Genetically engineered streptomyces albus for high yield of epsilon-polylysine and its fermentation production process
By genetically engineering Streptomyces albopictus, integrating specific gene expression cassettes and two-stage pH control, the problems of cytotoxicity and product degradation in ε-polylysine fermentation have been solved, achieving high efficiency, high yield, and molecular weight uniformity, making it suitable for the food and pharmaceutical industries.
Patent Information
- Application Number
- CN202610231963.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-27
- Publication Date
- 2026-06-09
AI Technical Summary
In existing ε-polylysine fermentation production, high concentrations of the product lead to high cytotoxicity of the microbial cells, intracellular accumulation causing feedback inhibition, and the product being easily degraded by endogenous enzymes in the later stages of fermentation, resulting in low final yield and poor molecular weight uniformity.
Using genetically engineered Streptomyces albopictus, we integrated the expression cassettes of ppc, asd, dapF and heterologous lysP genes, combined with the D404A/K499A mutant Pls enzyme, and constructed an active efflux channel and inhibited endogenous enzyme activity through tolerance acclimatization and a two-stage pH control strategy, thus optimizing the catalytic pathway of the synthase.
It improves the synthesis efficiency and molecular weight uniformity of ε-polylysine, meets high-end application standards, is suitable for large-scale industrial production, and complies with biosafety regulations.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] This invention relates to the fields of bioengineering and fermentation engineering technology, specifically to a genetically engineered white Streptomyces strain that produces high levels of ε-polylysine and its fermentation production process. Background Technology
[0002] ε-Polylysine (ε-PL) is a homopolymer composed of L-lysine residues linked by amide bonds between α-carboxyl and ε-amino groups. Due to its broad-spectrum antibacterial properties, good water solubility, thermal stability, and safety by being degraded into essential amino acids in the human body, it is widely used in food preservation, biomedicine, and biomaterials. Currently, aerobic fermentation using Streptomyces, particularly Streptomyces albopictus, is the main method for the industrial production of ε-polylysine.
[0003] Although existing microbial fermentation technologies have reached a certain scale, achieving high-yield and high-quality production of ε-polylysine still faces numerous bottlenecks at the biological mechanism and process control levels. Firstly, ε-polylysine itself possesses the characteristics of a cationic surfactant, exhibiting cytotoxicity to the producing strains. During fermentation, as the product concentration accumulates, high concentrations of ε-polylysine interact with the negatively charged microbial cell membrane, leading to cell membrane damage, altered permeability, and consequently, metabolic disorders and even autolysis and death. This autotoxic effect severely limits the cell growth density and the duration of product synthesis, resulting in a significant decrease in production intensity in the later stages of fermentation.
[0004] The biosynthesis of ε-polylysine is subject to strict metabolic regulation, and excessive accumulation of intracellular products or precursors often leads to feedback inhibition of key synthases. Since natural strains typically lack efficient efflux mechanisms, synthesized ε-polylysine is difficult to transfer to the extracellular space in a timely manner, resulting in excessively high local intracellular concentrations. This not only exacerbates cytotoxicity but also directly inhibits the catalytic activity of the synthase, limiting the efficiency of substrate-to-product conversion.
[0005] The genomes of *Streptomyces albopictus* commonly contain genes encoding ε-polylysine degrading enzymes (such as *Pld*). In conventional fermentation processes, to maintain cell growth, the environmental pH is usually controlled within the physiological neutral range, which is often also the high activity range of degrading enzymes. This leads to a common phenomenon of simultaneous synthesis and degradation during fermentation. Some synthesized long-chain polymers are hydrolyzed and broken down by degrading enzymes, resulting not only in a loss of total product volume but also in a wider molecular weight distribution and decreased polymerization uniformity of the final product, making it difficult to meet the stringent quality stability requirements of high-end applications. Existing strain modification or process optimization methods often struggle to simultaneously address the aforementioned issues of cytotoxicity, feedback inhibition, and product degradation. Summary of the Invention
[0006] To address the shortcomings of existing technologies, this invention provides a genetically engineered Streptomyces albopictus strain that produces high levels of ε-polylysine and its fermentation process. This invention solves the problems in existing ε-polylysine fermentation production, such as high cytotoxicity and premature aging of the bacterial cells due to high concentrations of the product, feedback inhibition caused by intracellular accumulation, and easy degradation of the product by endogenous enzymes in the later stages of fermentation, resulting in low final yield and poor molecular weight uniformity.
[0007] To achieve the above objectives, the present invention provides the following technical solution:
[0008] In a first aspect, the present invention provides a genetically engineered white Streptomyces strain that produces high levels of ε-polylysine, employing the following technical solution: A genetically engineered *Streptomyces albopictus* strain that produces high levels of ε-polylysine is based on a *Streptomyces albopictus* strain domesticated to ε-polylysine tolerance. The strain integrates the following gene expression cassette into its genome: phosphoenolpyruvate carboxylase gene. ppc Overexpression cassette; heterologous aspartate semialdehyde dehydrogenase gene asd Expression cassette; diaminopimelic acid ester epimerase gene dapF Overexpression cassette; fusion gene expression cassette, the fusion gene comprising an L-lysine transporter gene linked to a secretion signal peptide. lysP Heterologous ε-polylysine synthase gene pls The expression box, the pls The amino acid sequence encoded by the gene has a mutation where aspartic acid at position 404 is replaced by alanine, and lysine at position 499 is replaced by alanine.
[0009] By adopting the above technical solution, this invention achieves multi-dimensional synergistic effects: the tolerance-acclimated chassis can resist the osmotic pressure stress of high-concentration cationic polymers, ensuring bacterial survival; overexpression ppc , dapF and heterogeneous asd It enhances the metabolic flux of the aspartate family and increases the supply capacity of the precursor L-lysine; LysP, containing a signal peptide, constructs an active efflux channel in the cell membrane, pumping the product out of the cell in a timely manner, effectively relieving intracellular toxicity and feedback inhibition; the D404A / K499A dual-site mutation of Pls optimizes the enzyme's microstructure and electron transport pathway, improving the catalytic conversion rate.
[0010] Preferably, the tolerance acclimatization refers to continuously subculturing the starting strain in a medium containing gradient concentrations of ε-polylysine until a mutant strain tolerant to 30.0 g / L to 40.0 g / L ε-polylysine is obtained. The strains screened using this method break through the tolerance limits of the wild-type strain, laying a physiological foundation for high-concentration fermentation.
[0011] Preferably, the gene asd Derived from *Teslina motilityis*; the gene... lysP Derived from Escherichia coli; the gene pls Derived from *Streptomyces albopictus*; each gene sequence was optimized according to the codon bias of *Streptomyces albopictus*. This ensures efficient transcription and translation of the foreign gene in the host.
[0012] Preferably, in the fusion gene, the secretory signal peptide is a signal peptide of an endogenous protein from *Streptomyces albopictus*; the inclusion of the secretory signal peptide refers to linking the coding sequence of the secretory signal peptide to the 5' end of the L-lysine transporter gene via a linker peptide. The flexible structure of the endogenous signal peptide in conjunction with the linker peptide ensures that the transporter protein is precisely guided and inserted into the cell membrane to perform its function.
[0013] Preferably, the gene expression cassette is integrated into the genome using CRISPR / Cas9 gene editing technology, and the genetically engineered Streptomyces albopictus does not contain antibiotic resistance markers. This seamless integration method improves genetic stability and meets the biosafety standards for industrial strains.
[0014] Secondly, the present invention provides a fermentation production process for a genetically engineered Streptomyces albopictus strain that produces high levels of ε-polylysine, employing the following technical solution: A fermentation production process for a genetically engineered Streptomyces albopictus that produces high levels of ε-polylysine, applied to the aforementioned genetically engineered Streptomyces albopictus that produces high levels of ε-polylysine, includes inoculating the genetically engineered Streptomyces albopictus into a fermentation medium for fermentation culture. During the fermentation process, a two-stage pH control strategy is adopted: the first stage is the cell growth period, in which the pH is controlled to be maintained in the neutral range; the second stage is the product synthesis period, in which the pH is lowered to the acidic range and maintained within this range until the end of fermentation.
