Tomato slrrb9 gene and application of knock-out vector thereof in tomato

By knocking out the SlRRB9 gene, a tomato response regulator, using CRISPR/Cas9 gene editing technology, the problem of regulating tomato fruit size was solved, achieving the breeding goals of larger fruit and higher yield, while reducing breeding costs.

CN122146777APending Publication Date: 2026-06-05NANJING AGRICULTURAL UNIVERSITY
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202610629278.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-05-09
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively control tomato fruit size, which affects fruit enlargement and breeding efficiency.

Method used

The SlRRB9 response regulator gene in tomato was knocked out using CRISPR/Cas9 gene editing technology. The target sgRNA sequence was designed and the CRISPR/Cas9 gene editing vector pYLCRISPRCas9Pubi-N-SlRRB9 was constructed and introduced into tomato for genetic transformation.

Benefits of technology

It significantly increases the size and weight of tomato fruits, promotes high yield and reduces breeding costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122146777A_ABST
    Figure CN122146777A_ABST
Patent Text Reader

Abstract

The application provides a tomato SlRRB9 gene and application of a knockout vector of the tomato SlRRB9 gene in tomatoes. The gene number of the tomato response regulator gene SlRRB9 is LOC101258668, and the nucleotide sequence is shown as SEQ ID NO. 1. The knockout vector of the tomato response regulator gene SlRRB9 and an engineering bacterium comprising the knockout vector, the knockout vector targets an sgRNA-1 sequence shown as SEQ ID NO. 2 and an sgRNA-2 sequence shown as SEQ ID NO. 3. The application is selected from 1) and / or 2): 1) increasing the fruit size of tomatoes; 2) increasing the fruit weight of tomatoes. The application can obtain a tomato plant with increased fruit size by CRISPR / Cas9 gene editing of the SlRRB9 gene, which is of great significance for promoting high yield of tomatoes and reducing breeding costs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to the application of the tomato SlRRB9 gene and its knockout vector in tomatoes. Background Technology

[0002] Fruit size is a core agronomic trait that determines the commercial value and market competitiveness of horticultural crops, directly impacting growers' economic benefits and consumers' purchasing preferences. Therefore, regulating fruit size has long been an important direction for crop genetic improvement. Breeding large-fruited tomatoes can significantly increase yield per unit area, meeting the demands of large-scale production; it can also align with consumer preferences for fruit appearance and eating experience; furthermore, it can provide an ideal trait improvement model for tomato genetic breeding research.

[0003] Currently, various methods have been established to increase fruit size by regulating cell size and number during fruit development. For example: ① promoting fruit cell elongation and volume expansion by applying plant hormones such as gibberellin exogenously; ② aggregating superior genes controlling large fruit traits from different parents through traditional mutation and hybridization breeding to achieve stable inheritance of traits; ③ using transgenic or gene editing technologies to directionally regulate or modify genes such as CDK, Cyclin, and WUSCHEL-related homeobox genes to control cell number and size at the molecular level.

[0004] Cytokinins primarily promote cell division in the early stages of fruit development, leading to larger tomato fruits. Cytokinins activate the expression of cell cycle-related genes (such as CDK and Cyclin genes), prolonging the duration of cell division and increasing the total number of cells within the fruit. Simultaneously, cytokinins can synergistically work with auxins to promote nutrient transport to the fruit, providing the necessary material support for cell division and growth, thereby achieving significant fruit enlargement.

[0005] The cytokinin signaling pathway, composed of elements such as the cytokinin receptor, histidine phosphotransferase, and response regulators, is crucial for cytokinin function. Previous reports have shown that knocking out the cytokinin receptor gene SlHK2 significantly increases tomato fruit size. The response regulator, located downstream of the cytokinin receptor, is a key transcription factor regulating the expression of cytokinin-responsive genes. Using CRISPR / Cas gene editing technology to knock out the response regulator gene may yield tomato lines with larger fruits, thus providing new gene reserves and technical support for the breeding of new large-fruited tomato varieties. Summary of the Invention

[0006] In response to the need for breeding large-fruited tomatoes, the purpose of this invention is to provide an application of the tomato response regulator gene SlRRB9 and its knockout vector in regulating tomato fruit size. In one embodiment of this invention, the knockout vector is a CRISPR / Cas9 gene editing vector.

