Application of tobacco chloroplast psbY gene or its coded protein in regulating tobacco abortion
By overexpressing the psbY gene in tobacco, resulting in shortened filaments and inability to pollinate, the problem of insufficient gene regulation in tobacco male sterility research has been solved, enabling the breeding application of male sterility and promoting the development of tobacco breeding.
Patent Information
- Application Number
- CN202610020841.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-08
- Publication Date
- 2026-06-05
AI Technical Summary
In tobacco male sterility research, existing technologies lack effective gene regulation methods, resulting in slow research progress and failing to meet the needs of heterosis utilization and variety improvement.
By overexpressing the psbY gene in tobacco chloroplasts, the filaments are shortened and the stigma is higher than the anther, preventing normal pollination and thus causing male sterility in tobacco. The psbY gene was overexpressed in tobacco using Agrobacterium-mediated genetic transformation to create a male-sterile line.
This study achieved the regulation of male sterility in tobacco, opening up new prospects for tobacco breeding, providing important theoretical and practical value, and demonstrating the role of the psbY gene in regulating male sterility in tobacco.
Smart Images

Figure CN122146749A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the application of a tobacco chloroplast psbY gene or its encoded protein in regulating tobacco abortion. Background Technology
[0002] Male sterility in plants is a phenomenon during sexual reproduction where, due to physiological or genetic reasons, the female organs are normal while the male organs develop abnormally, leading to sterility. This includes shortened filaments, malformed anthers, absence of pollen, or empty or shriveled pollen grains. Male-sterile lines are the core of hybridization breeding and are crucial germplasm resources for improving the efficiency of heterosis utilization in crops, achieving breakthrough new variety development, and increasing yield. This phenomenon of male sterility enables the commercial mass production of self-pollinating crops and the efficient hybridization of cross-pollinating crops, eliminating the labor-intensive task of manual emasculation, thus saving labor costs and improving seed purity and quality. Creating and discovering nuclear male-sterile mutants in plants is of great significance for improving the efficiency of heterosis utilization in plants.
[0003] Tobacco plays a vital role in agricultural production and scientific research, and most of the flue-cured tobacco currently cultivated is hybrid varieties and sterile lines. However, the cytoplasmic source of sterile lines is singular, and long-term use of the same type of cytoplasmic sterility can lead to a weak genetic base in tobacco. Therefore, research on the mechanism of tobacco sterility is particularly important. Since the discovery of male sterility in tobacco, research on it has been continuous. Since the 18th century, when the German scholar Koelreuter discovered heterosis in interspecific hybridization of tobacco, the emergence of male-sterile lines eliminated the need for artificial emasculation, opening up new prospects for the utilization of heterosis in tobacco. Subsequently, research on tobacco male sterility has received widespread attention.
[0004] Early research on the mechanisms of male sterility in tobacco, both domestically and internationally, focused primarily on cell morphology and physiological and biochemical aspects. In recent years, preliminary explorations have also been conducted in molecular biology, with studies on genes such as COXII, ORF25, ATP6, NAD7, and ORFB in male-sterile tobacco. The DNA sequences (or mRNA sequences) of these genes show certain differences between sterile and maintainer lines, and all may be related to the formation of male-sterile tobacco lines. However, compared to the hundreds or even thousands of male sterility regulatory genes identified in Arabidopsis, rice, maize, and rapeseed, research on the mechanisms of male sterility in tobacco is relatively lagging, with fewer cloned and identified genes, far from meeting the needs of tobacco research on male sterility. Summary of the Invention
[0005] The purpose of this invention is to address the aforementioned problems in the existing technology and proposes an application of the tobacco chloroplast psbY gene or its encoded protein in regulating tobacco male sterility. This invention induces tobacco male sterility by overexpressing the psbY gene, resulting in shortened filaments and stigmas that are significantly higher than the anthers, preventing normal pollination. This has significant theoretical and practical value for research on tobacco male sterility.
[0006] The technical solution of this invention is:
[0007] This invention provides the application of the tobacco chloroplast psbY gene or tobacco chloroplast protein psbY in regulating tobacco abortion.
