An application method of using IL1RAP gene as a molecular marker of superovulation trait of cattle
By designing IL1RAP gene-specific primers for PCR amplification and genotyping analysis, the problem of inaccurate IL1RAP gene identification in existing technologies has been solved, enabling early and accurate identification of bovine superovulation traits and improving the accuracy of breeding and the sensitivity of detection.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- ANIMAL HUSBANDRY RES INST OF XINJIANG ACAD OF ANIMAL HUSBANDRY SCI
- Filing Date
- 2026-04-09
- Publication Date
- 2026-06-05
AI Technical Summary
The lack of accurate identification methods based on the genetic polymorphism of the IL1RAP gene in existing technologies makes it impossible for traditional molecular markers to accurately predict the effect of bovine superovulation. Furthermore, they are susceptible to interference from environmental factors and lack strict control over the PCR reaction, which affects the detection sensitivity and specificity.
By designing forward primer IL1RAP fwd and reverse primer IL1RAP rev, PCR amplification was performed using bovine genomic DNA to detect the C-to-T base mutation at position 198 of the IL1RAP gene, obtain the target genotype, and perform association analysis. TT-type individuals were selected as molecular markers for superovulation traits.
It enables early and accurate identification of superovulation traits at the genomic DNA level, overcomes environmental influences, improves the accuracy of breeding and the sensitivity of detection, shortens the generation interval, and enhances the superovulation effect.
Smart Images

Figure CN122146895A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of animal gene detection technology, specifically to a method for using the IL1RAP gene as a molecular marker for superovulation traits in cattle. Background Technology
[0002] In recent years, reproductive technology has been applied in animal husbandry. By improving breeding efficiency and enhancing genetic traits, reproductive technology has become an integral part of the livestock production process. Embryo transfer technology is a reproductive technique in bovine breeding, and superovulation is one of the steps in this process. Superovulation is a complex quantitative trait controlled by multiple genes and regulated by numerous minor-effect genes. Superovulation promotes the proliferation and differentiation of ovarian cells by inducing follicle maturation, increasing vascular permeability, and triggering a local inflammatory response. Inflammatory mediators not only promote follicle rupture but also regulate oocyte maturation, corpus luteum formation, and endometrial receptivity, which are fundamental to successful ovulation and pregnancy preparation.
[0003] Studies have shown that IL1RAP participates in the formation of dimers and transduces signals into the cell, triggering inflammatory pathways and playing a regulatory role in the immune-inflammatory cascade and cell signaling in animals. However, it remains unclear whether IL1RAP affects superovulation in cattle and whether it can be used to predict superovulation in cows. Existing traditional molecular markers are insufficient to comprehensively capture the genetic basis of superovulation, resulting in limited predictive accuracy and failing to meet the needs of precision breeding. Furthermore, traditional breeding methods rely on phenotypic observation, which is easily affected by environmental factors. The lack of an objective classification framework during the breeding process leads to subjective errors in genotype and phenotype interpretation. In addition, existing gene identification procedures lack amplification methods that strictly control reaction systems and temperature and time parameters, making it difficult to accurately obtain target amplified fragments and complete PCR products, thus limiting detection sensitivity and reaction specificity.
[0004] In cattle breeding, there is currently a lack of accurate identification methods based on the genetic polymorphism of the IL1RAP gene, making it impossible to detect single nucleotide polymorphisms caused by base mutations through efficient amplification of genomic DNA. Because the base composition of each genotype is not clearly defined, it is impossible to accurately associate target genotypes with the superovulation trait in cattle, thus limiting the application of single nucleotide polymorphisms as molecular markers in bovine embryonic production and genetic improvement. Therefore, developing a method to utilize the IL1RAP gene as a molecular marker for the bovine superovulation trait is a problem that needs to be solved in this field. Summary of the Invention
[0005] To address the shortcomings of existing technologies, this invention provides a method for using the IL1RAP gene as a molecular marker for superovulation traits in cattle. This method solves the problems of limited accuracy, susceptibility to environmental factors, and lack of early and accurate identification and objective typing of superovulation potential based on single nucleotide polymorphisms in the current cattle breeding process.