[0007] The specific technical solution of this invention is as follows: The tomato response regulator gene SlRRB9, with gene number LOC101258668, has a nucleotide sequence as shown in SEQ ID NO.1.

[0008]

[0009] The SlRRB9 gene sequence shown in SEQ ID NO.1, with gene number LOC101258668, is located on chromosome 7 of tomato (Genbank accession number OU640350.1) at 674818-678763 bp.

[0010] The aforementioned knockout vector for the tomato response regulator gene SlRRB9 is a CRISPR / Cas9 gene editing vector that targets the sgRNA-1 sequence shown in SEQ ID NO.2 and / or the sgRNA-2 sequence shown in SEQ ID NO.3.

[0011] The sgRNA-1 sequence shown in SEQ ID NO.2 is: GTAAGTGGAGAAAGTGGTCG; The sgRNA-2 sequence shown in SEQ ID NO.3 is: ATAGTCCCTTCCCCCTAATG.

[0012] Furthermore, the base vector for the knockout vector is the pYLCRISPRCas9Pubi-N universal vector.

[0013] Furthermore, the knockout vector is named pYLCRISPRCas9Pubi-N-SlRRB9, which is obtained by inserting the sgRNA-SlRRB9 gene sequence shown in SEQ ID NO.4 between two BsaI restriction sites in the pYLCRISPRCas9Pubi-N universal vector (NCBI accession number MG719602.1) from 8807bp to 9492bp (LB boundary is the 1st bp). The sgRNA-SlRRB9 gene sequence is composed of the AtU3d-C9 promoter, the sgRNA-1 sequence shown in SEQ ID NO.2, the sgRNA backbone sequence, the AtU3b-C1 promoter, the sgRNA-2 sequence shown in SEQ ID NO.3, and the sgRNA backbone sequence linked sequentially.

[0014] The sgRNA-SlRRB9 gene sequence shown in SEQ ID NO.4: .

[0015] This invention also provides a method for constructing the CRISPR / Cas9 gene editing vector pYLCRISPRCas9Pubi-N-SlRRB9 for the tomato response regulator gene SlRRB9. The construction method is as follows: S1: Search for gene number LOC101258668 in the NCBI database (https: / / www.ncbi.nlm.nih.gov / ) to obtain the gene sequence of SlRRB9 located in the 674818-678763bp region of chromosome 7 of tomato (Genbank accession number OU640350.1) (i.e. the fragment shown in SEQ ID NO.1), which is the tomato response regulator SlRRB9.

[0016] S2: Using the online tool CRISPR-P 2.0 (http: / / cbi.hzau.edu.cn / crispr / ), a target sgRNA sequence for CRISPR / Cas9 gene editing of the tomato response regulator gene SlRRB9 was designed. The 1399~1418bp region of the SlRRB9 gene sequence shown in SEQ ID NO.1, i.e. the sequence shown in SEQ ID NO.2, was selected as the target sgRNA-1 sequence; the reverse complementary sequence of the 2608~2627bp region of the SlRRB9 gene sequence shown in SEQ ID NO.1, i.e. the sequence shown in SEQ ID NO.3, was selected as the target sgRNA-2 sequence.

[0017] S3: The AtU3d-C9 promoter, the sgRNA-1 sequence shown in SEQ ID NO.2, the sgRNA backbone sequence, the AtU3b-C1 promoter, the sgRNA-2 sequence shown in SEQ ID NO.3, and the sgRNA backbone sequence are sequentially linked to form the sgRNA-SlRRB9 gene sequence shown in SEQ ID NO.4.

[0018] S4: The constructed sgRNA-SlRRB9 gene sequence was submitted to a biotechnology company for synthesis and inserted between two BsaI restriction sites at 8807bp~9492bp (LB boundary is the 1st bp) of the universal vector pYLCRISPRCas9Pubi-N (NCBI accession number MG719602.1) to obtain the CRISPR / Cas9 gene editing vector pYLCRISPRCas9Pubi-N-SlRRB9.