[0008] Furthermore, the application refers to the use of the tobacco chloroplast psbY gene or tobacco chloroplast protein psbY in regulating male sterility in tobacco.
[0009] Furthermore, the application involves overexpressing the psbY gene, which causes tobacco filaments to shorten, preventing normal pollination and leading to tobacco sterility.
[0010] Furthermore, the nucleotide sequence of the tobacco chloroplast psbY gene is shown in SEQ ID NO.1.
[0011] Furthermore, the amino acid sequence of the tobacco chloroplast protein psbY is shown in SEQ ID NO.4.
[0012] This invention also provides the application of the tobacco chloroplast psbY gene or tobacco chloroplast protein psbY in tobacco breeding.
[0013] Furthermore, the application is the use of the tobacco chloroplast psbY gene or the tobacco chloroplast protein psbY in the selection of tobacco sterile lines; wherein the nucleotide sequence of the tobacco chloroplast psbY gene is shown in SEQ ID NO.1.
[0014] The present invention also provides a method for breeding male-sterile tobacco lines, which uses Agrobacterium-mediated genetic transformation to transform an overexpression vector containing the psbY gene of the tobacco chloroplast into the genome of the tobacco, thereby obtaining a male-sterile tobacco variety with psbY gene overexpression.
[0015] The beneficial effects of this invention are:
[0016] This invention is the first to discover and demonstrate that the tobacco chloroplast protein psbY can be used to regulate tobacco male sterility. Overexpression of the psbY gene can lead to shortening of tobacco filaments and stigmas that are much higher than the anthers, resulting in failure to pollinate normally and thus causing tobacco sterility. This has important theoretical significance and practical value for the study of tobacco male sterility and opens up new prospects for tobacco breeding. Attached Figure Description
[0017] Figure 1 The figures show the flower growth of psbY overexpressing transgenic tobacco and control TN90 tobacco; Figure (a) shows psbY overexpressing transgenic tobacco, and it can be seen from Figure (a) that the stigma of its flower is much higher than the filament; Figure (b) shows control TN90 tobacco.
[0018] Figure 2 The figures show the entire inflorescence and pods of psbY overexpressing transgenic tobacco and control TN90 tobacco plants. Figure (a) shows the psbY overexpressing transgenic tobacco, and it can be seen from Figure (a) that its entire inflorescence is sterile and does not produce seeds. Figure (b) shows the control TN90 tobacco, and it can be seen from Figure (b) that its pods are full.
[0019] Figure 3 The image shows a comparison of pods from psbY-overexpressing transgenic tobacco and the control TN90 tobacco. The left side shows normal pods from the control TN90 tobacco, while the right side shows aborted pods from the psbY-overexpressing transgenic tobacco. Detailed Implementation
[0020] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0021] To further understand the present invention, it will be further described in conjunction with the accompanying drawings and embodiments. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the materials and reagents used are commercially available unless otherwise specified.
[0022] Example 1: Cloning of the tobacco psbY gene
[0023] The main reagents and instruments used in this embodiment are: RNA extraction reagent Trizol (purchased from Invitrogen), reverse transcription kit (TaKaRa PrimeScript™ II 1st Strand cDNA Synthesis Kit, model: 6210B), high-fidelity enzyme (Vazyme 2 × Phanta® Max Master Mix (Dye Plus), model: P525-02), 10× PCR Buffer, dNTP Mix, PCR polymorase, gel extraction kit, loading buffer, DNA marker, pipettes (0.1 μl-1000 μl), Eppendorf benchtop centrifuge, Milli-Q ultrapure water system, GRANT SUBAqua Plus digital temperature-controlled water bath, SANYO SIM-F140 AY65 ice maker and TOMY SS-325 autoclave, Applied Biosystems Veriti™ multiplex temperature-controlled PCR instrument, BIO-RAD electrophoresis tank and voltage meter, and a regular refrigerator.
[0024] Step 1: Cloning of the tobacco psbY gene
[0025] The tobacco variety TN90 was selected and cultured in a greenhouse at 23℃ with a photoperiod of 14 h light / 10 h dark for 15 to 20 days. Then, 0.1 to 0.2 g of leaves were weighed, thoroughly ground with liquid nitrogen, and total RNA was extracted using Trizol (purchased from Invitrogen).