[0006] This invention provides a method for using the IL1RAP gene as a molecular marker for bovine superovulation, employing the following technical solution:
[0007] A method for using the IL1RAP gene as a molecular marker for bovine superovulation includes the following steps:
[0008] Genomic DNA was extracted from the blood of the cattle being tested to obtain a genomic DNA template;
[0009] Using the forward primer IL1RAP fwd and the reverse primer IL1RAP rev, PCR amplification was performed on the genomic DNA template to obtain a 457bp amplified fragment with the sequence shown in SEQ ID NO:1, and the PCR product was obtained.
[0010] The PCR product was sequenced, and the single nucleotide polymorphism caused by the C-to-T base mutation at position 198 of the DNA sequence of the PCR product was detected to obtain the target genotype.
[0011] Association analysis was performed between the target genotype and the superovulation trait in cattle. When the target genotype was TT, the cattle individuals with the TT genotype were selected to obtain the target individuals.
[0012] The PCR amplification includes sequential pre-denaturation, cyclic denaturation, annealing and extension, and final extension; the sequence of the forward primer IL1RAP fwd is shown in SEQ ID NO:2, and the sequence of the reverse primer IL1RAP rev is shown in SEQ ID NO:3.
[0013] By employing the above technical solution, which involves extracting bovine genomic DNA and amplifying the target fragment using the forward primer IL1RAPfwd and the reverse primer IL1RAP rev, detecting the C / T single nucleotide polymorphism mutation at position 198 of the interleukin-1 receptor accessory protein gene sequence, and using the TT genotype resulting from this mutation as a selection marker, the following effects are achieved: The interleukin-1 receptor accessory protein gene participates in the immune-inflammatory cascade and cell signal transduction in animals, playing a regulatory role in reproductive physiology processes such as ovarian follicle development, ovulation, and corpus luteum formation. The C / T base mutation at position 198 of the gene sequence can cause changes in gene expression levels or transcriptional regulatory element function, thus significantly affecting the superovulation performance of cows. Using the TT genotype as a molecular marker overcomes the limitations of traditional phenotypic selection based on animal sex, age, and environment, enabling early and accurate identification at the genomic DNA level before determining the phenotype of the target individual. The method significantly shortens the generation interval, improves the accuracy of breeding individuals with superior superovulatory traits, and promotes the expansion and genetic improvement of core cattle herds.
[0014] Preferably, before performing the PCR amplification using the genomic DNA template, the forward primer IL1RAP fwd and the reverse primer IL1RAP rev are designed using biological software targeting the bovine IL1RAP gene fragment, and the forward primer IL1RAP fwd and the reverse primer IL1RAP rev are synthesized to obtain the synthesized primers.
[0015] By adopting the above technical solution and using bioinformatics software to design primers for the target region of the bovine IL1RAP gene, the annealing temperature and GC content of the forward primer IL1RAP fwd and the reverse primer IL1RAP rev can be accurately calculated, and hairpin structures or primer dimer formation can be avoided. This ensures the specific binding of the synthesized primers to the target sequence, avoids non-specific amplification interference, and guarantees the uniformity and accuracy of subsequent sequencing and genotyping results.
[0016] Preferably, the synthesized primers are prepared such that the concentrations of the forward primer IL1RAP fwd and the reverse primer IL1RAP rev are both 10 pmol / μL.
[0017] By employing the above technical solution, the concentrations of the forward primer IL1RAP fwd and the reverse primer IL1RAP rev are uniformly prepared at 10 pmol / μL, providing suitable reaction kinetic conditions in each cycle of the PCR reaction. This concentration ensures effective binding of the synthesized primers to the genomic DNA template during the annealing phase, maintaining the amplification efficiency of the target sequence, while avoiding non-specific binding and excessive consumption of primer dimers due to excessive primer concentration, thus ensuring the stability of the amplification system.
[0018] Preferably, when performing PCR amplification with the genomic DNA template, 10.0 μL of 2×Taq PCRMix, 0.5 μL of the forward primer IL1RAP fwd, 0.5 μL of the reverse primer IL1RAP rev, 0.5 μL of the genomic DNA template, and 8.5 μL of distilled water are mixed to form a reaction system for amplification; wherein the 0.5 μL of the genomic DNA template contains 10 ng to 50 ng of the genomic DNA.
