Methods for detecting chicken infectious anemia virus and related kits

By utilizing the oxidoreductase properties of the tetrastranded DNA in the genome of chicken infectious anemia virus, a colorimetric reaction was developed, simplifying the detection process and solving the problems of high equipment dependence and poor specificity in existing technologies. This resulted in rapid and low-cost detection.

CN122146941APending Publication Date: 2026-06-05HORIZON OMICS BIOTECH LTD +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
HORIZON OMICS BIOTECH LTD
Filing Date
2026-04-13
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Existing methods for detecting chicken infectious anemia virus rely on complex equipment and are costly, involve complicated operating techniques, and have poor specificity, making them difficult to widely apply in primary laboratories.

Method used

By utilizing the naturally occurring quadruplex DNA sequence in the genome of chicken infectious anemia virus, an oxidoreductase active complex is formed through isothermal amplification. This complex is then combined with a chromogenic substrate for naked-eye visual detection, avoiding non-specific amplification in primer design and simplifying the operation process.

Benefits of technology

It enables rapid, simple, and low-cost detection of chicken infectious anemia virus in grassroots laboratories, improving the specificity and sensitivity of the detection, and is suitable for rapid on-site screening.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application provides a detection method and kit for chicken infectious anemia virus based on the nature of four-strand DNA oxidoreductase. The method uses isothermal amplification technology to amplify the genomic fragment containing the four-strand DNA sequence in the genome of chicken infectious anemia virus, and realizes rapid and visual detection of chicken infectious anemia virus by adding hematin and oxidoreductase substrate for color reaction.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Related applications

[0002] This application claims priority and related benefits to Chinese Patent Application No. 202510465607.5, filed on April 14, 2025, the entire contents of which are incorporated herein by reference. Invention Field

[0003] This application relates to the field of pathogen detection technology. Specifically, this application provides a method and corresponding kit for detecting chicken infectious anemia virus based on the properties of tetrastranded DNA oxidoreductase. Background of the Invention

[0004] Infectious anemia in chickens was discovered in Japan in 1979, and the pathogen was successfully identified. Since then, infectious anemia has appeared in various countries worldwide. In my country, the virus was discovered in 1992, and its spread within the country was confirmed. Infectious anemia and its various complications have a significant impact on my country's poultry farming industry, especially on broiler farms. Current methods for detecting infectious anemia in chickens mainly include polymerase chain reaction (PCR), real-time fluorescent PCR (qPCR), and loop-mediated isothermal amplification (LAMP) techniques, as described below.

[0005] Polymerase chain reaction (PCR): This method relies on PCR instruments for amplification, and the products are identified by electrophoresis after amplification. It is highly technical, requiring sophisticated laboratory equipment, high-quality reagents, and skilled operators. The electrophoresis process is time-consuming and necessitates the use of specialized equipment such as electrophoresis apparatus and gel imaging systems.

[0006] Real-time fluorescence PCR (qPCR): This method uses a Q-PCR instrument for amplification and identification. The equipment and reagents used are expensive, limiting its widespread application in primary laboratories. Furthermore, the operation is complex, requiring specialized training and demanding high skill levels from the testing personnel.

[0007] Loop-mediated isothermal amplification (LAMP): This technique uses isothermal amplification and does not rely on complex equipment. However, product identification usually requires electrophoresis or staining with non-specific dyes, resulting in poor specificity and a high false-positive rate. Existing methods combining isothermal LAMP amplification and the redox properties of quadruplex DNA for nucleic acid detection involve designing quadruplex DNA into the primers, leading to non-specific amplification being identified as positive.

[0008] Therefore, these existing methods all have some limitations. Developing a simple, rapid, and effective detection method is of great significance for rapid on-site screening of chicken infectious anemia virus. Summary of the Invention

[0009] This application utilizes the naturally occurring quadruplex DNA sequence in the genome of chicken infectious anemia virus. The amplified product combines with heme chloride to form a complex with oxidoreductase activity, catalyzing a color change in the chromogenic substrate, enabling naked-eye visual detection. The operation is simple, and neither amplification nor identification requires expensive instruments. The inventors of this application also unexpectedly discovered that directly amplifying endogenous quadruplex sequences in the microbial genome avoids the risk of non-specific recognition caused by introducing exogenous quadruplex structures in primer design. By designing the quadruplex DNA into the product, non-specific amplification will not be recognized, significantly improving detection specificity.