[0026] Cloning of the CDS fragment of transcription factor psbY: Using the extracted total RNA as a template, cDNA was synthesized by reverse transcription of the RNA sample using a reverse transcription kit (TaKaRa PrimeScript™ II 1st Strand cDNA Synthesis Kit, model: 6210B);
[0027] The primer sequences are as follows:
[0028] F43-1: ATGGCAGCCACCATAGGAACCATG (SEQ ID NO.2)
[0029] F43-2: TCACTGTCTCATCTTGTTGATCTG (SEQ ID NO.3)
[0030] Using cDNA as a template and F43-1 / F43-2 as primers, PCR amplification was performed using a high-fidelity enzyme (Vazyme 2 × Phanta®Max Master Mix (Dye Plus), model: P525-02). The PCR program was as follows: 94℃ pre-denaturation for 2-4 min; 94℃ denaturation for 30-40 s; 58℃ annealing for 30-40 s; 72℃ extension for 30-50 s; 33-35 cycles; 72℃ incubation for 5-10 min.
[0031] The PCR reaction system is shown in Table 1 below.
[0032] Table 1. PCR reaction system for amplifying the tobacco psbY gene
[0033] composition volume 2 × Phanta® Max Master Mix 25 μL F43-1 1 μL F43-2 1 μL cDNA 1 μL <![CDATA[ddH2O]]> 22 μL
[0034] Step 2: Recovery and purification of PCR products
[0035] The PCR amplified target fragment obtained in the previous step was subjected to electrophoresis on a 1% agarose gel. After completion, the fragment was photographed and observed under a UV-Vis analyzer. The target band was then cut out using a UV-TV analyzer, and the gel extraction was performed according to the instructions of the gel extraction kit. The method is as follows:
[0036] (1) Under a long-wave ultraviolet lamp, use a clean blade to cut the DNA band to be recovered from the gel and put it into a pre-weighed clean 1.5 ml centrifuge tube;
[0037] (2) Weigh the total mass of the centrifuge tube and the gel, subtract the mass of the centrifuge tube, and obtain the mass of the gel. Add 300 µl of Extraction Buffer for every 100 g of gel.
[0038] (3) Melt the gel in a water bath at 55℃ for about 10 minutes, shaking and mixing every 2-3 minutes until the gel is completely melted;
[0039] (4) Transfer the mixture obtained in the previous step to a centrifuge column, centrifuge at 6000 rpm / min for 60 s, and discard the waste liquid in the collection tube;
[0040] (5) Add 600 µl of Extraction Buffer to the centrifuge column, centrifuge at 12000 rpm / min for 60 s, and discard the waste liquid in the collection tube;
[0041] (6) Add 750 µl Wash Buffer to the centrifuge column, centrifuge at 12000 rpm / min for 60 s, and discard the waste liquid in the collection tube;
[0042] (7) Spin the column at 12000 rpm for 60 s, and then transfer the column into a new 1.5 ml centrifuge tube;
[0043] (8) Add 30 µl of Elution Buffer solution to the middle part of the centrifuge column;
[0044] (9) Place the column in a water bath at about 60°C for 2 minutes;
[0045] (10) Centrifuge at 12000 rpm / min for 60 s, and the DNA product will be in the centrifuge tube;
[0046] (11) Store at -20℃;
[0047] (12) DNA was detected by 1% agarose gel electrophoresis. The band length was the same as that of the PCR product band.
[0048] Step 3: Preparation of Escherichia coli DH5α competent cells
[0049] The preparation of competent E. coli cells followed the calcium chloride resuspension method in "Molecular Cloning: A Laboratory Manual," with slight modifications in some parts. The specific steps are as follows:
[0050] (1) Take 20 µl from the preserved bacterial culture of Escherichia coli strain and inoculate it into 10 ml of liquid LB medium. Incubate overnight at 37°C and 250 rpm on a shaker. The OD600 is about 0.5.