[0019] By adopting the above technical solution, a PCR reaction system with a total sample loading volume of 20.0 μL was established. 2×Taq PCRMix provided an optimized buffer environment, dNTPs, and DNA polymerase; controlling the genomic DNA quality in the genomic DNA template between 10 ng and 50 ng ensured an appropriate target gene copy number to initiate amplification, while effectively avoiding genomic secondary structure entanglement, reaction inhibitor residues, and non-specific banding caused by excessive template quantity, thus achieving a balance between the sensitivity and specificity of the reaction system.
[0020] Preferably, the pre-denaturation temperature is 94°C and the time is 1 min.
[0021] By employing the above technical solution, treatment at 94℃ can disrupt the hydrogen bonds within the double-stranded DNA molecule, causing the genomic DNA template to unwind into a single-stranded state. The 1-minute treatment time ensures the effectiveness of the unwinding process, exposing suitable target sites for primer binding after synthesis, while avoiding long-term high temperatures that could lead to DNA template chain breaks or premature attenuation of polymerase activity, thus laying the template foundation for subsequent cyclic amplification.
[0022] Preferably, the denaturation temperature is 94°C and the time is 45s; the annealing temperature is 60°C and the time is 45s; the extension temperature is 72°C and the time is 45s; the denaturation, annealing and extension are performed in a total of 35 cycles.
[0023] By employing the above technical solution, denaturation at 94℃ for 45 seconds ensures the melting of the product in each round; the annealing parameter at 60℃ for 45 seconds is based on the Tm values of the forward primer IL1RAP fwd and the reverse primer IL1RAP rev, which effectively limits mismatches and achieves specific binding to the target sequence; the extension at 72℃ for 45 seconds conforms to the suitable catalytic temperature and synthesis rate of Taq polymerase, sufficient to synthesize the 457bp amplified fragment. 35 cycles can be completed before the amplification product reaches the plateau phase, obtaining a sufficient amount of the target DNA fragment while keeping the polymerase mismatch mutation rate at a low level.
[0024] Preferably, the final extension temperature is 72°C and the time is 5 minutes.
[0025] By employing the above-mentioned technical solution, maintaining the reaction at 72°C for 5 minutes after all cycles can ensure that all incompletely extended single-stranded PCR products in the reaction system complete the double-stranded structure. Furthermore, the process can utilize the template-independent terminal transferase activity of Taq polymerase to add deoxyadenine to the 3' end of the PCR product, ensuring the integrity and uniformity of the final PCR product.
[0026] Preferably, after obtaining the PCR product, the PCR product is detected by 1.5% agarose gel electrophoresis, and the PCR product has an electrophoretic band at the 457bp position.
[0027] By employing the above technical solution, 1.5% agarose gel concentration provides good resolution for DNA fragments in the 400bp to 500bp range. Electrophoresis detection can verify the specificity of the PCR amplification and the accuracy of the fragment length, ensuring that the PCR products submitted for sequencing are free of primer dimers or non-specific interference, thereby guaranteeing the clarity and accuracy of the single nucleotide polymorphism (SNP) sequencing map.
[0028] Preferably, the target genotype includes CC, CT, and TT.
[0029] By employing the above technical solution, three allele combinations of the target single nucleotide polymorphism (SNP) site in the cattle herd were identified, covering the population genetic distribution characteristics of this site. This classification provides a corresponding genetic classification framework for calculating genotype frequencies and allele frequencies, as well as for subsequent association analysis of productive traits.
[0030] Preferably, the CC type is a homozygous form of the DNA sequence of the PCR product with a C base at position 198; the CT type is a heterozygous form of the DNA sequence of the PCR product with a C base and a T base at position 198; and the TT type is a homozygous form of the DNA sequence of the PCR product with a T base at position 198.
[0031] By employing the above technical solutions, the specific base composition of each genotype at the molecular sequence level was defined. By clarifying the base characteristics of homozygotes and heterozygotes, an objective standard was provided for interpreting the chromatograms of sequencing results, avoiding subjective errors in genotype interpretation and ensuring the data rigor and reliability of identifying bovine superovulation traits using molecular markers.