[0010] On the one hand, this application provides a method for detecting chicken infectious anemia virus, which includes the following steps: 1) Amplify the specific nucleic acid fragments in chicken infectious anemia virus that can form quadruplex DNA to obtain quadruplex DNA products.

[0011] 2) Add heme and oxidoreductase substrate to the obtained quadruplex DNA product and determine the presence of chicken infectious anemia virus by colorimetric reaction.

[0012] In some embodiments, the quadruplex DNA product has oxidoreductase activity, which can colorimetrically react with the substrate.

[0013] In some implementations, the above detection method further includes analyzing, prior to step 1), whether there are species-specific nucleic acid fragments in the chicken infectious anemia virus that can form a quadruplex DNA structure.

[0014] In some implementations, the above detection method further includes analyzing, prior to step 1), whether there is a species-specific nucleic acid fragment in the chicken infectious anemia virus that can form a quadruplex DNA structure, and the quadruplex DNA structure has oxidoreductase activity that can colorimetrically react with the substrate.

[0015] In some embodiments, the amplification is isothermal amplification. In a preferred embodiment, loop-mediated isothermal amplification (LAMP) is used for amplification.

[0016] In some embodiments, the oxidoreductase substrate is 3,3',5,5'-tetramethylbenzidine (TMB) and hydrogen peroxide (H2O2).

[0017] On the other hand, this application provides a kit for the aforementioned detection method of chicken infectious anemia virus, which includes: reagents for amplification reaction; heme; and oxidoreductase substrate, etc.

[0018] In some implementations, the reagents used for the amplification reaction include amplification primers, amplification reaction buffers, polymerases, etc.

[0019] In some implementations, the reagent used for the amplification reaction is a LAMP amplification reagent. Brief description of the attached figures

[0020] Figure 1 The results show the combined isothermal amplification and four-stranded DNA redox properties detection of chicken infectious anemia virus, including amplification bands and colorimetric results for chicken infectious anemia virus of different copy numbers.

[0021] Figure 2A-2B The image shows amplification bands specific to chicken infectious anemia virus primers, obtained by combining isothermal amplification and the redox properties of quadruplex DNA. Figure 2A ) and color development results ( Figure 2B ). Detailed Implementation

[0022] This application provides a rapid detection method and kit for chicken infectious anemia virus based on the oxidoreductase properties of tetrastranded DNA. The method utilizes the oxidoreductase properties of tetrastranded DNA to achieve rapid and visual detection of chicken infectious anemia virus through isothermal amplification and colorimetric reactions.

[0023] In the specific implementation plan, this application amplifies the sequence of quadruplex DNA in the genome of chicken infectious anemia virus using isothermal amplification technology, and then uses heme and oxidoreductase substrates (such as H2O2, TMB) for colorimetric reaction. The result is judged by observing the color change with the naked eye, which does not require complicated instruments and equipment and reduces the detection cost.

[0024] Quadruplex DNA (G-quadruplex DNA) is a special nucleic acid structure, unlike the traditional double-stranded DNA structure. It is an atypical structure formed by the folding of a guanine (G)-rich DNA sequence. The core of quadruplex DNA is a planar structure called a G-tetrad, formed by four guanine residues interacting through hydrogen bonds. Each G-tetrad consists of four Gs linked by eight hydrogen bonds, forming a stable plane. Multiple G-tetrads can stack together to form the overall structure of quadruplex DNA. Quadruplex DNA can interact with certain oxidoreductases (such as peroxidases) and participate in redox reactions. For example, quadruplex DNA can bind heme, forming a peroxidase-like active site that catalyzes the decomposition of H₂O₂ and the oxidation of TMB, producing a blue product.

[0025] The structure of G-quadruplexes can be predicted and verified using conventional methods in this field. For example, specialized G-quadruplex prediction tools such as QGRS Mapper, G4Hunter, and G4-Explorer can be used to analyze whether structures that may form G-quadruplexes exist in the sequence. For example, the structure and stability of G-quadruplexes can be verified using methods such as DNase I footprinting, fluorescence resonance energy transfer (FRET), nuclear magnetic resonance (NMR), X-ray crystallography, or thermal stability analysis.

[0026] In the specific implementation plan, this application designs the quadruplex DNA in the amplification product rather than in the primer, which effectively avoids interference from non-specific amplification and improves the specificity of detection.