[0051] (2) Take 1 ml of the overnight culture and add it to 100 ml of freshly taken liquid LB medium. Shake at 225-250 rpm for 2.5-3 h until OD600=0.4. Dispense into two pre-cooled 50 ml centrifuge tubes and incubate in an ice water bath for 10 min.
[0052] (3) Centrifuge at 12000 rpm / min for 10 min at 4℃ and collect the bacterial cells;
[0053] (4) Discard the supernatant and slowly add 8 ml of 0.1 mol / L CaCl2 at 4℃ to resuspend the cells until homogeneous;
[0054] (5) Incubate in ice water for 30 min, then centrifuge at 12000 rpm / min for 5 min to recover cells;
[0055] (6) Discard the supernatant and resuspend the cells in 2 ml of 0.1 mol / L CaCl2 at 4℃ until homogeneous;
[0056] (7) Ice water bath for 2 hours;
[0057] (8) Dispense competent cell suspension into sterile, pre-cooled centrifuge tubes, 100 µl per tube, containing 15% glycerol, and store in a -80°C freezer.
[0058] Step 4: Recover the product, ligate it into pMDTM 19-T Vector, and transform it into E. coli DH5α.
[0059] The recovered product was ligated into a pMDTM 19-T vector, transformed into E. coli DH5α, identified, and sequenced. The ligation system is shown in Table 2 below.
[0060] Table 2. Connection system of recycled products to pMDTM 19-T Vector
[0061] Recycled products 4.0 μl T-vector 1.0 μl T4 DNA ligase 0.5 μl 10× ligase buffer 1.0 μl <![CDATA[ddH2O]]> 3.5 μl total 10.0 μl
[0062] The total volume is 10 µl. After gently shaking the mixture and briefly centrifuging, incubate overnight (12-16 h) in a 14°C dry incubator (or a 14°C water bath). The ligation product can be immediately used to transform competent cells.
[0063] Step 5: Transform E. coli
[0064] (1) Take a tube of prepared Escherichia coli competent cells DH5α in a -80℃ freezer, thaw it on ice, add 5 µl of ligation product, mix gently with a pipette tip, and then incubate on ice for 30 min.
[0065] (2) Heat in a 42℃ water bath for 60 s, then quickly in an ice water bath for 2 min;
[0066] (3) Add 900 µl of LB liquid medium, shake at 180 rpm, and revive at 37°C for 90 min. At the same time, preheat an LB plate containing Kan in a constant temperature incubator at 37°C.
[0067] (4) After resuscitation, centrifuge at 5000 rpm / min for 5 min;
[0068] (5) Take 900 µl of supernatant, resuspend the bacterial cells in the remaining supernatant, and spread the resuspended bacterial cells on LB plates;
[0069] (6) Incubate upside down in a 37℃ constant temperature incubator for 16~20 h.
[0070] Step 6: Screening of positive clones and PCR identification of bacterial culture
[0071] (1) Select 10 uniform, nearly round white colonies and inoculate them into 5 ml LB liquid medium containing Kan;
[0072] (2) Incubate at 225~250 rpm and 37℃ in a shaker for 8~10 h;
[0073] (3) The bacterial culture was PCR detected using amplification primers, and the PCR products were then subjected to gel electrophoresis and UV detection. The PCR reaction system was 30 µl, and the amplification program was as follows: 95℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 50 s, 30 cycles; 72℃ final extension for 10 min.
[0074] Step 7: Sequencing and identification of the screened positive clones.
[0075] Positive clones of bacteria, whose PCR detection showed a band consistent with the target band, were sent to Shanghai Panoson Biotechnology Co., Ltd. for sequencing. The sequencing results showed consistency with the psbY gene sequence, confirming that the cloned gene was the target gene. The gene sequence is shown in SEQ ID NO. 1.
[0076] .
[0077] Its amino acid sequence is shown in SEQ ID NO.2.
[0078] Example 2: Creation of psbY overexpression transgenic tobacco
[0079] PVX vector: pCamb-GR106 (ClaI + SalI restriction sites; restriction site sequences have been added to the synthesized sequence), then transformed into Agrobacterium LBA4404.