[0032] This invention provides a method for using the IL1RAP gene as a molecular marker for bovine superovulation. It has the following beneficial effects:
[0033] 1. This invention utilizes the forward primer IL1RAP fwd and the reverse primer IL1RAP rev to perform PCR amplification with a genomic DNA template. It detects single nucleotide polymorphisms (SNPs) caused by C-to-T base mutations in the obtained amplified fragments, and performs association analysis between the obtained target genotype and the superovulation trait in cattle. When the target genotype is TT, cattle individuals with the TT genotype are selected for testing. This clarifies the effect of SNPs on the superovulation trait in cattle and realizes the application of the IL1RAP gene as a molecular marker for the superovulation trait.
[0034] 2. This invention designs and synthesizes forward primer IL1RAP fwd and reverse primer IL1RAP rev targeting the bovine IL1RAP gene fragment. By strictly controlling the content of genomic DNA in the PCR amplification reaction system and combining it with sequential pre-denaturation, cyclic denaturation, annealing and extension, and final extension reaction conditions, the amplified fragment can be accurately obtained and PCR products can be obtained. This provides a complete template basis for subsequent sequencing and single nucleotide polymorphism detection, and improves the overall amplification sensitivity and reaction specificity of the method.
[0035] 3. This invention defines the target genotype as CC, CT, and TT by sequencing the PCR products. It clarifies that the CC type is a homozygous genotype containing a C base, the CT type is a heterozygous genotype containing both C and T bases, and the TT type is a homozygous genotype containing a T base. This provides an objective classification framework for single nucleotide polymorphism typing, avoids subjective errors in genotype interpretation, ensures the data rigor of bovine superovulation trait association analysis, and guarantees the reliability of the final identification of the target individuals. Attached Figure Description
[0036] Figure 1 This is an agarose gel electrophoresis image of the IL1RAP gene amplification product of this invention;
[0037] Figure 2 This is a sequencing peak diagram of the PCR products of three genotype individuals in this invention;
[0038] Figure 3 This is an agarose gel electrophoresis image of the IL1RAP gene amplification product in the test example of this invention;
[0039] Figure 4 This is a sequencing peak diagram of the PCR products of three genotypes in the test examples of this invention. Detailed Implementation
[0040] The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0041] Preparation example:
[0042] This preparation example provides a pair of specific primers for amplifying the bovine IL1RAP gene fragment, including the following steps:
[0043] A pair of specific primers targeting the bovine IL1RAP gene fragment were designed using the biological software Oligo 6.0. The primer sequences include the forward primer IL1RAP-fwd (SEQ ID NO:2) and the reverse primer IL1RAP-rev (SEQ ID NO:3).
[0044] The designed forward and reverse primers were synthesized to obtain the synthesized primers.
[0045] The synthesized forward and reverse primers were prepared separately to a concentration of 10 pmol / μL to obtain specific primers for subsequent PCR amplification.
[0046] Example:
[0047] This embodiment provides a method for using the IL1RAP gene as a molecular marker for bovine superovulation, including the following steps:
[0048] S01. Genomic DNA was extracted from bovine blood as a template;
[0049] S02. Using the specific forward primer IL1RAP fwd (SEQ ID NO:2) and reverse primer IL1RAP rev (SEQ ID NO:3), PCR amplification was performed using the extracted bovine genomic DNA as a template to obtain a 457bp specific amplified fragment as shown in SEQ ID NO:1.
[0050] The specific reaction system for PCR amplification is as follows: 10.0 μL of 2×Taq PCR Mix, 0.5 μL each of forward and reverse primers with a concentration of 10 pmol / μL, 0.5 μL of template containing 10-50 ng of genomic DNA, and 8.5 μL of distilled water.