[0015] By adopting the above technical solution, the present invention solves the contradiction between growth and product stability: the neutral environment in stage one is conducive to the rapid accumulation of biomass by the cells; the acidic environment in stage two effectively inhibits the activity of endogenous degradation enzymes (Pld) in Streptomyces albopictus, blocking the hydrolysis pathway of long-chain products. At the same time, with the cooperation of the tolerance chassis and mutant synthase, the high molecular weight and uniformity of the product are ensured while maintaining the synthetic activity.
[0016] Preferably, the pH range of stage one is 6.8-7.2; the pH range of stage two is 4.0-4.5; and the start time of stage two is 24-30 hours after fermentation begins. This precise parameter setting establishes an acidic barrier at the product synthesis initiation point, avoiding ineffective losses.
[0017] Preferably, the fermentation medium comprises a carbon source, a nitrogen source, and inorganic salts; the components of the fermentation medium are: glucose 55.0-65.0 g / L, yeast extract 8.0-12.0 g / L, ammonium sulfate 8.0-12.0 g / L, magnesium sulfate heptahydrate 0.7-0.9 g / L, ferrous sulfate heptahydrate 0.04-0.06 g / L, and potassium dihydrogen phosphate 3.5-4.5 g / L. This formulation is optimized for the high metabolic flux of engineered bacteria, providing sufficient nutrients and cofactors.
[0018] Preferably, in stage two, the residual sugar concentration in the fermentation broth is maintained within the range of 5.0-10.0 g / L by feeding glucose solution. This feeding-limiting method relieves the catabolic repression effect and directs metabolic flow towards the synthesis of secondary metabolites.
[0019] Preferably, the fermentation production process further includes a seed culture preparation step, which includes: inoculating the genetically engineered *Streptomyces albopictus* into an activation medium, culturing it at 28-32°C until the logarithmic growth phase to prepare a seed culture, and then transferring it to the fermentation medium at an inoculation rate of 8.0%-10.0% by volume. This shortens the lag period and improves the batch stability of the fermentation.
[0020] This invention provides a genetically engineered *Streptomyces albopictus* strain that produces high levels of ε-polylysine and its fermentation production process. It offers the following advantages: 1. This invention improves the ε-polylysine synthesis capacity of genetically engineered strains through systematic metabolic engineering. By introducing an L-lysine transporter (LysP) containing a secretion signal peptide, an active efflux channel is constructed on the cell membrane, which promptly transports intracellularly synthesized products to the extracellular space, effectively reducing the intracellular product concentration and relieving the feedback inhibition of the synthase and the toxic damage to cell structure caused by high concentrations of ε-polylysine. Combined with the improved catalytic kinetics of the D404A / K499A dual-site mutant synthase and the enhancement of the precursor metabolic pathway, the strain can maintain high-efficiency continuous synthesis during fermentation, ultimately increasing the fermentation yield.
[0021] 2. The two-stage pH fermentation control strategy adopted in this invention effectively ensures the molecular weight uniformity and structural integrity of the product. By utilizing the characteristic that the activity of endogenous degrading enzymes of Streptomyces albopictus is inhibited under acidic conditions, the pH is adjusted to 4.0-4.5 during the product synthesis period, blocking the degradation pathway of the synthesized long-chain polymer being randomly hydrolyzed into low molecular weight fragments. At the same time, the mutant synthase still maintains good catalytic activity and chain length specificity under acidic conditions, with a low polydispersity index, and the product quality meets the standards for high-end applications.
[0022] 3. This invention utilizes CRISPR / Cas9 scarless editing technology to integrate the genome of multiple gene modules, eliminating the risk of plasmid genetic instability. Furthermore, the strain does not contain antibiotic resistance markers, complying with biosafety standards for the food and pharmaceutical industries. In addition, the chassis strain, after tolerance domestication, combined with the transport detoxification mechanism, improves the physiological survival status of the cells in the later stages of fermentation, delays cell autolysis and death, and extends the effective fermentation cycle, making it suitable for large-scale industrial production. Detailed Implementation
[0023] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0024] Preparation Examples 1-4: Preparation Example 1: This preparation example provides a method for preparing the basic plasmid pKC1139-Cas9 for gene editing in Streptomyces albopictus, including the following steps: (1) Using the genomic DNA of Streptomyces whitei JCM4703 as a template, specific primers were designed to amplify the inducible promoter. tipA Sequence; PCR amplification was performed using the artificially synthesized Cas9 gene sequence optimized with Streptomyces codons as a template; overlap extension PCR was used to... tipA The promoter is fused with the Cas9 gene to obtain tipA -Cas9 expression box fragment; (2) Artificially synthesized constitutive promoters ermE Sequence and sgRNA backbone sequence were obtained by PCR fusion. ermE -sgRNA backbone fragment; (3) The temperature-sensitive plasmid pKC1139 was linearized by double digestion with restriction endonucleases EcoRI and HindIII, and the large fragment was recovered; the fragment obtained in step (1) was assembled using a Gibson assembly kit. tipA - Cas9 expression box and steps (2) obtained ermE The sgRNA backbone fragment was ligated into the linearized pKC1139 vector, transformed into E. coli DH5α competent cells, and obtained the basic editing plasmid pKC1139-Cas9 after screening for apramycin resistance and sequencing verification.
[0025] Preparation Example 2: This preparation example provides methods for preparing homologous recombination repair plasmids targeting different metabolic sites, including the following specific preparation examples: Preparation Example 2-1: This preparation example provides a method for... ppc Recombinant plasmid pKC- for gene overexpression ppc The preparation method includes the following steps: Using the genomic DNA of Streptomyces whiteiformis JCM4703 as a template, primers were designed to amplify the phosphoenolpyruvate carboxylase gene. ppc The upstream 800bp fragment serves as the left homologous arm, and the downstream 800bp fragment serves as the right homologous arm. ppc The complete coding frame sequence of the gene itself; Will ermE Strong starter sequence connected to ppc An overexpression box is formed at the 5' end of the encoding frame; Design for ppc A specific sgRNA spacer sequence (20 bp) from the upstream non-coding region of the gene was inserted into the sgRNA backbone of the pKC1139-Cas9 plasmid. Finally, the left homologous arm, ermE - ppc The overexpression cassette and right homologous arm were sequentially assembled into the plasmid to construct pKC- ppc .
[0026] Preparation Example 2-2: This preparation example provides a method for... asd Recombinant plasmid pKC- for heterologous gene expression asd The preparation method includes the following steps: Based on the high-frequency codon preference of *Streptomyces albopictus*, the aspartate semialdehyde dehydrogenase gene derived from *Teslinia molybdica* was analyzed. asd and its upstream kasOp Strong promoters enable full genome synthesis; In the genome of Streptomyces albopictus asd The 1000bp sequences upstream and downstream of the gene locus are used as homologous arms; Design targeting endogenous Streptomyces albopictus asd The sgRNA sequence at the site; Homologous arms and synthesized kasOp - asd The expression cassette was assembled into the pKC1139-Cas9 plasmid containing the corresponding sgRNA to construct the pKC- asd Used to replace or insert expressions of heterogeneity asd Gene.
[0027] Preparation Examples 2-3: This preparation example provides preparation methods for... dapF Recombinant plasmid pKC- for gene overexpression dapF The preparation method includes the following steps: Following the method of Preparation Example 2-1, the diaminopimercoid epimerase gene from *Streptomyces albopictus* was used. dapF As a target, amplify its upstream and downstream homologous arms and coding sequences, and connect them. ermE The promoter was used to construct an overexpression cassette, which was then assembled into a pKC1139-Cas9 plasmid containing the corresponding sgRNA, thus obtaining pKC- dapF .