[0027] In a specific implementation plan, the detection method of this application may include: extracting nucleic acid from the pathogenic microorganism from the sample to be tested; designing LAMP primers targeting the specific nucleic acid sequence (including quadruplex DNA) of the target pathogenic microorganism to perform isothermal amplification of the extracted nucleic acid; adding heme and oxidoreductase substrates (such as H2O2, TMB) to the amplification product to catalyze a colorimetric reaction; and observing the color change of the reaction solution with the naked eye to determine whether the sample contains the target pathogenic microorganism. A positive reaction is blue, and a negative reaction is colorless.

[0028] In a specific implementation, the kit of this application may include: amplification reagents for chicken infectious anemia virus specific nucleic acid sequences (containing quadruplex DNA), including LAMP primers, amplification reaction buffers, polymerases, etc.; heme; oxidoreductase substrates such as TMB and H2O2; and optional other buffers such as NaH2PO4 buffer.

[0029] The detection method and kit of this application are simple to operate. From nucleic acid extraction to result determination, no complicated equipment or cumbersome steps are required, making them suitable for application in scenarios such as primary laboratories and rapid on-site testing.

[0030] In specific implementation schemes, the detection methods and kits of this application are suitable for rapid detection of chicken infectious anemia virus. For example, the entire process from sample processing to result interpretation can be completed in about 1 hour, achieving efficient detection.

[0031] In a specific implementation, the method and kit of this application are capable of detecting chicken infectious anemia virus. Preferably, the specific nucleic acid sequence of chicken infectious anemia virus used for detection is shown in SEQ ID NO:1.

[0032] In this specification and claims, the words “comprising,” “including,” and “containing” mean “including but not limited to” and are not intended to exclude other parts, additives, components, or steps.

[0033] It should be understood that the features, characteristics, components or steps described in a particular aspect, embodiment or example of this application may be applied to any other aspect, embodiment or example described herein, unless there is any contradiction.

[0034] The foregoing disclosure generally describes the present invention, and the following embodiments further illustrate the invention. These embodiments are described merely to illustrate the invention and not to limit its scope. Although specific terms and values ​​are used herein, they are also to be understood as exemplary and do not limit the scope of the invention. Unless otherwise specified, the reagents, experimental methods, and techniques used in the embodiments are known in the art.

[0035] Example

[0036] Example 1: Sensitivity Detection of Chicken Infectious Anemia Virus Amplification

[0037] This embodiment verifies the detection of chicken infectious anemia virus (CIAV) using the method described in this application. First, a specific fragment of chicken infectious anemia virus containing quadruplex DNA was synthesized and cloned into the vector PUC57. The detected CIAV sequence is as follows: ATGGCAAGACGAGCTCGCAGACCGAGAGGCAGATTTTACGCCTTCAGAAGAGGACGGTGGCACAACCTCAAGCGACTTCGACGAAGATATAAATTTCGACATCGGAGGAGACAGCGGTATCGTAGACGAGCTTTTAGGAAGGCCTTTCACAACCCCCGCCCCGGTACGTATAGTGTGAGACTGCCGAACCCCCAGTCAACGATGACTATCCGCTTTCAAGGCATCATTTTTCTTACCGAAGGACTCATTCTACCTAAAAACAGTACAGCGGGGGGATATGCAGACCACCTCTACGGGGCGAGAGTCGCCAAGATCTCAGTGAACCTGAAAGAGTTCCTGCTAGCGTCAATGAACCTGACATACGTGAGCAAAATCGGAGGCCCCATCGCCGGTGAGTTAATTGCGGACGGGTCTAAATCACAAGCCGCGGAGAATTGGCCTAACTGTTGGCTGCCGCTAGACAATAACGTGCCCTCCGCGACACCATCGGCATGGTGGAGATGGGCTTTAATGATGATGCAGCCCACGGACTCTTGCCGGTTCTTTAATCACCCTAAACAAATGACCCTGCAAGACATGGGTCGGATGTTTGGGGGCTGGCACCTGTTCCGACACATTGAAACCCGCTTTCAGCTCCTTGCCACTAAGAATGAGGGATCCTTCAGCCCCGTGGCG(SEQ ID NO:1) Perform LAMP amplification, and the primer sequences are as follows: VP1-G42-FIP: GTCGCGGAGGGCACGTTATTCAAGCCGCGGAGAATTGG(SEQ ID NO:2); VP1-G42-BIP: TAATGATGATGCAGCCCACGGAAACATCCGACCCATGTCTTG(SEQ ID NO:3); VP1-G42-F3: TCGCCGGTGAGTTAATTGC(SEQ ID NO:4); VP1-G42-B3: TCAATGTGTCGGAACAGGTG(SEQ ID NO:5); VP1-G42-LF: GCGGCAGCCAACAGTTAGG (SEQ ID NO: 6); VP1-G42-LB:TTGCCGGTTCTTAATCACCCTAAA (SEQ ID NO:7).