[0019] The CRISPR / Cas9 gene editing vector constructed in this invention can be directly used for Agrobacterium-mediated plant genetic transformation, which is of great significance for increasing tomato fruit size, promoting high-yield tomatoes, and reducing breeding costs.

[0020] Engineered bacteria, including the aforementioned knockout vector.

[0021] Furthermore, the genetically engineered bacterium EHA105 Agrobacterium is the host cell.

[0022] The application of knocking out the aforementioned tomato response regulator gene SlRRB9, or the aforementioned knockout vector, or the aforementioned engineered bacteria in regulating tomato fruit traits, wherein the application is 1) and / or 2). 1) Increase the size of the tomato fruit; 2) Increase the weight of the tomato fruit.

[0023] Furthermore, the application involves introducing frameshift mutations in the 1399-1418bp and 2608-2627bp regions of the SlRRB9 gene sequence shown in SEQ ID NO.1, thereby knocking out the SlRRB9 gene. The sequence of the 1399-1418bp region of the SlRRB9 gene sequence shown in SEQ ID NO.1 is as shown in SEQ ID NO.2, and the sequence of the 2608-2627bp region is inversely complementary to the sequence shown in SEQ ID NO.3.

[0024] This invention identifies a response regulator gene, SlRRB9, from tomato. The target sgRNA sequences of SlRRB9 in this invention are the 1399-1418 bp region of the SlRRB9 gene sequence (i.e., the fragment shown in SEQ ID NO.1) (sgRNA-1 sequence, i.e., the fragment shown in SEQ ID NO.2) and the reverse complementary sequence of the 2608-2627 bp region (sgRNA-2 sequence, i.e., the fragment shown in SEQ ID NO.3), both 20 bp in length. These sequences are also specific to other response regulator genes and other tomato genes.

[0025] The beneficial effects achieved by the technical solution of this invention are as follows: (1) In this invention, the target sgRNA fragment of the tomato response regulator gene SlRRB9 was screened and edited by CRISPR / Cas9. The CRISPR / Cas9 gene editing vector pYLCRISPRCas9Pubi-N-SlRRB9 was constructed and then transfected into transgenic engineered bacteria and transferred into tomatoes, resulting in a homozygous mutant line of SlRRB9 with significantly increased fruit size.

[0026] (2) The fruit size of the SlRRB9 homozygous mutant line is larger and the single fruit weight is heavier than that of the wild type (WT).

[0027] (3) This invention can obtain tomato plants with larger fruits by editing the SlRRB9 gene through CRISPR / Cas9 gene, which is of great significance for promoting high-yield tomatoes and reducing breeding costs. Attached Figure Description

[0028] Figure 1 This is the vector map constructed in Example 2.

[0029] Figure 2 In Example 4 rrb9-2Sequencing results of the sgRNA region targeting the SlRRB9 gene; where: A is the sequencing result of the region where the sgRNA-1 sequence is located, B is the sequencing result of the region where the sgRNA-2 sequence is located, and the red box indicates the region where the sgRNA-1 or sgRNA-2 sequence is located.

[0030] Figure 3 For WT and 35 days after sowing in Example 5 rrb9-2 Mutant plant.

[0031] Figure 4 This shows the size of tomatoes at the red ripening stage in Example 5.

[0032] Figure 5 The longitudinal and transverse diameters of the tomato fruit at the red ripening stage in Example 5.

[0033] Figure 6 The weight of a single tomato during the red ripening stage in Example 5.

[0034] In the image, WT represents the wild-type tomato variety Micro-Tom. rrb9-2 This is a homozygous SlRRB9 mutant line obtained using CRISPR / Cas9 gene editing. Detailed Implementation

[0035] The present invention will be further explained below with reference to the embodiments, but the embodiments do not limit the present invention in any way.

[0036] Example 1: Obtaining the target sgRNA sequence of the tomato response regulator gene SlRRB9 1. The location information of the tomato SlRRB9 gene (gene number: LOC101258668) was obtained by querying the NCBI database (https: / / www.ncbi.nlm.nih.gov / ). This gene is located in the 674818~678763bp region of tomato chromosome 7 (Genbank accession number OU640350.1).