[0028] Preparation Examples 2-4: This preparation example provides preparation methods for... lysP Recombinant plasmid pKC- for fusion gene expression lysP The preparation method includes the following steps: (1) Design and synthesis of fusion gene: A fusion gene sequence was designed, which contains, from the 5' end to the 3' end, the N-terminal signal peptide coding sequence of the Streptomyces albopictus endogenous secretion protein Vsi, the flexible linker peptide coding sequence (corresponding amino acid sequence is Gly-Gly-Gly-Ser), and the Escherichia coli L-lysine transporter gene optimized by the Streptomyces albopictus codon. lysP The full-length encoded sequence; (2) Plasmid construction: The synthesized fusion gene was placed in ermE Downstream of the promoter; using upstream and downstream sequences of non-essential regions of the *Streptomyces albopictus* genome (such as near the phiC31 integration site) as homologous arms; designing corresponding target sgRNAs; assembling the homologous arms and fusion gene expression cassettes into the pKC1139-Cas9 plasmid to construct the pKC- lysP .
[0029] Preparation Examples 2-5: This preparation example provides preparation methods for... pls Recombinant plasmid pKC- expressing mutant gene pls The preparation method of -M includes the following steps: ε-polylysine synthase gene from Streptomyces albopictus pls Sequence analysis and modification design were performed, and the codon for aspartic acid at amino acid position 404 was mutated to alanine codon, and the codon for lysine at amino acid position 499 was mutated to alanine codon. Codon optimization was also performed on the whole gene. The above double mutant gene was synthesized from the whole genome. pls -M, connect to kasOp Downstream of the promoter; homologous arms and sgRNAs were designed using specific sites in the *Streptomyces albopictus* genome as integration targets; the recombinant plasmid pKC- was assembled and constructed. pls -M.
[0030] Preparation Examples 2-6: This preparation example provides preparations for wild-type... pls Recombinant plasmid pKC- for gene expression pls The preparation method of -WT includes the following steps: Except for incorrect pls Except for site-directed mutations at positions 404 and 499 (i.e., maintaining the wild-type amino acid sequence), the codon optimization strategy, promoter selection, and plasmid construction steps were exactly the same as in Preparation Examples 2-5, resulting in the recombinant plasmid pKC-. pls -WT is used for subsequent comparative experiments.
[0031] Preparation Example 3: This preparation example provides methods for the acclimatization and preparation of *Streptomyces whiteus* chassis strains with different tolerance gradients, including the following specific preparation examples: Preparation Example 3-1: This preparation example provides a chassis strain tolerant to 30.0 g / L ε-polylysine. S.albus The preparation method of -R1 includes the following steps: M3G solid plates containing ε-polylysine were prepared with concentration gradients of 1.0 g / L, 5.0 g / L, 10.0 g / L, 15.0 g / L, 20.0 g / L, 25.0 g / L, and 30.0 g / L. The starting strain of *Streptomyces albopictus* JCM4703 was plated on 1.0 g / L plates and incubated at 30°C for 4 days to produce single colonies. Single colonies were picked and streaked to the next concentration plate, and each concentration was subcultured three times until the strain grew well on 30.0 g / L plates, with colony diameters reaching more than 85% of the control without antibiotics. The selected strain was named... S.albus -R1.
[0032] Preparation Example 3-2: This preparation example provides a chassis strain tolerant to 35.0 g / L ε-polylysine. S.albus The preparation method of -R2 includes the following steps: Based on the preparation example 3-1, an M3G solid plate containing 35.0 g / L ε-polylysine was further prepared; S.albus -R1 was transferred to 35.0 g / L plates for continuous subculturing, with 5 subcultures. Single colonies with stable growth and no significant biomass decline were selected. The selected strains were named... S.albus -R2.
[0033] Preparation Example 3-3: This preparation example provides a chassis strain tolerant to 40.0 g / L ε-polylysine. S.albus The preparation method of -R3 includes the following steps: Based on the preparation example 3-2, an M3G solid plate containing 40.0 g / L ε-polylysine was further prepared; S.albus -R2 was transferred to 40.0 g / L plates for extreme pressure acclimatization, and passaged 5-8 times. Single colonies whose growth rate recovered to 80% of the control group were selected; the selected strains were named S.albus -R3.
[0034] Preparation Example 4: This preparation example provides a genetically engineered Streptomyces albopictus strain that produces high levels of ε-polylysine. S.albus The preparation method of -E includes the following steps: (1) Donor bacterial preparation: The five recombinant plasmids (pKC-) constructed in Preparation Examples 2-1 to 2-5 were used to prepare the donor bacteria. ppc pKC- asd pKC- dapF pKC- lysP pKC- pls -M) were transformed into Escherichia coli ET12567 / pUZ8002 to prepare conjugation transfer donor bacteria; (2) Conjugation transfer and gene editing: using the tolerant strains obtained in preparation example 3-2 S.albus -R2 is the recipient bacterium; its fresh spores were collected and pre-germinated after being heat-shocked at 50°C for 10 minutes; firstly, the pKC-... ppc The donor and recipient bacteria were mixed and plated on MS plates (containing 10 mmol / L MgCl2), co-cultured at 30°C for 18 hours, and then covered with sterile water containing 50 μg / mL apramycin and 25 μg / mL nalidixic acid. Conjugates were picked and induced to express Cas9 in BTN liquid medium containing 10 μg / mL thiotetracycline, and positive clones with successful genome integration were screened. (3) Multi-gene iterative integration: The successfully edited strains were inoculated into antibiotic-free BTN medium and cultured at 37°C for 48 hours. Apramycin-sensitive single colonies were screened to obtain overexpressed strains. ppc For the strain containing the gene, repeat the above steps sequentially. asd , dapF , lysP and pls The -M expression cassette was integrated into the genome of the same strain, and the recombinant plasmid was eliminated to obtain the final antibiotic-free genetically engineered bacterium, named... S.albus -E.
[0035] Examples 1-4: Example 1: This example provides a method for utilizing high-yield genetically engineered bacteria. S.albus The process for producing ε-polylysine by fermentation includes the following steps: (1) Seed liquid preparation: The genetically engineered Streptomyces albopictus obtained in Preparation Example 4 was used as a seed liquid preparation. S.albus Fresh E spores were inoculated into M3G activation medium in 50 mL / 250 mL Erlenmeyer flasks and cultured with shaking at 30 °C and 200 rpm for 24 hours until the cells entered the logarithmic growth phase to obtain the seed culture. (2) Fermentation culture: The seed culture was transferred to a 5L fully automatic fermenter containing 3.0L LSM fermentation medium at an inoculation rate of 10.0% (v / v); the basic fermentation conditions were controlled as follows: temperature 30℃, aeration rate 1.0vvm, initial stirring speed 400rpm, and the stirring speed was set to be coupled with dissolved oxygen (DO) to maintain the dissolved oxygen concentration in the fermentation broth at no less than 30%; (3) Two-stage pH control: The fermentation process adopts a two-stage pH control strategy: Stage 1 (cell growth period): 0-26 hours after the start of fermentation, the pH of the fermentation broth is controlled at 7.0 by automatically adding 25% ammonia or 85% phosphoric acid; Stage 2 (product synthesis period): after 26 hours of fermentation, the automatic control parameters are adjusted so that the pH of the fermentation broth slowly and linearly decreases to 4.2 within 2 hours, and is then maintained at pH 4.2 until the end of fermentation (total fermentation cycle 72 hours). (4) Feeding strategy: In the above-mentioned stage two, the feeding system is turned on and a glucose solution with a concentration of 500 g / L is added; a feeding method based on residual sugar feedback is adopted, and the residual sugar concentration of the fermentation broth is sampled and detected every 2-4 hours. The flow rate is adjusted to control the residual sugar concentration in the fermentation broth to be maintained at about 7.5 g / L.