[0051] The PCR amplification reaction conditions were as follows: 94℃ pre-denaturation for 1 min; 94℃ denaturation for 45 s, 60℃ annealing for 45 s, 72℃ extension for 45 s, for a total of 35 cycles; final extension at 72℃ for 5 min. The amplification products were detected by 1.5% agarose gel electrophoresis, and the results are shown in the attached figure. Figure 1 As shown, there is a distinct and specific band at the 457bp position;
[0052] S03. The PCR products obtained above were sequenced. A C-to-T base mutation at position 198 of the DNA sequence of the PCR product fragment led to a single nucleotide polymorphism. The specific genotype was determined by sequencing. Among them, individuals of the CC type were homozygous for C at position 198, individuals of the CT type were heterozygous for C and T at position 198, and individuals of the TT type were homozygous for T at position 198. The sequencing peak diagrams of the PCR products of the three genotypes are attached. Figure 2 As shown;
[0053] S04. Correlation analysis was performed between the different genotypes shown in the test results and the superovulation trait in cattle. Individuals with the TT genotype were selected to obtain better superovulation results.
[0054] Test example:
[0055] Experimental description:
[0056] To test and verify the effectiveness of the embodiments, 53 experimental cattle individuals were selected for comprehensive testing, aiming to explore the specific influence of IL1RAP gene polymorphism at a specific site on the superovulation trait in cattle.
[0057] Experimental steps:
[0058] The genomic DNA of 53 experimental cattle was amplified using the method described in the example, and the amplification products were then detected by 1.5% agarose gel electrophoresis.
[0059] The amplified products that passed the agarose gel electrophoresis test were recovered and sequenced. At the same time, the genotypes were identified based on the sequencing peak diagram, and the number of individuals for each genotype was counted.
[0060] We collected and combined superovulation-related records from these 53 experimental cattle, and performed trait association analysis using one-way ANOVA in SPSS 22.0 software.
[0061] An association analysis model was established, in which the phenotypic value of production performance of the observed individuals was equal to the sum of the least squares mean of production performance and the effect value of genotype on production performance, and the random residuals corresponding to the observed values were added, thereby obtaining the specific differences in superovulation traits among individuals with different genotypes.
[0062] Experimental data:
[0063] Table 1. Results of analysis on significant differences in superovulation traits among individuals with different genotypes
[0064] Superovulation traits CC type individuals CT type individuals TT type individuals Number of usable embryos per head 3.86±0.87a 4.50±0.94b 8.88±0.71c Total number of embryos per head 7.18±1.04a 11.21±1.30b 15.82±0.88c
[0065] Note: Different letters on the shoulder labels of different groups of data indicate significant differences, P<0.05.
[0066] Experimental conclusion:
[0067] Combined with appendix Figure 3 As can be seen, after electrophoresis detection, the amplified products of this experimental population all showed a specific band at the 457bp position, indicating that the primers designed in this invention can accurately and stably amplify the target fragment.
[0068] Combined with appendix Figure 4 The sequencing peak diagram shows that three different genotypes exist at the specific mutation site indicated by the arrow, namely CC, CT, and TT, which further confirms that a single nucleotide polymorphism mutation from cytosine to thymine does indeed exist at this site. According to the experimental data in Table 1, the average number of usable embryos per head in the TT-type experimental cattle reached 8.88, and the average number of total embryos per head reached 15.82. Both of these key indicators are significantly better than those in the CT and CC types of experimental cattle.
[0069] Superovulation in cattle induces rapid follicle maturation and causes local tissue damage, leading to a local physiological inflammatory response. The IL1RAP gene, a key molecule in the inflammatory signaling pathway, exhibits genetic regulatory changes due to polymorphic mutations that significantly impact superovulation outcomes. Individuals with the TT genotype better optimize the efficiency of inflammatory signaling pathways, regulate oocyte maturation and endometrial receptivity, thus phenotypically increasing the number of usable embryos and the total number of embryos during superovulation.
[0070] In summary, in the selection process of superovulation donors in bovine breeding, the overall superovulation effect can be steadily improved by using this molecular marker to detect and prioritize individuals with the TT genotype in advance, while avoiding the selection of CC genotype individuals as much as possible.