[0080] I. Ligation of the target gene into the pCamb-GR106 vector
[0081] Specific primers with ClaI + SalI restriction sites were designed. Using a T vector containing the target fragment as a template, PCR amplification was performed to amplify the target fragment with ClaI + SalI restriction sites. The target fragment was then ligated to pCamb-GR106, and the ligation product was transformed into Agrobacterium tumefaciens LBA4404.
[0082] The PCR reaction system is shown in Table 3 below.
[0083] Table 3 PCR reaction system
[0084] 10× PCR Buffer 5.0 μl dNTP Mix 0.5 μl 5′ primer 0.5 μl 3′ primer 0.5 μl polymorase 0.5 μl T-vector carrying the target fragment 0.5 μl <![CDATA[ddH2O]]> 42.5 μl total 50.0 μl
[0085] The total volume was 50 μl, and the reaction conditions were as follows: denaturation at 94℃ for 5 min; denaturation at 94℃ for 30 s, annealing at 56℃ for 30 s, extension at 72℃ for 50 s, for 35 cycles; extension at 72℃ for 10 min; and holding at 4℃. The obtained DNA product was subjected to gel electrophoresis, and the target fragment was detected.
[0086] The target fragments were cleaved and recycled using the same method as described above. The recycled target fragments were then linked to the pCamb-GR106 carrier, and the linkage system is shown in Table 4.
[0087] Table 4. Ligation system of pCamb-GR106, the target fragment ligation carrier.
[0088] Target gene with ClaI + SalI restriction sites 4.0 μl pCamb-GR106T vector 1.0 μl T4 DNA ligase 0.5 μl 10× ligase buffer 1.0 μl <![CDATA[ddH2O]]> 3.5 μl total 10.0 μl
[0089] The mixture was gently shaken and briefly centrifuged, then incubated overnight (12-16 h) in a dry incubator (or in water at 14°C). The ligation product can be used immediately to transform Agrobacterium.
[0090] II. Transformation of Agrobacterium tumefaciens by vector
[0091] The ligation product obtained in the previous step was transformed into Agrobacterium tumefaciens LBA4404, and the specific steps are as follows:
[0092] (1) Take a tube of LBA4404 Agrobacterium competent cells, thaw it in an ice water bath, add 5 μl of positive plasmid, and gently beat it with a pipette tip until well mixed;
[0093] (2) Place the centrifuge tube in an ice-water bath and let it stand for 5 minutes. Then, after 8 minutes of cold shock in liquid nitrogen, quickly remove the centrifuge tube and place it in a 37°C water bath for 5 minutes of heat shock.
[0094] (3) Add 900 μl of YEB liquid culture medium containing Str and Rif, and revive in a shaker at 28℃ and 180 rpm for 3-5 h;
[0095] (4) Centrifuge at 5000 rpm / min for 5 min, and discard 900 µl of supernatant;
[0096] (5) Resuspend the bacterial cells and spread them on YEB plates containing three antibiotics: Kan, Str, and Rif. Incubate them upside down in a constant temperature incubator at 28°C for about 2 days until larger colonies grow.
[0097] (6) Pick up about 10 uniform, nearly round, pale yellow colonies with a pipette tip and inoculate them into 5 ml of YEB liquid medium containing Kan, Str, and Rif; shake culture, and then perform PCR bacterial culture detection. Positive clones are then expanded cultured and used for transient expression of Agrobacterium.
[0098] III. Creation of transgenic tobacco plants overexpressing psbY
[0099] (1) Take leaves of sterile tobacco seedlings, cut off the edges and main veins with a sharp scalpel, and cut the leaves into small pieces of 0.5 cm square (so that there are wounds on all sides) for later use.
[0100] (2) Take the culture of Agrobacterium LBA4404 (containing kanamycin resistance gene and Ntppc gene) that has been cultured overnight, centrifuge at 4000 rpm for 10 min at room temperature, and resuspend the cells with MS salt solution (pH 7.0). When using, dilute with MS salt solution to 20-50 times the original volume.