[0036] Example 2: This example provides a method using high-yield genetically engineered bacteria. S.albus A method for producing ε-polylysine by E-fermentation includes the following steps: (1) Seed culture preparation: Same as step (1) in Example 1, except the culture time is adjusted to 20 hours; (2) Fermentation culture: The seed culture was transferred to a fermenter containing RSM fermentation medium at an inoculation rate of 8.0% (v / v); the fermentation temperature was 28℃, and the dissolved oxygen was maintained at no less than 30%. (3) Two-stage pH control: Stage 1: 0-24 hours after the start of fermentation, control the pH of the fermentation broth to be maintained at 6.8; Stage 2: 24 hours after fermentation, lower the pH of the fermentation broth to 4.0, and maintain pH 4.0 thereafter until the end of fermentation; (4) Feeding strategy: Add glucose solution in stage 2 to control the residual sugar concentration in the fermentation broth to be around 5.0 g / L.
[0037] Example 3: This example provides a method for utilizing high-yield genetically engineered bacteria. S.albus A method for producing ε-polylysine by E-fermentation includes the following steps: (1) Seed culture preparation: Same as step (1) in Example 1, except the culture time is adjusted to 28 hours; (2) Fermentation culture: The seed culture was transferred to a fermenter containing RSM fermentation medium at an inoculation rate of 10.0% (v / v); the fermentation temperature was 32℃, and the dissolved oxygen was maintained at no less than 30%. (3) Two-stage pH control: Stage 1: 0-30 hours after the start of fermentation, control the pH of the fermentation broth to be maintained at 7.2; Stage 2: after 30 hours of fermentation, lower the pH of the fermentation broth to 4.5, and maintain pH 4.5 thereafter until the end of fermentation. (4) Feeding strategy: Add glucose solution in stage 2 to control the residual sugar concentration in the fermentation broth to be around 10.0 g / L.
[0038] Example 4: This example provides a verification method for fermentation production using engineered bacteria constructed with chassis of different tolerances, including the following steps: (1) Construction of engineered bacteria with different tolerances: Referring to the method for constructing genetically engineered bacteria described in Preparation Example 4, the chassis strains obtained in Preparation Example 3-1 that are tolerant to 30.0 g / L ε-polylysine were used respectively. S.albus -R1, and the chassis strain tolerant to 40.0 g / L ε-polylysine obtained in Preparation Example 3-3. S.albus -R3 is the starting strain, which is integrated sequentially. ppc , asd , dapF , lysP and pls Five gene expression cassettes (M) were used to obtain engineered strains after plasmid elimination. S.albus -E1 (based on R1 chassis) and S.albus -E3 (based on R3 chassis); (2) Fermentation process verification: The fermentation process was verified by separately... S.albus -E1 and S.albus -E3 was used as the production strain, and a 5L tank fermentation experiment was conducted strictly according to the process method of Example 1. That is, the same seed preparation conditions, inoculum size, temperature and dissolved oxygen control, and completely consistent two-stage pH control strategy (pH 7.0 from 0 to 26 h; pH 4.2 after 26 h) and feeding strategy (residual sugar 7.5 g / L) were used. After fermentation, the yield and biomass were measured, and the results were recorded in the test case.
[0039] Comparative Examples 1-5: Comparative Example 1: Compared with Example 1, the difference is that the chassis strain used to construct the genetically engineered bacteria is the original white Streptomyces JCM4703 that has not undergone tolerance domestication (i.e., it has not undergone the gradient domestication steps described in Preparation Example 3). The same five gene expression cassettes are integrated into the genome of this original strain, and the remaining gene manipulation steps and fermentation process parameters are the same as in Example 1.
[0040] Comparative Example 2: The difference compared to Example 1 is that pKC- was not integrated during the construction of the genetically engineered bacteria. lysP Plasmids (i.e., those whose genomes do not contain fusion genes) lysP Expression Box), only integrated ppc , asd , dapF and pls The four expression boxes were M, and the selection of strains and fermentation process parameters for the remaining chassis were the same as in Example 1.
[0041] Comparative Example 3: Compared with Example 1, the difference is that the genetically engineered bacteria constructed were made from ordinary bacteria that do not contain the Vsi signal peptide and linker peptide. lysP Gene expression cassette (i.e.) lysP The gene coding sequence is directly linked downstream of the promoter (without fusion of secretory signal peptide), and everything else is the same as in Example 1.
[0042] Comparative Example 4: Compared with Example 1, the difference is that the genetically engineered bacteria constructed in Examples 2-6 integrated wild-type bacteria. pls Recombinant plasmid pKC- of the gene pls -WT, replacing the mutated gene in Example 1. pls The plasmid with -M (i.e., ε-polylysine synthase without D404A and K499A point mutations) is the same as in Example 1.
[0043] Comparative Example 5: Compared with Example 1, the difference is that the two-stage pH control strategy is not used in the fermentation process. Instead, the pH of the fermentation broth is maintained at a constant 6.8 throughout the process by adding ammonia or phosphoric acid. The other strain types and other fermentation parameters are the same as in Example 1.
[0044] Test Examples 1-6: Test Example 1: Genotyping and Sequence Verification of Genetically Engineered Strains This test case aims to verify the accuracy of the integration of exogenous gene expression cassettes and key enzyme point mutations in the genomes of the genetically engineered strains constructed in the examples and comparative examples.
[0045] Experimental steps: The genetically engineered bacterial strains constructed in Examples 1, 4, 1, 2, 3, and 4 were inoculated into 10 mL of TSB liquid medium and cultured at 30°C with shaking at 200 rpm for 24 hours until the logarithmic growth phase. 2 mL of the bacterial culture was centrifuged at 8000 rpm for 2 minutes, and the bacterial pellet was collected. After cell disruption using lysozyme, genomic DNA was extracted from each strain using a bacterial genomic DNA extraction kit. The DNA concentration and purity were measured using a micro spectrophotometer to ensure OD... 260 / OD 280 The ratio is between 1.8 and 2.0.
[0046] Based on the gene expression cassette sequence designed according to this invention, five pairs of specific validation primers were synthesized, namely: targeting... ppc overexpression cassette primer pair P_ ppc -F / R, for asd Primer pair P_ of heterologous expression cassette asd -F / R, for dapF overexpression cassette primer pair P_ dapF -F / R, for signals containing peptides lysP Primer pair P_ for fusion gene lysP -F / R, and for pls Primer pair P_ for the full length of the gene pls -F / R; Using the extracted genomic DNA of each strain as a template, PCR amplification was performed using high-fidelity DNA polymerase. The reaction volume was 50 μL, and the amplification program was set as follows: 30 cycles of 98℃ pre-denaturation for 3 minutes, 98℃ denaturation for 10 seconds, 60℃ annealing for 15 seconds, and 72℃ extension (the extension time was set according to the fragment length, 1 kb / 30 seconds), and finally 72℃ extension for 5 minutes.
[0047] Take 5 μL of PCR amplification product and perform 1.0% agarose gel electrophoresis to detect the presence of the target band and whether its size meets expectations in the ultraviolet gel imaging system; cut the PCR product that meets the expected size into gels, recover it, and send it to a sequencing company for Sanger bidirectional sequencing.
[0048] Sequence analysis software was used to align the sequence files obtained from sequencing with the designed target gene sequence; the focus was on checking the integrity of gene integration, and pls Mutations in the coding sequences of amino acids at positions 404 and 499 of the gene (GAT mutated to GCT, AAG mutated to GCG); for lysP For fusion genes, the focus is on comparing the correctness of the 5' signal peptide sequence and the linker sequence.
[0049] Experimental data: Table 1. Summary of sequencing alignment results of integration sites in the genomes of various genetically engineered strains
[0050] Note: The sequence consistency values in the table allow for systematic errors from the sequencing instrument; a consistency of 99.5% or higher is considered a correct sequence. Endogenous indicates that only the original genome sequence was detected, and no artificially constructed strong promoters or heterologous sequences were detected.
[0051] in conclusion: Based on the sequencing alignment data in Table 1, the engineered strains constructed in Examples 1 and 4 ( S.albus The -E series successfully amplified the target bands at all five target sites, and sequencing results showed that the exogenous gene expression cassette sequence was highly consistent with the designed sequence. This was particularly true for the core synthase gene. pls The sequencing peak diagram confirmed that codon 404 was successfully mutated from GAT (aspartic acid) to GCT (alanine), and codon 499 was successfully mutated from AAG (lysine) to GCG (alanine). This indicates that the two-site site-directed mutagenesis strategy was successfully constructed, laying the genetic foundation for improving the efficiency of ε-polylysine synthesis in the future.