[0071] Appendix: IL1RAP gene nucleotide sequence:
[0072] SEQ ID NO:1:
[0073] AGAGAAGCCTGGAAGGTTGTAGTCCACGGAGTTGCAAAGAGTCAGACATGACTGAAGCAACTTAGCATGCACACCATGATCAAGTGTATAGAAAATGCTAAGACCACACACACACACCAAAAACAGAAACCCTATTTAATTAGTGAATTTGGAAAGGTCAAATGGCCATAAAAGTTAATTCCATGTTCTTTTTTTTTCACAAATGTGCAATTTGAAAATGAAAACATTT AAATATTATATATGAAAGCATCAACAACATAACAGAGATAAATTTAACAATATGTGTGAAAGACTTGAAACCAAAAAAGAAAGACAAGCATTGCTGAGGATATTCAATTAGTCCTAAATAAATTGAGACATCATGTTAATGAATTTAAAAACTCAATATTGCTAAAATTTCAATTCCCATTGAATCGATTTATAAATGAATTTGCAATTCCAATCAAATCACAGGAGC.
[0074] Forward primer IL1RAP fwd nucleotide sequence:
[0075] SEQ ID NO:2:
[0076] AGAGAAGCCTGGAAGGTTGTAG.
[0077] Reverse primer IL1RAP rev nucleotide sequence:
[0078] SEQ ID NO:3:
[0079] GCTCCTGTGATTTGATTGGAA.
Claims
1. A method for using the IL1RAP gene as a molecular marker for bovine superovulation, characterized in that, Includes the following steps: Genomic DNA was extracted from the blood of the cattle being tested to obtain a genomic DNA template; Using the forward primer IL1RAP fwd and the reverse primer IL1RAP rev, PCR amplification was performed on the genomic DNA template to obtain a 457bp amplified fragment with the sequence shown in SEQ ID NO:1, and the PCR product was obtained. The PCR product was sequenced, and the single nucleotide polymorphism caused by the C-to-T base mutation at position 198 of the DNA sequence of the PCR product was detected to obtain the target genotype. Association analysis was performed between the target genotype and the superovulation trait in cattle. When the target genotype was TT, the cattle individuals with the TT genotype were selected to obtain the target individuals. The PCR amplification includes sequential pre-denaturation, cyclic denaturation, annealing and extension, and final extension; The sequence of the forward primer IL1RAP fwd is shown in SEQ ID NO:2, and the sequence of the reverse primer IL1RAP rev is shown in SEQ ID NO:
3.
2. The application method according to claim 1, characterized in that, Before performing the PCR amplification using the genomic DNA template, the forward primer IL1RAP fwd and the reverse primer IL1RAP rev were designed using biological software targeting the bovine IL1RAP gene fragment, and the forward primer IL1RAP fwd and the reverse primer IL1RAP rev were synthesized to obtain the synthesized primers.
3. The application method according to claim 2, characterized in that, The synthesized primers were prepared such that the concentrations of the forward primer IL1RAP fwd and the reverse primer IL1RAP rev were both 10 pmol / μL.
4. The application method according to claim 2, characterized in that, When performing PCR amplification with the genomic DNA template, 10.0 μL of 2×Taq PCR Mix, 0.5 μL of the forward primer IL1RAP fwd, 0.5 μL of the reverse primer IL1RAP rev, 0.5 μL of the genomic DNA template, and 8.5 μL of distilled water are mixed to form a reaction system and then amplified. The 0.5 μL of the genomic DNA template contains 10 ng to 50 ng of the genomic DNA.
5. The application method according to claim 1, characterized in that, The pre-denaturation temperature was 94°C, and the time was 1 minute.
6. The application method according to claim 5, characterized in that, The denaturation temperature was 94°C, and the time was 45 seconds. The annealing temperature is 60°C and the time is 45 seconds; The extension was performed at a temperature of 72°C for 45 seconds. The cycle involves 35 cycles of modification, annealing, and extension.
7. The application method according to claim 6, characterized in that, The final extension was performed at a temperature of 72°C for 5 minutes.
8. The application method according to claim 1, characterized in that, After obtaining the PCR product, the PCR product was detected by 1.5% agarose gel electrophoresis, and the PCR product showed an electrophoretic band at the 457bp position.
9. The application method according to claim 1, characterized in that, The target genotypes include CC, CT, and TT.
10. The application method according to claim 9, characterized in that, The CC type is a homozygous form of the DNA sequence of the PCR product with a C base at position 198. The CT type is a hybrid of the DNA sequence of the PCR product, with C and T bases at position 198. The TT type is a homozygous form of the DNA sequence of the PCR product with a T base at position 198.