[0037] 2. Using the CRISPR-P 2.0 online tool (http: / / cbi.hzau.edu.cn / crispr / ), we designed the target sgRNA sequence for the CRISPR / Cas9 gene editing tomato response regulator gene SlRRB9. Two target regions were ultimately selected: ① the 1399-1418 bp region of the SlRRB9 gene sequence shown in SEQ ID NO.1, i.e., the sgRNA-1 sequence shown in SEQ ID NO.2; ② the reverse complementary sequence of the 2608-2627 bp region of the SlRRB9 gene sequence, i.e., the sgRNA-2 sequence shown in SEQ ID NO.3.

[0038] Example 2: Construction of the gene editing vector pYLCRISPRCas9Pubi-N-GFP for the tomato response regulator gene SlRRB9 - SlRRB9 The AtU3d-C9 promoter, the sgRNA-1 sequence shown in SEQ ID NO.2, the sgRNA backbone sequence, the AtU3b-C1 promoter, the sgRNA-2 sequence shown in SEQ ID NO.3, and the sgRNA backbone sequence were sequentially ligated to construct the sgRNA-SlRRB9 gene sequence shown in SEQ ID NO.4. This gene sequence was then synthesized by a biotechnology company and inserted between two BsaI restriction sites at 8807bp~9492bp (LB boundary is the 1st bp) of the pYLCRISPRCas9Pubi-N universal vector (NCBI accession number MG719602.1), ultimately yielding the gene named pYLCRISPRCas9Pubi-N-GFP. - The CRISPR / Cas9 gene editing vector for SlRRB9, vector map as follows: Figure 1 As shown.

[0039] Example 3: Genetic transformation of tomatoes The above vector pYLCRISPRCas9Pubi-N-GFP was generated using Agrobacterium-mediated transformation. - The main steps for introducing SlRRB9 into the tomato variety Micro-Tom are as follows: (1) Preparation of Agrobacterium: pYLCRISPRCas9Pubi-N-GFP -Using the SlRRB9 gene editing vector as the template sequence, specific primers sgRNA-F: 5'-CTAGATCGGGAGCACCGGTA-3' (SEQ ID No.5) and sgRNA-R: 5'-TCGATGCATGCGGCCGCTAG-3' (SEQ ID No.6) were designed to amplify the sequence SEQ ID No.7 with a length of 696bp: CTAGATCGGGAGCACCGGTAAGGCGCGCCATAAGCTTATGATTTCTTTTTTCTTACGAATTTTGCGTCCCACATCGGTAAGCGAGTGAAGAAATAACTGCTTTATATATGGCTACAAAGCACCATTGGTCAGTAAGTGGAGAAAGTGGTCGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTTTTACTTTAAATTTTTTCTTATGCAGCCTGTGATGGATAACTGAATCAAACAAATGGCGTCTGGGTTTAAGAAGATCTGTTTTGGCTATGTTGGACGAAACAAGTGAACTTTTAGGATCAACTTCAGTTTATATATGGAGCTTATATCGAGCAATAAGATAAGTGGGCTTTTTATGTAATTTAATGGGCTATCGTCCATAGATTCACTAATACCCATGCCCAGTACCCATGTATGCGTTTCATATAAGCTCCTAATTTCTCCCACATCGCTCAAATCTAAACAAATCTTGTTGTATATATAACACTGAGGGAGCAACATTGGTCATAGTCCCTTCCCCCTAATGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTGGCGCGCCTCTCGAGCTAGCGGCCGCATGCATCGA。

[0040] The recombinant plasmid was introduced into Agrobacterium EHA105 via a freeze-thaw method. Colony PCR was performed using primers shown in SEQ ID No. 5 and SEQ ID No. 6 (Table 1 shows the reaction system). The PCR product bands were observed by 1% agarose gel electrophoresis. If the band size matched the 696 bp shown in SEQ ID No. 7, the plasmid was considered successfully introduced.

[0041] Take a very small amount of successfully transformed Agrobacterium and culture it in 800 μl of LB liquid medium containing 50 mg / L Kan and 50 mg / L Rif at 200 rpm and 28 °C for 16 h with shaking. Then add 50% glycerol and store at -80 °C.