[0052] For the comparative strain, sequencing results confirmed that the construction of each missing or replaced term conformed to the experimental design. No such term was detected in Comparative Example 2. lysP The fusion gene fragment confirmed that this strain lacked an exogenous L-lysine transport channel enhancement module; although Comparative Example 3 amplified... lysP The fragment was analyzed, but sequence analysis revealed a 5' deletion of the nucleotide sequence encoding the *Streptomyces albopictus* Vsi signal peptide, confirming that its expression product could not be correctly localized to the cell membrane; (Comparative Example 4) pls Gene sequencing results showed that positions 404 and 499 were both wild-type codons, confirming the expression of the unmodified wild-type synthase. These genotyping results indicate a clear and distinct genetic background between the experimental and control groups, and the differences in subsequent fermentation performance can be attributed to these specific differences in gene modification.
[0053] Test Example 2: Tolerance assessment and growth performance determination of chassis strains This test case aims to evaluate the growth ability of various levels of tolerant chassis strains obtained through adaptive evolutionary domestication under different concentrations of ε-polylysine stress, and to verify the effect of the domestication process on improving the tolerance threshold of the strains.
[0054] Experimental steps: Prepare basic M3G liquid culture medium and add ε-polylysine standard to achieve final concentrations of 0 g / L (control group), 15.0 g / L, 30.0 g / L, 35.0 g / L and 40.0 g / L respectively; dispense into 250 mL Erlenmeyer flasks, with each flask containing 30 mL of liquid, and set up 3 replicates for each concentration.
[0055] Collect the original starting strain (JCM4703) and the tolerant strain obtained in Preparation Example 3-1. S.albus -R1, the resistant strain obtained in Preparation Example 3-2 S.albus -R2 and the resistant strains obtained in Preparation Example 3-3 S.albus Fresh R3 spores were used to prepare a spore suspension using sterile physiological saline, and the spore concentration was adjusted to 1.0 × 10⁻⁶. 7 CFU / mL.
[0056] Spore suspensions of each strain were inoculated into different concentration gradients of ε-polylysine medium at an inoculation rate of 2.0% (v / v) and cultured in a constant temperature shaker at 30°C and 200 rpm in the dark. During the culture process, the rotation speed and temperature fluctuations were strictly controlled to ensure that the culture conditions of each group were consistent.
[0057] After 48 hours of cultivation (the cell stationary phase), the culture was removed, and 5 mL of fermentation broth was centrifuged at 4000 rpm for 10 minutes. The supernatant was discarded to eliminate interference from the color of the culture medium and residual products on light absorption. The cell pellet was resuspended in an equal volume of distilled water. The turbidity (OD) of the cells was measured at 600 nm using a UV-Vis spectrophotometer. 600 ), with OD of the 0 g / L concentration group 600 Using the baseline (set to 100%), the relative biomass retention rate of each strain under different stress concentrations was calculated.
[0058] Experimental data: Table 2. Relative biomass retention (%) of each chassis strain under ε-polylysine stress
[0059] in conclusion: According to the data in Table 2, ε-polylysine has an inhibitory effect on the growth of *Streptomyces albopictus*, and the original starting strain is extremely sensitive to this product. Under low to medium concentration stress of 15.0 g / L, the biomass of the original strain dropped to 42.3% of the control group, while at a concentration of 30.0 g / L, its growth essentially stopped (biomass remained at only 8.4%), failing to meet the requirements of the chassis for high-concentration fermentation.
[0060] In contrast, mutants obtained through gradient pressure acclimatization exhibited a tolerance advantage. S.albus The R1 strain retained 83.7% of its biomass at a concentration of 30.0 g / L. This was achieved after further domestication. S.albus The -R2 strain exhibited an even higher tolerance threshold, maintaining a biomass retention rate of over 80% (82.9%) at a concentration of 35.0 g / L. Meanwhile, for extreme stress screening... S.albus - Even at a high concentration of 40.0 g / L, strain R3 still maintained a relative growth of 81.3%, which was better than the performance of strain R2 at this concentration (38.4%).
[0061] Data shows that through laboratory adaptive evolution strategies, the cell membrane structure or physiological metabolic mechanisms of the strain underwent adaptive changes, successfully overcoming the feedback inhibition of cell growth caused by high concentrations of the product. This improvement in tolerance exhibits a stepwise distribution, directly supporting the survival ability of the cells at high product concentrations in subsequent high-density fermentation processes, and is a key prerequisite for achieving high and stable yields. The feasibility and rationality of the tolerance range (30.0-40.0 g / L) for strains with different tolerance levels are also examined.
[0062] Test Example 3: Specific Enzyme Activity Determination and Catalytic Efficiency Evaluation of ε-Polylysine Synthase This test case aims to compare and analyze the differences in intracellular key enzyme catalytic activity between the engineered strain expressing mutant synthase (Pls-M) constructed in Example 1 and the strain expressing wild-type synthase (Pls-WT) constructed in Comparative Example 4 through in vitro enzyme activity assay, and to verify the effect of the D404A / K499A double-site mutation on enzyme catalytic efficiency.
[0063] Experimental steps: Collection Example 1 (strain) S.albus Fresh mycelia of strains -E) and Comparative Example 4 (control strain 4) after 36 hours of fermentation (peak product synthesis period) were collected. 50 mL of fermentation broth was taken, centrifuged at 8000 rpm for 10 minutes at 4℃, and the supernatant was discarded. The mycelial pellet was washed twice with pre-cooled 50 mM Tris-HCl buffer (pH 8.0, containing 1 mM MDT and 1 mM EDTA) and resuspended in the above buffer at a ratio of 1:5 (w / v).
[0064] The bacterial suspension was placed in an ice bath and the cells were disrupted using an ultrasonic cell disruptor (3 seconds on, 5 seconds off, total time 15 minutes, power 400W) until the clarity of the bacterial solution no longer changed. The disrupted solution was centrifuged at 4°C and 12,000 rpm for 30 minutes, and the supernatant was collected as the crude enzyme extract. The total protein concentration in the crude enzyme solution was determined using the Coomassie Brilliant Blue method (Bradford method), and the total protein concentration of each sample was adjusted to a uniform level (approximately 2.0 mg / mL) for later use.
[0065] An in vitro enzymatic reaction system (total volume 1 mL) was established, containing 100 mM Tris-HCl buffer (pH 8.0), 10 mM ATP, 10 mM MgCl2, 50 mM L-lysine substrate, and 100 μL crude enzyme solution; a reaction system without L-lysine substrate was set up as a blank control to eliminate interference from background inorganic phosphate.
[0066] The reaction system was placed in a 30°C constant temperature water bath for 30 minutes, and the reaction was terminated by adding 200 μL of 10% trichloroacetic acid (TCA) solution. The content of inorganic phosphorus (Pi) released in the reaction system was determined by the malachite green-ammonium molybdate colorimetric method. ε-polylysine synthase catalyzes the hydrolysis of ATP and the ligation of lysine monomers, and releases 1 mol Pi (or AMP / PPi, here the reaction rate is characterized by the amount of Pi released) for every 1 mol of ATP consumed. The enzyme activity unit (U) is defined as: the amount of enzyme required to catalyze the release of 1 μmol of inorganic phosphorus per minute under the above conditions.
[0067] The specific enzyme activity was calculated based on the measured inorganic phosphorus release, reaction time, and protein content in the crude enzyme solution; each strain sample was measured independently in 3 replicates.
[0068] Experimental data: Table 3. Results of intracellular specific enzyme activity assays for wild-type and mutant ε-polylysine synthases
[0069] in conclusion: According to the data in Table 3, during the metabolically active phase of fermentation, the average specific enzyme activity of the crude enzyme solution in Comparative Example 4 strain (expressing wild-type Pls) was 4.18 U / mg, representing the basal catalytic level of unmodified natural ε-polylysine synthase. In contrast, the average specific enzyme activity of the strain in Example 1 (expressing D404A / K499A double mutant Pls-M) reached 6.81 U / mg, an increase of 62.9% compared to the wild type.