[0101] (3) After infecting the prepared leaf discs in the bacterial solution for 10 min, remove the leaves, absorb the bacterial solution on the surface of the leaves with sterile filter paper, transfer them to MS medium covered with a layer of sterile filter paper, and incubate in the dark at 28℃ for 3-7 days.
[0102] (4) After co-culture, the material was transferred to differentiation medium (screening medium) containing antibiotics (MS+NAA 0.2mg / l +6-BA 3 mg / l+Kan 100 μg / ml+Cb 500 μg / ml) and cultured, and subcultured every 15 days.
[0103] (5) When the resistant shoots grow to 2-3 cm, cut them off and transfer them to 1 / 2 MS rooting medium (1 / 2 MS + Kan 100 μg / ml + Cb 500 μg / ml) to induce rooting.
[0104] (6) When the transgenic tobacco plants have rooted and grown to 5-6 leaves, the expression of psbY in the transgenic plants is detected by western blot to confirm its existence and activity at the transcriptional and translational levels.
[0105] Example 3: psbY induces tobacco sterility
[0106] Transgenic tobacco plants overexpressing psbY with 3-4 leaves were transplanted from sterile culture bottles into soil for cultivation. Wild-type TN90 plants of similar growth stage and vigor were used as a control. Five individual plants were selected from both the control TN90 tobacco plants and each transgenic line.
[0107] Control tobacco and transgenic tobacco were placed in a greenhouse for normal growth. The greenhouse conditions were set as follows: long day, temperature: 25℃; relative humidity: 80%; photoperiod: 16 h light + 8 h dark; light intensity: 80-100 μmol·m⁻¹ -2 ·s -1 LED lights: full spectrum and warm color (6500 K). Once the tobacco plants reach the budding stage, the flowering and seed production of the psbY overexpressing transgenic tobacco and the control TN90 were observed and recorded daily.
[0108] Observation results as follows Figure 1 As shown, both the five psbY overexpressing transgenic tobacco plants and the control TN90 tobacco plant could flower normally. In the control TN90 plant, the filaments grew normally, exceeding the stigma in length, and the anthers contacted the stigma, allowing for normal pollination. However, the flowers of the psbY overexpressing transgenic tobacco plant developed abnormally, with shortened filaments causing the stigma to be much higher than the anthers, preventing the anthers from contacting the stigma and thus hindering normal pollination. Figure 2 and Figure 3 As shown, the control group TN90 produced normal seeds with full pods, which are normal pods; while the entire inflorescence of the psbY overexpressing transgenic tobacco was completely sterile, resulting in shriveled pods, which are sterile pods without seeds.
[0109] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, alterations, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. Application of the tobacco chloroplast psbY gene or tobacco chloroplast protein psbY in regulating tobacco sterility.
2. The application according to claim 1, characterized in that, The application refers to the use of the tobacco chloroplast psbY gene or tobacco chloroplast protein psbY in regulating male sterility in tobacco.
3. The application according to claim 1, characterized in that, The application involves overexpression of the psbY gene, which causes shortening of tobacco filaments, preventing normal pollination and leading to tobacco sterility.
4. The application according to claim 1, characterized in that, The nucleotide sequence of the tobacco chloroplast psbY gene is shown in SEQ ID NO.
1.
5. The application according to claim 1, characterized in that, The amino acid sequence of the tobacco chloroplast protein psbY is shown in SEQ ID NO.
4.
6. Application of the tobacco chloroplast psbY gene or tobacco chloroplast protein psbY in tobacco breeding.
7. The application according to claim 6, characterized in that, The application refers to the use of the tobacco chloroplast psbY gene or the tobacco chloroplast protein psbY in the breeding of tobacco sterile lines.
8. The application according to claim 6, characterized in that, The nucleotide sequence of the tobacco chloroplast psbY gene is shown in SEQ ID NO.
1.
9. A method for breeding male-sterile tobacco lines, characterized in that, Using Agrobacterium-mediated genetic transformation, an overexpression vector containing the tobacco chloroplast psbY gene as described in claim 1 is transformed into the tobacco genome to obtain a male-sterile tobacco variety with psbY gene overexpression.