acting elements can be reasonably expected to have similar promoter activity and be able to drive the transcription of downstream genes.
[0059] Explanation of the functional equivalence of genomic sequence variants: For the variant sequences hybridized under stringent conditions as described in claim 3(3), those highly similar to the genomic sequence shown in SEQ ID NO.1 (including the 5'UTR, coding region, and 3'UTR) are included. Those skilled in the art will understand that sequences hybridized to SEQ ID NO.1 under stringent hybridization conditions typically exhibit over 80-90% overall homology. Although hybridization is primarily driven by the overall sequence, due to the large proportion and high conserved nature of the coding region (SEQ ID NO.3) in SEQ ID NO.1, the coding region of such hybridized sequences is likely to be highly homologous to SEQ ID NO.3, and it is reasonable to expect that the encoded proteins retain key functional regions of SiLARGE3 (such as the PWWP domain, NLS, and LXXLL motifs). Therefore, increasing millet yield is also possible through functional attenuation or loss-of-function mutations in these homologous genes (especially those disrupting their key functional regions).
[0060] RNA interference technology: Specific RNA interference fragments are designed targeting the coding sequence of the SiLARGE3 gene, and RNA interference vectors are constructed and introduced into millet cells through plant genetic transformation methods. This can effectively reduce the expression level of the SiLARGE3 gene, and is expected to achieve a yield increase similar to that of gene-edited mutants.
[0061] Plant genetic transformation methods: There are various methods for introducing exogenous nucleic acids into millet cells. Besides the Agrobacterium-mediated transformation method specifically used in Example 3, other methods include, but are not limited to, gene gun methods, PEG-mediated methods, electroporation methods, pollen tube pathway methods, and other conventional transformation techniques used in the art. Those skilled in the art can select appropriate transformation methods to introduce gene editing vectors or RNA interference vectors into millet cells based on the type of recipient material, experimental conditions, and equipment available, thereby achieving the editing or inhibition of the SiLARGE3 gene. These different transformation methods are all equivalent embodiments of the present invention.
[0062] Natural mutant screening and mutant library utilization: By screening millet germplasm resources, natural mutants of the SiLARGE3 gene can be discovered; or mutant materials of the SiLARGE3 gene can be obtained from existing millet mutant libraries, which is also a convenient way to obtain target materials.
[0063] Furthermore, millet materials with weakened or lost SiLARGE3 gene function obtained using this invention (whether obtained through gene editing, promoter editing, RNA interference, natural mutation, or mutant library) can be transferred to other superior millet varieties using conventional breeding methods (such as self-pollination, hybridization, backcrossing, etc.) to cultivate new varieties with larger grains, increased number of grains per ear, and improved yield. These embodiments are all within the scope of protection of this invention.
Claims
1. An isolated DNA molecule, characterized in that, The DNA molecule is selected from any of the following groups: (1) The genomic DNA sequence of the SiLARGE3 gene, the nucleotide sequence of which is shown in SEQ ID NO.1; (2) The promoter sequence of the SiLARGE3 gene, the nucleotide sequence of which is shown in SEQ ID NO.2; (3) The coding sequence of the SiLARGE3 gene, the nucleotide sequence of which is shown in SEQ ID NO.
3.
2. A protein, characterized in that, The protein in question is SiLARGE3, and its amino acid sequence is shown in SEQ ID NO.
4.
3. A variant sequence associated with the DNA molecule of claim 1, characterized in that, The variant sequence is selected from: (1) A nucleotide sequence that has at least 90% sequence identity with the nucleotide sequence shown in SEQ ID NO.3 and encodes a protein that has the function of regulating millet yield-related traits; (2) A nucleotide sequence that has at least 90% sequence identity with the promoter sequence shown in SEQ ID NO.2 and has promoter activity; (3) A nucleotide sequence that hybridizes with the nucleotide sequence shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3 under strict conditions.
4. A SiLARGE3 gene mutant with weakened or lost function, characterized in that, The mutant is obtained by mutating the DNA molecule of claim 1 or the variant sequence of claim 3, the mutation resulting in a decrease or loss of expression or function of the SiLARGE3 gene or its homolog.
5. The mutant according to claim 4, characterized in that, Compared to wild-type millet, the mutant possesses one or more of the following traits: (1) The size of the seeds increases; (2) The number of grains per ear increases; (3) Increased production.
6. A gene editing vector for creating the mutant of claim 4 or 5, characterized in that, The vector contains a gRNA expression cassette targeting the SiLARGE3 locus; the SiLARGE3 locus includes the genomic DNA sequence, promoter sequence, or coding sequence as described in claim 1.
7. The application of the DNA molecule of claim 1, the protein of claim 2, the variant sequence of claim 3, the mutant of claim 4 or 5, or the gene editing vector of claim 6 in regulating millet yield-related traits, wherein the yield-related traits include one or more of grain size, number of grains per spike, and yield.
8. A method for obtaining millet materials with weakened or lost SiLARGE3 gene function, characterized in that, The method is selected from any of the following: (1) Transgenic millet plants were obtained by editing the SiLARGE3 locus using gene editing technology; (2) The expression of the SiLARGE3 gene was suppressed by RNA interference technology to obtain millet plants with reduced expression; (3) Screening for natural mutants of the SiLARGE3 gene; (4) Obtain SiLARGE3 gene mutants from the mutant library.
9. The method according to claim 8, characterized in that, The gene editing technology is selected from at least one of CRISPR / Cas9, TALEN, and ZFN; the gene editing is achieved by a vector containing a gRNA expression cassette targeting the SiLARGE3 locus, and the vector is transformed into millet cells by a plant genetic transformation method.
10. A method for improving millet yield-related traits, characterized in that, Includes the following steps: (1) Obtain millet material with weakened or lost SiLARGE3 gene function by means of the method described in claim 8 or 9; (2) Using the millet material obtained in step (1), millet plants with increased grain size, increased number of grains per ear and / or increased yield are cultivated through self-pollination or hybridization breeding methods.