[0070] Data dispersion analysis showed that the fluctuations in the data of each parallel sample were within a reasonable range (small standard deviation), proving the reliability of the measurement results. Mechanistic analysis revealed that the aspartic acid at position 404 (Asp) is located near the ATP-binding pocket of the enzyme. Its mutation to alanine (Ala), with a shorter side chain, reduced steric hindrance, facilitating the entry and binding of ATP substrates. The lysine at position 499 (Lys) is located in the catalytic active center region. Its mutation to alanine may have altered the local charge distribution, optimizing the nucleophilic attack pathway of the substrate L-lysine, thereby increasing the enzyme's catalytic conversion number (kcat).
[0071] This change in enzymatic properties is endogenous and independent of changes in the fermentation environment. The improved in vitro enzyme activity data directly explains why, under the same fermentation process conditions, the final yield of Example 1 was higher than that of Comparative Example 4. This result confirms that the molecular modification strategy (D404A / K499A) described in this invention successfully removes the rate-limiting step of the synthase and is one of the core driving forces for achieving high yields.
[0072] Test Example 4: Comparative Test of Fermentation Product Synthesis Capacity and Overall Process Performance This test case aims to determine the fermentation endpoint parameters of each experimental group described in Examples 1-4 and Comparative Examples 1-5 through shake flask and 5L fermenter experiments, and to comprehensively evaluate the effects of different strain construction strategies and fermentation process control strategies on ε-polylysine yield, cell growth and substrate conversion efficiency.
[0073] Experimental steps: Batch fermentation experiments were conducted according to the corresponding fermentation conditions described in Examples 1-4 and Comparative Examples 1-5. For Examples 1-4 and Comparative Examples 2-5, the fermentation cycle was set to 72 hours. For Comparative Example 1 (original strain), due to premature cell aging, the fermentation cycle was set to 48 hours or 72 hours depending on the dissolved oxygen recovery. Each group of experiments was repeated in 3 parallel fermenters or shake flasks.
[0074] After fermentation, accurately measure the volume of the fermentation broth, take 50 mL of the fermentation broth sample, and centrifuge at 4000 rpm for 15 minutes; collect the supernatant for the determination of ε-polylysine yield and residual sugar; collect the cell precipitate, wash it twice with distilled water, and dry it in a 105℃ oven until constant weight, and calculate the cell dry weight (DCW, g / L).
[0075] The concentration of ε-polylysine in the supernatant was determined by high performance liquid chromatography (HPLC). The chromatographic conditions were as follows: a C18 reversed-phase column (4.6 mm × 250 mm, 5 μm) was used; the mobile phase was acetonitrile-phosphate buffer (pH 2.5, containing NaClO4); the flow rate was 1.0 mL / min; the detection wavelength was 215 nm; and the column temperature was 30 °C. The concentration was calculated by substituting the sample peak area into a pre-plotted standard curve.
[0076] The total glucose consumption at the fermentation endpoint was determined using a biosensor analyzer; various technical indicators were calculated according to the formulas: production intensity (g / L / h) = fermentation endpoint yield / fermentation time; sugar-acid conversion rate (%) = fermentation endpoint yield / total glucose consumption × 100%.
[0077] Experimental data: Table 4. Summary of comprehensive fermentation performance test results for each example and comparative example.
[0078] in conclusion: According to the test data in Table 4, the comprehensive technical solution adopted in Example 1 (domesticated chassis + five-gene modification + two-stage pH control) achieved the best fermentation performance, with the final yield of ε-polylysine reaching 34.2 g / L and the sugar-acid conversion rate of 18.4%, which was higher than all comparative examples.
[0079] Through horizontal comparative analysis, the contribution and mechanism of action of each technical feature of this invention can be revealed: First, the tolerance of the chassis strain is a prerequisite for fermentation to proceed. Comparative Example 1 used an unacclimated original strain. Although it integrated the same synthetic genes, when the product accumulated to about 4.5 g / L, the cells underwent autolysis due to their inability to tolerate the cytotoxicity of high concentrations of ε-polylysine, and the fermentation was forced to terminate after 48 hours, with a biomass of only 29.1% of that in Example 1. This demonstrates that the tolerance acclimation steps described in the claims are a necessary foundation for achieving high yields.
[0080] Secondly, the membrane-localized expression of the L-lysine transporter LysP plays a crucial role in pumping and detoxification. (Comparative Example 2: Deficiency) lysP The gene caused excessive accumulation of the product intracellularly, triggering feedback inhibition, resulting in a yield of only 12.8 g / L. Comparative Example 3, although expressing... lysP However, the absence of the signal peptide resulted in a yield (19.4 g / L) that was higher than that of Comparative Example 2 but still lower than that of Example 1. This indicates that exogenous transport proteins must be correctly positioned on the cell membrane with the help of the signal peptide in order to perform their transport function, thereby reducing intracellular product pressure and relieving feedback inhibition.
[0081] Furthermore, key synthetic enzymes Pls Molecular modification improved synthesis efficiency. With similar biomass (approximately 42 g / L), the yield of Example 1 (mutant Pls) was 41.9% higher than that of Comparative Example 4 (wild-type Pls) (34.2 g / L vs 24.1 g / L). Combined with enzyme activity data from Test Example 3, this further confirmed that the mutation at the D404A / K499A site effectively improved the enzyme's catalytic activity, which was the direct cause of the increased yield.
[0082] Finally, the control of the fermentation process is crucial to the final indicators. Comparative Example 5 used a constant pH of 6.8 throughout the process, which achieved the highest biomass (44.2 g / L, due to the neutral environment being suitable for cell growth), but the final yield was only 21.6 g / L. In contrast, the two-stage pH strategy used in Example 1, which maintained neutrality in the early stage to promote rapid cell growth and then adjusted to acidity (pH 4.2) in the later stage, not only facilitated the activity of the product-synthesizing enzymes, but more importantly, the acidic environment inhibited the activity of ε-polylysine degrading enzymes, reducing product degradation.
[0083] In summary, this invention achieves a synergistic match between strain performance and fermentation process through chassis tolerance domestication, key enzyme molecule modification, transport channel enhancement, and fermentation process optimization, thereby obtaining ε-polylysine yields far exceeding those of existing technologies.
[0084] Test Example 5: Analysis of Cell Physiological State and Viability during Fermentation This test case aims to analyze the expression of L-lysine transporter (LysP) and the effect of fermentation pH regulation strategies on the physiological state of genetically engineered strains by measuring the number of viable bacteria at different stages of fermentation, and to verify the role of the technical solution described in this invention in alleviating product cytotoxicity and maintaining cell fermentation vitality.
[0085] Experimental steps: Example 1, Comparative Example 2, and Comparative Example 5 were selected as test subjects. Samples were taken at three key time points during the fermentation process: 24 hours (end of logarithmic cell growth / initiation of product synthesis), 48 hours (peak of product synthesis), and 72 hours (end of fermentation).
[0086] In a clean bench, using a large-bore sterile pipette, 1.0 mL of fermentation broth was drawn from each time point and added to a test tube containing 9.0 mL of sterile physiological saline (containing 0.1% peptone) for serial dilution; the fermentation broth was then diluted to 10 mL. 510 5, 10 610 6 and 10 710 7. Three gradients.
[0087] Take 100 μL of bacterial culture at each dilution and spread it onto M3G solid plates; set up 3 parallel plates for each dilution; invert the plates in a 30℃ constant temperature incubator and incubate for 72-96 hours until clearly visible single colonies grow.
[0088] Plates with colony counts between 30 and 300 were selected for counting, and the log number of viable cells per milliliter of fermentation broth was calculated (Log). 10 (CFU / mL); at the same time, observe the colony morphology and record whether there are physiological degeneration phenomena such as colony shrinkage or abnormal morphology.