[0042] Table 1 Colony PCR Reaction System <![CDATA[ddH2O]]> Up to 25μl sgRNA-F 1 μl (0.2-0.3 μM) sgRNA-R 1 μl (0.2-0.3 μM) colonies - Taq enzyme 12.5 μl (1.25 U) (2) Explant treatment: ① Seed disinfection: Select 100 intact and plump seeds and place them in a 10ml sterile centrifuge tube. Disinfect the seeds stepwise with 3ml of 75% anhydrous ethanol solution (1min) and 3ml of 10% sodium hypochlorite solution (7min), and then quickly rinse 6-8 times with sterile water. Place a sterile filter paper in a sterile square petri dish (10×10cm) containing 5ml of sterile water using sterile forceps. Place the disinfected seeds on the moistened filter paper using sterile forceps. Seal the square dish with sealing film and incubate at 28℃ in the dark for 2-3 days. When the radicle elongates to about 1cm, transfer the seeds to a tissue culture flask containing MS solid medium and continue incubating at 28℃ in the dark. When the hypocotyl elongates to about 3cm, transfer the seeds to a tissue culture room for light culture.

[0043] ②Sampling: When the first true leaf of the tomato seedling is about to emerge (7-10 days of growth under light), cut the seedling from the stem under sterile conditions and place it on sterile filter paper with tweezers. Remove the tip of the tomato cotyledon and cut the cotyledon near the petiole. Divide it into two small squares perpendicular to the leaf veins and place them face up in the pre-culture medium for 2 days.

[0044] (3) Activation of the strain: The gene editing vector pYLCRISPRCas9Pubi-N-GFP was used. -Agrobacterium tumefaciens EHA105 (SlRRB9) was streaked onto LB solid medium containing 50 mg / L Kan and 50 mg / L Rif. The plates were inverted and incubated in the dark at 28°C for 2 days until single colonies appeared. A moderately sized and plump single colony was picked and inoculated into 800 μl of LB liquid medium containing the same concentration of antibiotics. The culture was incubated at 28°C and 200 rpm with shaking for 16 h. 100 μl of the bacterial culture was then transferred to a fresh 100 ml LB medium and incubated at 28°C and 200 rpm with shaking for approximately 15 h to allow the OD to adjust. 600 The OD value reached 0.6~0.8. The bacterial suspension was centrifuged at 4℃ and 5000 rpm for 5 min to obtain a bacterial pellet. The precipitated bacterial cells were adjusted to OD using resuspension buffer (MS + 100 μM AS). 600 Adjust the value to 0.47~0.5, and continue to suspend and shake at 28℃ and 100rpm for 1 hour for later use.

[0045] (4) Agrobacterium infection: Take out the tomato cotyledons that have been pre-cultured for 2 days and immerse them in the activated bacterial solution obtained in (3). Shake at 28℃ and 100rpm for 20 minutes. After infection, use sterile forceps to remove the explants and place them on sterile filter paper to remove any residual bacterial solution on the surface.

[0046] (5) Co-cultivation: The infected explants were placed face up and evenly spread on the surface of the co-culture medium, and then placed in a dark incubator for 3 days.

[0047] (6) Screening and cultivation: After co-culture, the explants were transferred to selection medium and cultured under light conditions, with the medium being changed every 15 days. During this period, the explants gradually formed callus tissue and further differentiated into buds.

[0048] (7) Sprouting culture: Explants with clearly formed buds are transferred to a budding medium to promote the growth of adventitious buds. When the adventitious buds grow to a large size, they are transferred to a tissue culture bottle containing a budding medium.

[0049] (8) Rooting culture: When the regenerated shoots grow to 3-4 true leaves, they are separated from the callus tissue with a scalpel and inserted into the rooting culture medium to induce and develop the root system.

[0050] (9) Seedling hardening: After the plants have developed a well-developed root system in the rooting medium, wash off the culture medium adhering to the roots, remove old leaves, add water to the seedling root-stem transition zone in the tissue culture bottle, and culture under light for 4-5 days to harden off the seedlings. Change the water once a day.