[0038] Add primers and plasmid template (10 1 ~10 8 The amplification reaction was carried out by mixing LAMP buffer, dNTPs, and Bst 3.0 polymerase (copy), LAMP buffer, dNTPs, and Bst 3.0 polymerase. Then, a redox reaction was carried out: a mixture of heme and acidic NaH2PO4 buffer was added to the amplification product, mixed well, and then a mixture of TMB and H2O2 was added and mixed well.

[0039] Result interpretation: A positive reaction is blue, a negative reaction is colorless. See also Figure 1 The EP tubes from left to right represent the negative control and an 8.8×10⁻⁶ tube, respectively. 8 Copy / μL, 8.8×10 7 Copy / μL, 8.8×10 6 Copy / μL, 18.8×0 5 Copy / μL, 8.8×10 4 Copy / μL, 8.8×10 3 Copy / μL, 8.8×10 2 Copy / μL and 8.8×10 1 Copies / μL, capable of detecting down to 10 2 Chicken infectious anemia virus (TIA) copies / μL.

[0040] In addition, the amplified products will be subjected to electrophoresis under the following conditions: 200V, 150mA, 30 minutes.

[0041] The results showed that using 10 2 copy / μL-10 8 Amplification bands were observed in viral plasmids at concentrations of copies / μL. See [link / reference]. Figure 1 .

[0042] Example 2: Specific detection of chicken infectious anemia virus amplification primers

[0043] LAMP amplification was performed according to Example 1. Whole-genome DNA was extracted from healthy chicken tissue using a genomic extraction kit. A laboratory-synthesized CIAV-VP1 plasmid was used as a positive control. A 25 μl amplification system was used, and amplification was performed at 63°C for 30 min. The positive group amplified the target plasmid DNA, while no amplification band was observed in the healthy chicken tissue. A 25 mM NaH2PO4 buffer with a pH <1 was prepared, and 0.9 μL of heme was added. Then, 22 μL of NaH2PO4 buffer was added, mixed well, and 100 μL of TMB chromogenic solution (containing H2O2) was added and mixed thoroughly. The mixture was then incubated in the dark for 20 min.

[0044] See electrophoresis and colorimetric results. Figures 2A-2B The reaction system using healthy chicken genomic DNA as a template showed neither amplification bands nor colorimetric reaction, demonstrating that the primers used had good specificity.

[0045] The above experimental results show that the method described in this application can accurately detect chicken infectious anemia virus and has high specificity and sensitivity.

[0046] Various changes and equivalent substitutions may be made to the embodiments disclosed in this application without departing from the spirit and scope of this disclosure. Unless the context otherwise requires, any feature, step, or embodiment of the embodiments disclosed herein may be used in combination with any other feature or embodiment.

Claims

1. A method for detecting avian infectious anemia virus, comprising the following steps: 1) Amplify the specific nucleic acid fragments in chicken infectious anemia virus that can form quadruplex DNA to obtain quadruplex DNA products; 2) Add heme and oxidoreductase substrate to the obtained quadruplex DNA product and determine the presence of infectious anemia in chickens by colorimetric reaction.

2. The method according to claim 1, further comprising: Before step 1), analyze whether there are species-specific nucleic acid fragments in the chicken infectious anemia virus that can form a quadruplex DNA structure.

3. The method according to claim 2, wherein the quadruplex DNA structure has oxidoreductase activity and is capable of colorimetrically reacting with the substrate.

4. The method according to claim 1 or 2, wherein the amplification is isothermal amplification.

5. The method according to claim 4, wherein the amplification employs loop-mediated isothermal amplification (LAMP).

6. The method according to any one of claims 1-5, wherein the oxidoreductase substrate is 3,3',5,5'-tetramethylbenzidine (TMB) and hydrogen peroxide (H2O2).

7. A kit for detecting chicken infectious anemia virus according to any one of claims 1-6, comprising: Reagents used for amplification reactions; heme and oxidoreductase substrates.

8. The kit according to claim 7, wherein the reagents for the amplification reaction include amplification primers, amplification reaction buffer, polymerase, etc.