[0089] Experimental data: Table 5. Results of cell survival rate determination at different stages of fermentation (Log) 10 CFU / mL
[0090] in conclusion: According to the test data in Table 5, the cell physiological states under different strains and process conditions showed differences during the product synthesis period.
[0091] In the initial stage of fermentation (24 hours), the viable cell counts in all three groups of experiments remained at a high level (approximately 8.8-8.9 Log). 10 The CFU / mL count indicates that before the product has accumulated in large quantities, the growth status of each strain is good, and the genotypic differences have not caused a significant burden on the growth of the bacteria.
[0092] After entering the peak synthesis period (48 hours), Comparative Example 2 (deleted) lysP The viable cell count of the gene (in this study) experienced a precipitous drop, plummeting from 8.79 at 24 hours to 6.15, and further to only 4.32 at the 72-hour endpoint. Combined with the extremely low final biomass (28.5 g / L) and yield (12.8 g / L) in Test Example 4, it can be confirmed that the absence of the efflux transporter LysP led to excessive intracellular accumulation of synthesized ε-polylysine. Because ε-polylysine possesses cationic surfactant properties, high intracellular accumulation disrupted cell membrane integrity, triggering severe cytotoxic effects and causing massive autolysis and death of the cells in the later stages of fermentation, thus prematurely terminating the product synthesis process.
[0093] Although Example 1 experienced environmental stress during the later stages of fermentation, with the pH value decreasing from 7.0 to 4.2, the decline in viable cell count was gradual, remaining at 7.92 Log after 72 hours. 10 The viable cell count in Example 1 was slightly lower than that in Comparative Example 5 (pH 6.8 throughout, optimal growth environment), although the difference was approximately 0.6 log units over 72 hours. This indicates that: First, the fusion expression of a signal peptide-containing... LysP The protein successfully constructed an efficient product efflux channel, promptly pumping intracellularly synthesized products to the extracellular space, effectively eliminating intracellular toxicity. This is the fundamental reason why the viable cell count in Example 1 was higher than that in Comparative Example 2. Secondly, the acclimatized tolerant chassis, combined with the action of LysP, enabled the strain to tolerate the acidic environment and high concentrations of extracellular products in the later stages of fermentation. Although the acidic environment (pH 4.2) inhibited cell division to some extent (compared to the pH 6.8 group), this inhibition was controllable, and the acidic environment effectively inhibited the activity of product-degrading enzymes (as described in the conclusion of Test Example 4), thus finding the optimal balance between maintaining cell survival and preventing product degradation, ultimately achieving a maximum yield of 34.2 g / L.
[0094] In summary, the transport and synthesis coupling mechanism constructed in this invention, combined with a two-stage pH control strategy, effectively extends the high-yield duration of engineered bacteria and solves the bottleneck problem of premature cell aging caused by product toxicity in traditional fermentation.
[0095] Test Example 6: Determination of Product Molecular Weight and Molecular Weight Distribution This test example uses gel permeation chromatography (GPC) to determine the weight-average molecular weight (Mw), number-average molecular weight (Mn), and polydispersity index (PDI) of the fermentation end products of the examples and comparative examples, in order to verify the effects of the genetically engineered strain construction strategy and fermentation pH control process on the degree of polymerization and structural uniformity of ε-polylysine.
[0096] Experimental steps: Take 50 mL of the final fermentation broth from Examples 1, 4, and 5 after 72 hours of fermentation, place it in a centrifuge tube, centrifuge at 8000 rpm for 15 minutes, and collect the supernatant. Add 1.0 mol / L NaOH solution to the supernatant to adjust the pH to 7.0, and pass it through a pretreated Amberlite IRC-50 weakly acidic cation exchange resin column at a flow rate of 1.0 mL / min for adsorption. After adsorption saturation, wash the resin column with 5 column volumes of deionized water to remove residual sugars and impurities, and then elute with 0.2 mol / L HCl solution, collecting the eluent containing ε-polylysine stepwise.
[0097] The collected eluents were combined and concentrated by rotary evaporation under reduced pressure at 45°C to a dry matter content of about 20%. Five times the volume of pre-cooled anhydrous ethanol was added, and the mixture was allowed to stand at 4°C for 12 hours to precipitate. The precipitate was collected by centrifugation at 4000 rpm, dried in a freeze dryer for 48 hours, and ground through a 100-mesh sieve to obtain pure ε-polylysine powder.
[0098] Accurately weigh each group of lyophilized powder and ε-polylysine standard, dissolve them in the mobile phase to prepare a 2.0 mg / mL sample solution, and filter through a 0.22 μm aqueous microporous membrane. The GPC analysis conditions are as follows: TSKgel G3000PWXL column (7.8 mm × 300 mm), mobile phase is 0.1 mol / L sodium nitrate solution (containing 0.02% sodium azide), flow rate is 0.8 mL / min, column temperature is 35 ℃, and the detector is a refractive index detector (RID); injection volume is 20 μL.
[0099] Chromatographic data were collected, and calibration curves were established using polyethylene glycol (PEG) series standards. The weight-average molecular weight (Mw), number-average molecular weight (Mn), and polydispersity index (PDI = Mw / Mn) of each sample were calculated by integrating the data using GPC chromatography workstation software.
[0100] Experimental data: Table 6. Results of molecular weight and distribution characteristics of fermentation products
[0101] in conclusion: According to the data in Table 6, the ε-polylysine prepared in Example 1 has a weight-average molecular weight of 4158 Da and a polydispersity index of 1.11, which is not significantly different from the parameters of the commercial standard (Mw 4210 Da, PDI 1.06). This indicates that the production process established in this invention can synthesize a homogeneous product with a degree of polymerization in the range of 25-35 lysine residues.
[0102] Comparative Example 4 (wild-type enzyme) and Example 1 (mutant enzyme) showed consistency in product molecular weight and distribution (PDI 1.13 and 1.11, respectively), indicating that the mutation at the D404A / K499A site only changed the catalytic reaction rate of the synthase, but did not change the enzyme's recognition and termination mechanism of substrate polymerization chain length. The mutant enzyme still maintained the specificity of the product structure.
[0103] In Comparative Example 5 (constant pH 6.8 throughout fermentation), the product Mw decreased to 3185 Da, and the PDI increased to 1.58, while the peak area normalized purity decreased. The high concentration of product accumulation in the later stages of fermentation, combined with a neutral environment (pH 6.8), induced or activated the extracellular potential ε-polylysine degrading enzyme activity of *Streptomyces albopictus*, leading to random hydrolysis and cleavage of long-chain products, generating low-molecular-weight oligomers. The two-stage pH control strategy employed in Example 1, which lowered the environmental pH to 4.2 in the later stages of fermentation, effectively inhibited the catalytic activity of the degrading enzyme, blocking the product degradation pathway and ensuring that the final product's molecular weight remained within the high degree of polymerization range and was uniformly distributed.