[0051] (10) Transplanting and planting: After hardening off, the seedlings are transplanted into the cultivation substrate and placed in the plant growth chamber for further cultivation.

[0052] The culture medium formulation used in genetic transformation is as follows: ① Pre-culture medium: MS medium + ZT (2 mg / L) + AS (20 mg / L).

[0053] ② Co-culture medium: MS medium + ZT (2 mg / L) + AS (20 mg / L).

[0054] ③ Screening medium: MS medium + ZT (3 mg / L) + Kan (80 mg / L) + Ti (300 mg / L).

[0055] ④ Germination medium: MS medium + ZT (1 mg / L) + Kan (80 mg / L) + Ti (300 mg / L).

[0056] ⑤ Rooting medium: MS medium + IBA (0.2 mg / L) + Kan (20 mg / L) + Ti (300 mg / L).

[0057] Culture media ①~⑤ were diluted with distilled water to a final volume, dispensed into Erlenmeyer flasks of the required size, sealed, and sterilized using conventional methods (e.g., sterilized at 121℃ for 25 minutes).

[0058] ⑥LB liquid medium: 10g / L tryptone + 5g / L yeast extract + 10g / L NaCl powder.

[0059] ⑦MS solid medium: 20 g / L sucrose + 1.8 g / L MS medium powder + 7 g / L agar.

[0060] ⑧MS liquid medium: 20 g / L sucrose + 1.8 g / L MS medium powder.

[0061] Culture media ⑥~⑧ were adjusted to pH 5.80 with 1M sodium hydroxide, diluted to volume with distilled water, dispensed into Erlenmeyer flasks of the required size and sealed, and sterilized according to the above method.

[0062] The main solution formulation is as follows: ①ZT hormone (10mg / mL): Weigh 90mg ZT, add 600μL of 1M sodium hydroxide to aid dissolution, and dilute to 9mL with distilled water.

[0063] ②IBA hormone (1mg / mL): Weigh 6mg of IBA, dilute with distilled water to 6mL, and store at -20℃ for later use.

[0064] ③Ti Termetine solution (300mg / mL): Weigh 1.8g Ti, dilute with distilled water to 6mL, and store at -20℃ for later use.

[0065] ④Kan (100 mg / mL) solution: Weigh 600 mg Kan, dilute with distilled water to 6 mL, and store at -20℃ for later use.

[0066] ⑤AS acetylsuccinone solution (20mg / mL): Weigh 0.1g AS, dilute to 5ml with DMSO, and store at -20℃ for later use.

[0067] ⑥1M Sodium Hydroxide: Weigh 4g of sodium hydroxide, dissolve it in distilled water and bring the volume to 100 mL.

[0068] Solutions ① to ⑤ should be stored at -20℃ for later use, while solution ⑥ should be stored at room temperature for later use.

[0069] Example 4: Identification of tomato response regulator gene SlRRB9 gene-edited lines (1) Take young leaf samples from T0 generation transgenic plants and extract DNA using the CTAB method.

[0070] The specific steps are as follows: ① Heat the CTAB extract in a 65°C water bath beforehand and add 1% by volume of β-mercaptoethanol; ②Weigh 0.5g of tender tomato leaves, quickly freeze them with liquid nitrogen, place them in a small mortar that has been pre-cooled with liquid nitrogen, and grind them into a fine powder in liquid nitrogen. ③ Transfer the ground powder to a PE tube containing 2 ml of preheated CTAB extract, mix thoroughly, and heat in a 65°C water bath for 1 hour, inverting and mixing 3-5 times during the process; ④ Remove the PE tube, cool it to room temperature, add an equal volume of chloroform / isoamyl alcohol (24:1), mix gently, centrifuge (8000 rpm, 16℃, 15 min), and transfer the supernatant to a new PE tube; ⑤ Repeat the previous step to extract again, add an equal volume of chloroform / isoamyl alcohol (24:1), mix gently and centrifuge (8000 rpm, 16℃, 15 min), and transfer the supernatant to a new PE tube; ⑥ Add an equal volume of anhydrous ethanol and mix gently until a filamentous or flocculent precipitate appears; this is the crude extract. ⑦ Pick up DNA clumps and transfer them to 1.5ml PE tubes. Add 75% ethanol and incubate on ice for 2-3 hours, changing the 75% ethanol 2-3 times during this period. After air drying, add 600μl ddH2O to completely dissolve the DNA. ⑧ Add 6 μl RNase, incubate in a 37°C water bath for 30 min, detect DNA by 1% agarose gel electrophoresis, and store in a -80°C freezer for later use.

[0071] (2) Using the DNA obtained in (1) as a template, PCR amplification was performed using the primers shown in SEQ ID No. 5 and SEQ ID No. 6, according to the system in Table 2. If a 696bp band matching SEQ ID No. 7 appeared by 1% agarose gel electrophoresis, the plant to which the template DNA belongs was preliminarily determined to be transgenic positive.

[0072] Table 2. Standard PCR reaction system <![CDATA[ddH2O]]> Up to 25μl upper primer 1 μl (0.2-0.3 μM) lower primer 1 μl (0.2-0.3 μM) DNA template 2μl (0-500ng) Taq enzyme 12.5 μl (1.25 U) (3) Collect self-pollinated seeds from T0 generation transgenic plants and sow them to cultivate T1 generation lines. Culture conditions: daytime temperature 25℃, light 10000 Lux for 14 hours; nighttime temperature 18℃, darkness for 10 hours; air humidity 60%, other routine management.

[0073] (4) Select young leaves of T1 generation plants and extract DNA using the CTAB method, the same as (1).

[0074] (5) Transgenic identification: Using the DNA extracted in (4) as a template, and using the sequences of SEQ ID No. 5 and SEQ ID No. 6 as primers, PCR amplification was performed (the reaction system is shown in Table 2). The PCR products were detected by 1% agarose gel electrophoresis. If the reaction was normal but the expected band was not amplified, it indicates that the transgenic fragment has been removed through self-pollination.

[0075] (6) Using the upstream and downstream sequences of the sgRNA-1 sequence shown in SEQ ID No. 2 and the sgRNA-2 sequence shown in SEQ ID No. 3 of the wild-type tomato SlRRB9 gene as templates, specific primers were designed respectively: SlRRB9-1F: 5'-CGTTTTGGTCCAGTGTTGTCTG-3' (SEQ ID No. 8) and SlRRB9-1R: 5'-GGGAAAATTCATAACAAGCATAGTCGG-3' (SEQ ID No. 9), SlRRB9-2F: 5'-GAGCCGAGGATCTATTGGAAACA-3' (SEQ ID No. 10) and SlRRB9-2R: 5'-TGGCTGGCGGAATGCTTG-3' (SEQ ID No. 11).

[0076] The primer pairs SlRRB9-1F and SlRRB9-1R can amplify a 462bp fragment from the 1205-1666bp region of the SlRRB9 gene sequence shown in SEQ ID No. 1 of wild-type tomato.

[0077] The primer pairs SlRRB9-2F and SlRRB9-2R can amplify a 466bp fragment from the 2403-2868bp region of the SlRRB9 gene sequence shown in SEQ ID No. 1 of wild-type tomato.

[0078] Using the DNA extracted in (4) as a template, PCR amplification was performed using the sequences of SEQ ID No. 8 and SEQ ID No. 9, and SEQ ID No. 10 and SEQ ID No. 11 as primers (reaction system shown in Table 2). The PCR products were detected by 1% agarose gel electrophoresis. If the band sizes were approximately 462 bp and 466 bp, respectively, they were submitted to a biotechnology company for Sanger sequencing. The sequencing results were compared with the nucleotide sequences of the 1205~1666 bp and 2403~2868 bp regions of the SlRRB9 gene sequence shown in SEQ ID No. 1 to analyze the mutation status of the SlRRB9 target site in the T1 generation plants.

[0079] (7) Based on the above identification and analysis, a line without transgenes and with a homozygous mutation at the SlRRB9 target site was obtained and named rrb9-2 . rrb9-2 The strain has a 1 bp deletion at position 1415 of the SlRRB9 gene sequence and a 10 bp deletion at positions 2608-2617, for a total deletion of 11 bp. Figure 2 All mutations in this strain are frameshift mutations, which are speculated to cause the loss of normal function of the SlRRB9 gene, thus achieving gene knockout.