[0104] Appendix: ppc sequence: asd sequence: ATGCGCATCGGCATCGTCGGCGCCACCGGCGCCGTCGGCCAGGAGACCATCCAGGTGCTGAAGGACCGCGGCTTCCCGGTGACCGAGCTGCACCTGTTCGCCAGCGAGCGCAGCGCCGGCAAGACCACCGAGACCGCCTTCGGCACCATCACCATCGAGCCGTTCAGCGTGGACGCCGCCCGCGGCATGGACATCGTGTTCCTGGCCGTGAGCGGCGACTTCGCCAAGGAGTACGCCCCGCAGATCGCCGCCGAGGGCGGCGCCGTGGTGATCGACAACAGCAGCGCCTTCCGCTACGACGACGCCGTGCCGCTGGTGGTGCCGGAGATCAACGGCCGCCGCGCCCTGGGCCAGAAGCTGATCGCCAACCCGAACTGCACCACCGCCATCCTGCTGATGGCCCTGGCCCCGCTGCACGAGGCCTTCGGCGTGAAGCGCGCCATCGTGAGCACCTACCAGGCCGCCAGCGGCGCCGCCGAGGGCATGACCGAGCTGGAGCAGGGCGCCCGCCAGTACCTGGCCGGCGAGCCGGTGACCGCCAGCAAGTTCGCCCACCCGCTGGCCTTCAACCTGATCCCGCACATCGACAGCTTCCAGGACAACGGCTACACCCGCGAGGAGATGAAGGTGCTGTGGGAGACCCGCAAGATCATGGAGGCCCCGGAGGTGCTGCTGAGCTGCACCGCCGTGCGCGTGCCGACCATGCGCGCCCACGCCGAGGCCGTGACCATCGAGACCCGCCACCCGGTGACCCCGGCCGCCGCCCGCGAGGTGCTGGCCAAGGCCCAGGGCGTGACCCTGGCCGACGACCCGGCCAACAAGCTGTACCCGATGCCGCTGACCGCCAGCAGCAAGTACGACGTGGAGGTGGGCCGCATCCGCGAGAGCCTGGTGTTCGGCGAGACCGGCCTGGACTTCTTCGTGTGCGGCGACCAGCTGCTGAAGGGCGCCGCCCTGAACACCGTGCAGATCGCCGAGCTGCTGGTGTGA dapF Sequence: GTGAGCAGCACAGCAGGCGTGCCCTTCCCGTTCCTGAAGGGGCACGGCACCGAGAACGACTTCGTGATCATCCCGGACCCGGACGGGGAGCTCGACCTGCCGCCGGCGGTGGTGGCCCGGCTGTGCGACCGGAGGGCGGGCATCGGGGCCGACGGTGTGCTCCGTGTCGTCCGCTCGGCGGCGCACCCGGAGGCCAAGGCCATGGCCGCCGAGGCGGAGTGGTTCATGGACTACCGCAACAGCGACGGTTCCGTGGCCGAGATGTGCGGCAACGGTGCCCGGGTATTCGCCCGCTATCTGGAGCGGGCCGGACTCGTCGAACCCGGTGATCTGGCCATCGCGACCCGCGCGGGGGTCCGCCGGGCGCACATCGCCAAGAACGGCGGTCCCGTCACCATCGCCATGGGCGCCGCCGAACTGCACACCTCCGCGCGGGGCGCCGACGAGATCACCGTCAGCGCGGCAGGGCACACCTGGCCGGTACGCAAGGTCGGCATGGGCAACCCCCACGCGGTCGCCTTCGTGACGGACCTGGCGGACCCCGGGCCGCTGCAGGAGGCCCCCGTGGTGCGGCCTGCCGCCGCCTACCCGGAGGGCGTCAACGTCGAATTCGTCGTCTCCCGGGGCCCGCGCCACGTGGCGCTGCGGGTGCATGAGCGGGGCGCCGGCGAGACGCGTTCGTGCGGCACCGGGGCCTGCGCCGTCATGGTGGCCGCCGCCCGGCGGGACGGACACGATCCGCGACAGGACGGCGCCCCGGTCACCTACACCGTGGAGGTGCCCGGCGGACAGCTGGAGATCACCGAGCGGACGGACGGGGAGATCGAGATGACAGGCCCGGCCGTGATCGTCGCGGAGGGCCGGATCGACCCCGGCCTCCTCGTGTAG lysP Sequence:
Claims
1. A genetically engineered Streptomyces albopictus strain that produces high levels of ε-polylysine, characterized in that, The genetically engineered *Streptomyces albopictus* strain used as the chassis strain was *Streptomyces albopictus* that had been domesticated to ε-polylysine tolerance, and the following gene expression cassettes were integrated into the genome of the chassis strain: Phosphoenolpyruvate carboxylase gene PPC The overexpression box; Heterogeneous aspartate semialdehyde dehydrogenase gene asd The expression box; Diaminopimelic acid epimerase gene dapF The overexpression box; A fusion gene expression cassette, the fusion gene expression cassette containing a nucleotide sequence encoding a fusion protein, the fusion protein being composed of a secretion signal peptide linked to an L-lysine transporter LysP; Mutated ε-polylysine synthase gene pls The expression cassette of the ε-polylysine synthase gene pls In the amino acid sequence of the ε-polylysine synthase encoded by the gene, the aspartic acid at position 404 corresponding to the wild-type sequence of Streptomyces albopictus is mutated to alanine, and the lysine at position 499 is mutated to alanine.
2. The genetically engineered *Streptomyces albopictus* strain with high ε-polylysine production according to claim 1, characterized in that, The tolerance acclimatization refers to the continuous subculturing of the starting strain in a medium containing gradient concentrations of ε-polylysine until a mutant strain tolerant to 30.0 g / L to 40.0 g / L ε-polylysine is obtained.
3. The genetically engineered Streptomyces albopictus with high ε-polylysine production according to claim 1, characterized in that, The aspartate semialdehyde dehydrogenase gene asd Derived from *Testrinatum molybditis*; The L-lysine transporter gene lysP Derived from Escherichia coli; The ε-polylysine synthase gene pls Derived from Streptomyces albopictus; The aspartate semialdehyde dehydrogenase gene asd L-lysine transporter gene lysP and ε-polylysine synthase gene pls The nucleotide sequence was synthesized with optimization based on the codon preference of Streptomyces albopictus.
4. The genetically engineered Streptomyces albopictus with high ε-polylysine production according to claim 1, characterized in that, In the nucleotide sequence encoding the fusion protein, the secretion signal peptide is the signal peptide of an endogenous protein from Streptomyces albopictus; In the fusion protein, the secretion signal peptide is linked to the N-terminus of the L-lysine transporter LysP via a linker peptide.
5. The genetically engineered Streptomyces albopictus strain with high ε-polylysine production according to claim 1, characterized in that, The gene expression cassette was integrated into the genome of the chassis strain using CRISPR / Cas9 gene editing technology, and the genetically engineered Streptomyces albopictus does not contain antibiotic resistance marker genes.
6. A fermentation process for producing high-yield ε-polylysine from genetically engineered Streptomyces albopictus, characterized in that, The genetically engineered Streptomyces albopictus strain with high ε-polylysine production as described in any one of claims 1-5 comprises: The genetically engineered Streptomyces albopictus was inoculated into a fermentation medium for fermentation culture, and a two-stage pH control strategy was adopted during the fermentation process: Phase 1: Microbial growth period, maintaining pH within the neutral range; Phase 2: Product synthesis period, the pH is adjusted down to the acidic range and maintained within this range until fermentation is complete.
7. The fermentation production process of the genetically engineered Streptomyces albopictus with high ε-polylysine production according to claim 6, characterized in that, The pH range of stage one is 6.8-7.2; The pH range for stage two is 4.0-4.5; The second stage begins 24-30 hours after fermentation begins.
8. The fermentation production process of the genetically engineered Streptomyces albopictus with high ε-polylysine production according to claim 6, characterized in that, The fermentation medium contains a carbon source, a nitrogen source, and inorganic salts; The components of the fermentation medium are: Glucose 55.0-65.0 g / L, yeast powder 8.0-12.0 g / L, (NH4)2SO4 8.0-12.0 g / L, MgSO4·7H2O 0.7-0.9 g / L, FeSO4·7H2O 0.04-0.06 g / L, KH2PO4 3.5-4.5 g / L.
9. The fermentation production process of the genetically engineered Streptomyces albopictus with high ε-polylysine production according to claim 6, characterized in that, In the second stage, the residual sugar concentration in the fermentation broth is maintained within the range of 5.0-10.0 g / L by adding glucose solution.
10. The fermentation production process of the genetically engineered Streptomyces albopictus with high ε-polylysine production according to claim 6, characterized in that, The fermentation production process further includes a seed liquid preparation step, which includes: The genetically engineered Streptomyces albopictus was inoculated into an activation medium and cultured at 28-32°C until the logarithmic growth phase to prepare a seed culture. Then, it was transferred to a fermentation medium at an inoculation rate of 8.0%-10.0% (v / v).