[0080] Example 5: Measurement of longitudinal and transverse diameters and weight of tomato fruits Wild-type (WT) and mutants were selected. rrb9-2 Several plump seeds were placed in a petri dish with an appropriate amount of water and germinated in a dark incubator at 28℃ for 3-5 days. When the radicles extended to about 3cm, they were transplanted into flowerpots (10cm long, 10cm wide, and 8.8cm high) filled with nutrient soil and placed in a plant growth chamber for cultivation. The cultivation conditions were set as follows: daytime temperature 25℃, light intensity 14h, nighttime temperature 18℃, light intensity 10h, relative humidity 60%, and light intensity 200μmol / m². -2 ·s -1 Ten days after transplanting, select several plants with consistent growth status (WT and...) rrb9-2 The seedlings were replanted in pots filled with nutrient soil and placed in a plant growth chamber for further cultivation. Figure 3 ).

[0081] After all the fruits on the plants had reached the ripening stage, the longitudinal and transverse diameters of the fruits were measured using vernier calipers, and the weight of the fruits was determined using a balance. The results showed that... rrb9-2 The mutant's red-ripe fruit has a significantly larger size than WT ( Figure 4 The characteristics of ).

[0082] Specifically, rrb9-2 The average longitudinal diameter and average transverse diameter of the fruit were both 1.11 times the WT (wt). Figure 5 The average weight of a single fruit is 1.13 times the WT (wt). Figure 6 All showed significant differences.

[0083] The results above indicate that the sgRNA-guided CRISPR / Cas9 gene editing shown in SEQ ID NO.2 and SEQ ID NO.3, which knocks out the SlRRB9 gene, a tomato response regulator, can effectively promote the increase in tomato fruit size and weight.

[0084] In summary, this invention successfully constructed the gene editing vector pYLCRISPRCas9Pubi-N-GFP for the tomato response regulator gene SlRRB9 by designing and obtaining the sgRNA fragment of SlRRB9. - SlRRB9 was developed, and tomato lines with the SlRRB9 gene knocked out were obtained using genetic transformation and gene editing technologies, providing an effective way to increase the size of tomato fruits.

[0085] The above description is only a preferred embodiment of the present invention. Any person skilled in the art can make several improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The tomato response regulator gene SlRRB9, characterized in that, The nucleotide sequence of the tomato response regulator gene SlRRB9 is shown in SEQ ID NO.

1.

2. The knockout vector of the tomato response regulator gene SlRRB9 as described in claim 1, characterized in that, The knockout vector is a CRISPR / Cas9 gene editing vector that targets the sgRNA-1 sequence shown in SEQ ID NO.2 and / or the sgRNA-2 sequence shown in SEQ ID NO.

3.

3. The knockout carrier according to claim 2, characterized in that, The base vector for the knockout vector is the pYLCRISPRCas9Pubi-N universal vector.

4. The knockout carrier according to claim 2 or 3, characterized in that, The knockout vector was obtained by inserting the sgRNA-SlRRB9 sequence shown in SEQ ID NO.4 between the two BsaI restriction sites at 8807bp~9492bp of the pYLCRISPRCas9Pubi-N universal vector.

5. Engineered bacteria, characterized in that, The engineered bacteria include the knockout vector as described in any one of claims 2 to 4.

6. The application of knocking out the tomato response regulator gene SlRRB9 as described in claim 1, or the knockout vector as described in any one of claims 2 to 4, or the engineered bacteria as described in claim 5 in regulating tomato fruit traits, characterized in that, The application is 1) and / or 2): 1) Increase the size of the tomato fruit; 2) Increase the weight of the tomato fruit.

Citation Information

Patent Citations

  • Gene participating in regulation and control of tomato plant height, fruit shape and yield and application thereof

    CN116410986A

  • Application of Solyc11g071810 gene in regulation and control of tomato fruit size

    CN119614609A

  • Application of tomato cytokinin receptor gene SlHK2 and knockout vector thereof in regulation and control of tomato fruit size

    CN120272524A